ID: 1018709642

View in Genome Browser
Species Human (GRCh38)
Location 6:166488887-166488909
Sequence GATGCCGCAGTTCCTCAGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018709642_1018709651 26 Left 1018709642 6:166488887-166488909 CCCCACTGAGGAACTGCGGCATC 0: 1
1: 0
2: 1
3: 7
4: 82
Right 1018709651 6:166488936-166488958 CCTATTTTAGGATCTATTTTAGG 0: 1
1: 0
2: 0
3: 22
4: 322
1018709642_1018709649 14 Left 1018709642 6:166488887-166488909 CCCCACTGAGGAACTGCGGCATC 0: 1
1: 0
2: 1
3: 7
4: 82
Right 1018709649 6:166488924-166488946 GAAAAACAAGATCCTATTTTAGG 0: 1
1: 0
2: 1
3: 38
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018709642 Original CRISPR GATGCCGCAGTTCCTCAGTG GGG (reversed) Exonic
900350198 1:2230650-2230672 GGTGCCGAAATTACTCAGTGGGG + Intronic
906533991 1:46541315-46541337 GATGCTGAAGTTCCTCAGGCTGG - Intergenic
913225853 1:116697546-116697568 GATGCCTCAGATCCCAAGTGAGG - Intronic
914913775 1:151805885-151805907 GGTGGAGCAGTCCCTCAGTGAGG - Exonic
914950420 1:152109109-152109131 GATGGCGCAGTTCCTCTTCGCGG + Exonic
917702047 1:177591349-177591371 GATGCTGCAGGTCATCACTGAGG - Intergenic
921584498 1:216931412-216931434 GAAGGAGCAGTTTCTCAGTGTGG - Intronic
923022009 1:230172292-230172314 GAGGCCCCAGTTCCTCACTGGGG - Intronic
1068173314 10:53423344-53423366 CATGCTGCAGTTCCACAGTTTGG - Intergenic
1068645559 10:59462960-59462982 GATTGGGCAGTTTCTCAGTGAGG - Intergenic
1068707562 10:60093486-60093508 GATGCCTCAGTTCCTCTGGTGGG - Intronic
1070910350 10:80112410-80112432 AAGGGCACAGTTCCTCAGTGTGG - Intergenic
1071093565 10:81947833-81947855 GATGCCTGAGTTTCTCACTGAGG - Intronic
1072752171 10:97989052-97989074 GATGCCCCAGCTCTGCAGTGAGG - Intronic
1074857294 10:117482766-117482788 GATGCCTCAGTCCCCCAGTGAGG - Intergenic
1078420036 11:11203233-11203255 CAAGGGGCAGTTCCTCAGTGTGG - Intergenic
1085337372 11:75706446-75706468 GAGGGCGCAGTTCCTCACCGCGG + Intergenic
1085732485 11:79011534-79011556 GATGCCCAGGTTCCTGAGTGTGG + Intronic
1087188818 11:95231182-95231204 GCCGCCGCAGCGCCTCAGTGCGG + Exonic
1087317738 11:96623771-96623793 GATGCCTCACTTCCTCATGGAGG + Intergenic
1088825992 11:113495201-113495223 GATGCAGCAGTTTTACAGTGAGG - Intergenic
1089386063 11:118068814-118068836 GATGCCGCTGGGCCTCTGTGGGG - Intergenic
1090806477 11:130205605-130205627 AATGCCGCCATTTCTCAGTGTGG - Intronic
1090831191 11:130421940-130421962 GATGCCTCTGCTCCTCAGGGGGG - Intronic
1102165649 12:110804437-110804459 GAAGCCCCAATTCCTCAGTGTGG - Intergenic
1103685668 12:122730267-122730289 GATGCCGCCGCTGCTCATTGTGG - Exonic
1108810582 13:54219151-54219173 GATGCGGCATTGCCTCAGAGGGG + Intergenic
1110189524 13:72714943-72714965 CATTCGGCAGTTCCCCAGTGAGG - Intronic
1112297309 13:98199238-98199260 GATGTCTCAGTTCCTCAGTGAGG + Intronic
1113310028 13:109122110-109122132 GATGCCACAGGTCCTGGGTGGGG - Intronic
1113675121 13:112201896-112201918 GATGCCACAGGTCTCCAGTGGGG - Intergenic
1114795105 14:25705030-25705052 AATGCCTGAGTTCTTCAGTGAGG - Intergenic
1118746008 14:68773724-68773746 GATGCCGCAGGAACACAGTGGGG + Intergenic
1121105132 14:91274425-91274447 AAGGCTGCAGTTCCTGAGTGGGG - Intronic
1121401534 14:93682159-93682181 GATGCTGAAGTTCCCCTGTGGGG + Intronic
1128703746 15:69822861-69822883 GAGGGCGCAGGACCTCAGTGTGG + Intergenic
1129960569 15:79680913-79680935 GATGCTGCAGTGACTCACTGAGG - Intergenic
1130940471 15:88504169-88504191 GAAGCCTCAGTTCCTCAGCAAGG + Intergenic
1131039837 15:89254066-89254088 GATGCCATAGTTGCTCGGTGCGG + Intronic
1135166004 16:20139643-20139665 GCTGGCTCAGTTCCTCTGTGGGG + Intergenic
