ID: 1018709793

View in Genome Browser
Species Human (GRCh38)
Location 6:166490150-166490172
Sequence GTATCGTTTTACCATGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018709793_1018709800 18 Left 1018709793 6:166490150-166490172 CCAGTCACATGGTAAAACGATAC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1018709800 6:166490191-166490213 ACCAGGAGTGCTATATGAATGGG 0: 1
1: 0
2: 1
3: 15
4: 127
1018709793_1018709799 17 Left 1018709793 6:166490150-166490172 CCAGTCACATGGTAAAACGATAC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1018709799 6:166490190-166490212 AACCAGGAGTGCTATATGAATGG 0: 1
1: 0
2: 1
3: 6
4: 96
1018709793_1018709802 19 Left 1018709793 6:166490150-166490172 CCAGTCACATGGTAAAACGATAC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1018709802 6:166490192-166490214 CCAGGAGTGCTATATGAATGGGG No data
1018709793_1018709803 27 Left 1018709793 6:166490150-166490172 CCAGTCACATGGTAAAACGATAC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1018709803 6:166490200-166490222 GCTATATGAATGGGGTCAGCAGG No data
1018709793_1018709796 1 Left 1018709793 6:166490150-166490172 CCAGTCACATGGTAAAACGATAC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1018709796 6:166490174-166490196 GAGTCCTGCCAAGGTCAACCAGG 0: 1
1: 0
2: 2
3: 4
4: 138
1018709793_1018709794 -8 Left 1018709793 6:166490150-166490172 CCAGTCACATGGTAAAACGATAC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1018709794 6:166490165-166490187 AACGATACCGAGTCCTGCCAAGG 0: 1
1: 0
2: 0
3: 0
4: 48
1018709793_1018709804 30 Left 1018709793 6:166490150-166490172 CCAGTCACATGGTAAAACGATAC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1018709804 6:166490203-166490225 ATATGAATGGGGTCAGCAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018709793 Original CRISPR GTATCGTTTTACCATGTGAC TGG (reversed) Intronic
900870395 1:5298078-5298100 GTGTCATCCTACCATGTGACTGG - Intergenic
900968445 1:5975847-5975869 AGATCGTCCTACCATGTGACTGG + Intronic
901339561 1:8483631-8483653 GTATCTCTCTACCATGTGTCAGG + Intronic
907714029 1:56911282-56911304 ACTTAGTTTTACCATGTGACAGG + Intronic
921583411 1:216921921-216921943 TTAAGGTTTTACCATGTGCCAGG - Intronic
1066517737 10:36182663-36182685 TTATCATTTTACCAACTGACAGG - Intergenic
1068845335 10:61665393-61665415 GTTTAGTTTTACCATGTAAAGGG - Intronic
1073738128 10:106373509-106373531 TTATTTTTTTAGCATGTGACTGG - Intergenic
1087210759 11:95444473-95444495 GTATTGTGTTAGCATGTTACTGG - Intergenic
1090304572 11:125680011-125680033 GACTCGTGTCACCATGTGACTGG + Intronic
1101057787 12:100936948-100936970 GTATCGTTTAACCAAGTCAGAGG - Intronic
1102670479 12:114614762-114614784 GTATGTGTTTACTATGTGACAGG + Intergenic
1103816235 12:123659164-123659186 GCATAGAATTACCATGTGACTGG + Intronic
1111175591 13:84591228-84591250 GTATCTTTTTAGGATGTGAAAGG - Intergenic
1113105882 13:106771354-106771376 GTTTTGTTTTACCATGGGAGTGG - Intergenic
1114808344 14:25864232-25864254 GTATCTATTTACCCTATGACAGG + Intergenic
1122046887 14:99030157-99030179 TTATCCATTTACCATATGACTGG - Intergenic
1123891738 15:24787985-24788007 GTATCATTTTACCAATTGAATGG + Intergenic
