ID: 1018715640

View in Genome Browser
Species Human (GRCh38)
Location 6:166530498-166530520
Sequence AAACTGACCCCCTGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018715640_1018715645 21 Left 1018715640 6:166530498-166530520 CCTCCTCCCCAGGGGGTCAGTTT 0: 1
1: 0
2: 1
3: 25
4: 222
Right 1018715645 6:166530542-166530564 CAGTTCATCTGTCCAGTGCCCGG 0: 1
1: 0
2: 1
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018715640 Original CRISPR AAACTGACCCCCTGGGGAGG AGG (reversed) Intronic
900604337 1:3517088-3517110 AAACAGGGCCCCTGGGAAGGCGG - Intronic
900788219 1:4663044-4663066 CCACTGCCCCCCTGGGAAGGGGG - Intronic
900794615 1:4700533-4700555 GAGCTGACCCCCAGGGGATGAGG + Intronic
901181000 1:7341844-7341866 GAGCTGGCCTCCTGGGGAGGAGG + Intronic
902292769 1:15446256-15446278 AAACTGACCCCCTGAGGGTATGG + Intronic
902836805 1:19052817-19052839 AAGGTGACCCGGTGGGGAGGAGG - Intergenic
902970593 1:20045302-20045324 TACTTGCCCCCCTGGGGAGGTGG + Intronic
903390984 1:22963389-22963411 AAAGTGTGCCCTTGGGGAGGAGG + Intronic
903876017 1:26473187-26473209 AAACAAACCCCCTCCGGAGGCGG - Intronic
904756287 1:32770536-32770558 CCACTGCCTCCCTGGGGAGGGGG - Exonic
905882566 1:41474271-41474293 AAACTGAGGCCCTGGGGAGGCGG - Intergenic
908775800 1:67638710-67638732 CAAATCACCCCCTGGGGAGTGGG - Intergenic
911883019 1:103265693-103265715 AAACCCACCCCCAGGGGAGTGGG + Intergenic
913530328 1:119729464-119729486 AAGAGGACCCCCTGGGGAAGGGG - Intronic
914803244 1:150975008-150975030 AAACCGCCGACCTGGGGAGGCGG + Intergenic
916187424 1:162146507-162146529 ACTCTGACACCCTGGGGAGTTGG - Intronic
922705208 1:227787021-227787043 ACACTCACCCCCTGGAAAGGAGG + Intergenic
923656411 1:235920875-235920897 AGCCTGAATCCCTGGGGAGGGGG + Intergenic
924289992 1:242526147-242526169 AATCTCAGCCCCTTGGGAGGAGG + Intergenic
924650800 1:245925465-245925487 AAACTGACCCCTTGGAGCAGAGG - Intronic
1065787410 10:29229527-29229549 TGGCTGATCCCCTGGGGAGGAGG + Intergenic
1066426023 10:35308534-35308556 AGAGTGAGCCCATGGGGAGGAGG + Intronic
1067558292 10:47287257-47287279 ACTCAGACCCCATGGGGAGGCGG + Intergenic
1069707349 10:70467209-70467231 AAAGAGGCCCCCTGGGGAGCTGG + Intergenic
1071472189 10:85991513-85991535 GGACTGCCCCTCTGGGGAGGTGG + Intronic
1071522241 10:86338559-86338581 TAACAGCCCCCCAGGGGAGGGGG + Intronic
1072357285 10:94624127-94624149 AGACTGACCTCCTGGGAAGAAGG + Intergenic
1073215763 10:101835317-101835339 AAACTGAGGCCCAAGGGAGGGGG + Intronic
1073427847 10:103466872-103466894 AAACTGGTCAGCTGGGGAGGAGG - Intergenic
1074734049 10:116409512-116409534 AAACAGGCCCCTTGGAGAGGGGG - Intergenic
1075209304 10:120477690-120477712 ACAGTGAGCCCCTTGGGAGGAGG + Intronic
1075341946 10:121653912-121653934 CTACTGAGCACCTGGGGAGGGGG - Intergenic
1075527877 10:123201553-123201575 AAACAGACACCCTGGGGGAGAGG + Intergenic
1076642338 10:131927274-131927296 AAACTCTCCCCCCGGGGAGTGGG + Intronic
1077807296 11:5603003-5603025 AAACTGAGGCCCTGGAAAGGAGG - Intronic
1079902276 11:26202067-26202089 AAACTGATCCCCTGGAGATTGGG + Intergenic
1081647350 11:44799175-44799197 GGACAGGCCCCCTGGGGAGGGGG - Intronic
1081912149 11:46706587-46706609 AGACTGAACACCTTGGGAGGTGG + Intergenic
1083420773 11:62551818-62551840 ACACTGCCTCCCTGGGGAGTGGG + Intronic