1142146410 16:88494663-88494685 GAGGCCGCAGGGCCTGAGTGGGG + Intronic
1150934455 17:69620024-69620046 GATGTGGCAGCTCCTGAGTGGGG + Intergenic
1152672044 17:81614389-81614411 GCTGCCTCAATTCCCCAGTGAGG + Intronic
1160436673 18:78857203-78857225 GAGGAGGCAGCTCCTCAGTGTGG + Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1164683565 19:30151920-30151942 GATGCAGCTGTCCCTGAGTGTGG + Intergenic
1167049737 19:47071078-47071100 GAAGGCTCAGTGCCTCAGTGGGG - Intronic
927257649 2:21054214-21054236 GATGGGGCCGGTCCTCAGTGAGG - Intergenic
929896675 2:45966879-45966901 GCTGTCGCTCTTCCTCAGTGAGG + Intronic
935335441 2:102011252-102011274 GATCCAGCAGTTCCTCTTTGGGG - Intronic
935662208 2:105476811-105476833 GATGCCACATTTCCTATGTGCGG + Intergenic
936263267 2:110980105-110980127 GATTTCACAGTTCCTCAATGTGG - Intronic
938232717 2:129675407-129675429 GAAGCCACACTTCCTCAGTGTGG + Intergenic
948628122 2:239283252-239283274 TAAGCCTCAGTTCCTCAGAGAGG - Intronic
949070304 2:242020489-242020511 GATGTGGCTGTTCCTCTGTGAGG + Intergenic
1171151027 20:22826666-22826688 AATGCCACAGTCCCTCAGAGAGG + Intergenic
1173108510 20:40161947-40161969 GATGCTACAGTTCCCCAGTGAGG - Intergenic
1173141436 20:40488223-40488245 GATGCCTCAGTTTCTCAGCAAGG - Intergenic
1174393581 20:50232913-50232935 GTTGCCTCACTTCCTCAGTGTGG + Intergenic
1175995691 20:62811400-62811422 GAAGCCCCGGTTCCTGAGTGTGG - Intronic
1182302031 22:29342293-29342315 GGTGCAGCAGGTCCTCAGTTTGG - Exonic
1185097955 22:48821925-48821947 GAAGCCCCAGTGCCTCCGTGGGG - Intronic
949188440 3:1221334-1221356 GAGGCTGCAGTTCCGCATTGAGG - Intronic
954991424 3:54843823-54843845 GATGCTGCAGTTTCTAACTGGGG + Intronic
961379406 3:126487433-126487455 GAGGCTGCAGTTCCGCACTGCGG - Intronic
979155700 4:117386807-117386829 AATGCCTGAGGTCCTCAGTGAGG + Intergenic
982131451 4:152232510-152232532 GATGCTGCAGCTACTCTGTGGGG - Intergenic
991610153 5:68441377-68441399 GAAGTGGCTGTTCCTCAGTGGGG + Intergenic
993724779 5:91355012-91355034 GCTGACTCAGTTCCCCAGTGAGG + Intergenic
996524497 5:124463675-124463697 GACACAGCAGCTCCTCAGTGAGG + Intergenic
1003035781 6:2639243-2639265 GATCCCGCAGTGCATCACTGGGG - Intergenic
1005807557 6:29488635-29488657 GATGCAGCAGTGCCACAGTATGG + Intergenic
1006418427 6:33918886-33918908 GATGCCTCATGTCCACAGTGAGG + Intergenic
1009863465 6:69366035-69366057 AGTGCCCCAGTTCCTGAGTGAGG - Intronic
1010496442 6:76538188-76538210 GATTACACAGTTCCACAGTGGGG + Intergenic
1017125276 6:151059017-151059039 GTTGAGGCAGTGCCTCAGTGAGG + Intronic
1017888773 6:158622315-158622337 GATGCCCCAGTCCCTGTGTGTGG + Intronic
1018709642 6:166488887-166488909 GATGCCGCAGTTCCTCAGTGGGG - Exonic
1019163182 6:170082348-170082370 GATGGCGGACTTCCTCAGGGTGG + Intergenic
1022950955 7:35337443-35337465 GCTCCAGCAGTTCCTCAGTTTGG - Intergenic
1025057426 7:55776344-55776366 GACCCCCCAGTTCCTCAGTGTGG + Intergenic
1032480027 7:132238939-132238961 GATTCCCCAGTGACTCAGTGAGG + Intronic
1033455315 7:141497744-141497766 CATGCCGCAGTTTCTAAGAGTGG - Intergenic
1036200526 8:6767486-6767508 GCTGAGTCAGTTCCTCAGTGGGG - Intergenic
1037701439 8:21278444-21278466 GAAGCTGCAGTGGCTCAGTGTGG - Intergenic
1037934167 8:22903509-22903531 GAGGCAGCAGTTCCTGAATGGGG + Intronic
1042779494 8:72475410-72475432 GAAGCCCCAGTACCTGAGTGAGG + Intergenic
1046983025 8:120357325-120357347 GAGGGCTCAGTTCCTCACTGTGG + Intronic
1056235352 9:84588519-84588541 GATTCTGCAGTATCTCAGTGAGG + Intergenic
1061916269 9:133756056-133756078 ACTCCCCCAGTTCCTCAGTGTGG - Intergenic
1186323119 X:8452038-8452060 GCTTCCACAGTTCCACAGTGTGG + Intergenic