1126760531 15:51966085-51966107 GTATCTTTTCATCATCTGACTGG + Exonic
1128701818 15:69810140-69810162 GTGTCGTTTGAACATGTGATTGG - Intergenic
1129582678 15:76829665-76829687 GTACCTTTTTAGCATATGACTGG + Intronic
1136566770 16:31075067-31075089 GTATTATATTACCATGTGCCAGG - Intronic
1143948493 17:10614961-10614983 TTATAGTTATAACATGTGACAGG + Intergenic
1146515776 17:33488155-33488177 GTATCAGTTTACCAAGTGAGAGG + Intronic
1155761905 18:29578578-29578600 GTATGGTTTTACTATGTGTCAGG + Intergenic
1158184390 18:54754857-54754879 ATATCTTATAACCATGTGACTGG + Intronic
929380464 2:41344560-41344582 GTTTGGTTTCTCCATGTGACAGG + Intergenic
936807256 2:116350119-116350141 GTATCTTTTTAGCATTTGGCAGG + Intergenic
941712742 2:168731585-168731607 GTATCATTTGACCATGGGAAGGG + Intronic
942264532 2:174208569-174208591 ATATCAATTTACCATGTGATGGG + Intronic
947333423 2:229054549-229054571 GTAACATTTTTCCCTGTGACTGG - Intronic
947650932 2:231786058-231786080 TGAGCGTTTTACCATGTGCCAGG - Intronic
1173001238 20:39107219-39107241 TTATCTTCTTACCAGGTGACAGG + Intergenic
952302161 3:32112827-32112849 ATTTCGTTTAAACATGTGACAGG + Intronic
956671885 3:71698885-71698907 GTATGTTTTTAACCTGTGACTGG - Intronic
967427484 3:189344111-189344133 GTATTGTGTTAACATGTTACTGG - Intergenic
967427788 3:189347414-189347436 GTATTGTGTTAACATGTTACTGG - Intergenic
970686319 4:18571748-18571770 GTATCATTTTACTGAGTGACTGG - Intergenic
972021549 4:34322530-34322552 GTATCGCTTTTCACTGTGACAGG - Intergenic
976380203 4:84390354-84390376 GTGTCGTTTTACTATGGGAAGGG + Intergenic
983391711 4:167140472-167140494 GTATAGTTATACTAGGTGACAGG + Intronic
987496675 5:18653588-18653610 GTTTCATTTTCCCTTGTGACCGG + Intergenic
988515215 5:31898621-31898643 GCATCACTTTGCCATGTGACAGG - Intronic
994684513 5:102932872-102932894 GTAGAGTTTTTCCATGTAACTGG + Intronic
994909732 5:105887348-105887370 GTATGCTTTTACTATTTGACAGG + Intergenic
1001339323 5:170829038-170829060 GTAGGGTTTTGCCATGTGGCCGG + Intergenic
1004097067 6:12566967-12566989 ATAATGTTTTAGCATGTGACAGG + Intergenic
1012224380 6:96688039-96688061 GTTTTGTTTTCCCCTGTGACAGG - Intergenic
1012942293 6:105428066-105428088 ATATGGTGTAACCATGTGACCGG - Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1018709793 6:166490150-166490172 GTATCGTTTTACCATGTGACTGG - Intronic
1020051096 7:5082309-5082331 GTTTCCATTTACCATGTGTCTGG + Intergenic
1037001498 8:13724584-13724606 GTATTGATTTACTATGTGATAGG + Intergenic
1038167725 8:25101823-25101845 GTAACATGTTACCATGTAACAGG + Intergenic
1041756665 8:61321232-61321254 GTGTTGTTTTCCCATGTGAAGGG + Intronic
1045612671 8:103864597-103864619 TTATTTTTTTACCATGTGTCAGG - Intronic
1047886560 8:129256978-129257000 ATATCCTCTTAGCATGTGACAGG + Intergenic
1051197956 9:14584421-14584443 GTAACCATTTACCATGTGCCAGG - Intergenic
1051487623 9:17625819-17625841 GTATCGTTTTTCAGTGTGAAAGG + Intronic
1059872622 9:118594891-118594913 GTATCTGTTTTTCATGTGACAGG + Intergenic
1060422119 9:123476702-123476724 GTATGCTCTTACCATGTGCCAGG + Intronic
1196264511 X:113626426-113626448 GTATTGTGTTACACTGTGACAGG + Intergenic