1084612490 11:70212494-70212516 AATCTGAAACCCTGGGGCGGAGG - Intergenic
1085696720 11:78711021-78711043 AAACTGAGGCCCAGAGGAGGAGG + Intronic
1088717825 11:112564362-112564384 AAACTGGAACCCTAGGGAGGGGG - Intergenic
1089528605 11:119112615-119112637 AAGCTGACCCCTGGGGTAGGTGG + Intronic
1091772414 12:3161527-3161549 AAACCCACCACCTGGGGAGCAGG + Intronic
1098472361 12:70860019-70860041 AAACTTAACCCCTGAGGAGGGGG - Intronic
1100401404 12:94233249-94233271 CAACTGAGGCCCTGGGGAGAGGG + Intronic
1102026944 12:109719036-109719058 AAACGGAGACCCTGGGGAAGGGG + Intronic
1102693448 12:114779684-114779706 AAACTGAGGCCCTGAGGTGGAGG + Intergenic
1104719795 12:131038964-131038986 AGGCTGTCCCCCTAGGGAGGAGG + Intronic
1105250936 13:18698030-18698052 AAACAGACCCCCAGGTGGGGAGG - Intergenic
1110247139 13:73339614-73339636 AAACTGAGGCTCTAGGGAGGTGG + Intergenic
1111951491 13:94712301-94712323 AAACTGCCGCCGCGGGGAGGGGG - Exonic
1112250499 13:97774725-97774747 AATCTGAGCACCTCGGGAGGCGG - Intergenic
1112455010 13:99552195-99552217 AATCTGATCCTCTGGGGAGAAGG + Exonic
1115909656 14:38241455-38241477 AAACTGACGGCTTGGAGAGGAGG + Intergenic
1116428670 14:44820738-44820760 GAACTGAGCCCCTGTGGGGGAGG + Intergenic
1118041436 14:61921283-61921305 AAAGTGACACCCCGGGCAGGAGG - Intergenic
1119472005 14:74906243-74906265 ACACAGGCCCACTGGGGAGGAGG + Exonic
1121313147 14:92945941-92945963 AAACTGAGGCCCTAGAGAGGAGG - Intronic
1121706768 14:96002201-96002223 ACACTGAACTCCTGGGGAGGGGG + Intergenic
1122756966 14:103989439-103989461 AAACTGAGCTCCTTGGCAGGAGG + Intronic
1125896928 15:43310354-43310376 AACCTGGCCCCCTGGAGATGTGG - Intergenic
1128449556 15:67796984-67797006 AAACTGACCCCCAGGGAGGCTGG + Intronic
1129914834 15:79259720-79259742 AAATTTACCCTCTGGGCAGGGGG - Intergenic
1130944436 15:88540387-88540409 AAACTCACTCCCTGGGGGGCTGG - Intronic
1131468159 15:92672441-92672463 AAACTGAGGCCCAGGGGAGGTGG - Intronic
1133098112 16:3461341-3461363 AGAGTGCCCCCCTGCGGAGGTGG + Intronic
1133233000 16:4375125-4375147 CAAGTGAGCCCCTGGGGCGGTGG - Intronic
1133871240 16:9688345-9688367 AAACTGAGCCCCAGGTTAGGTGG - Intergenic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1134216345 16:12319766-12319788 ATACTGACCACCTGGGGCTGTGG - Intronic
1136516617 16:30772424-30772446 AAACTGACAGTCAGGGGAGGAGG + Intronic
1138412029 16:56848216-56848238 AAAATGAACCCCTGGGCTGGCGG + Intronic
1140201031 16:72894857-72894879 AGAGTCACCCGCTGGGGAGGAGG + Intronic
1141763882 16:86046187-86046209 AGGCTGGCCCCCTGGGGAAGTGG + Intergenic
1143976226 17:10831899-10831921 AAACTGGCCTCCAGGGGAGAAGG - Intronic
1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG + Intronic
1144797926 17:17904995-17905017 TTACTGACCCCCAGGGGTGGAGG - Intronic
1144952517 17:19001907-19001929 AAACTGAGGCCATGGGTAGGGGG - Intronic
1147330474 17:39696276-39696298 GAACTCACGCCCTGGGGAGGAGG - Intronic
1147387949 17:40092705-40092727 AAACTGACCAGATGGAGAGGTGG + Intronic
1147776045 17:42902151-42902173 AAACTGACTCTCTGGGGAGCAGG + Intronic
1148632067 17:49118720-49118742 AAACTGAACCCATGGCCAGGGGG - Intergenic
1151382678 17:73736451-73736473 ATATTGACACCCTGGGGAGAGGG + Intergenic
1151986700 17:77548435-77548457 AGACCGCCCACCTGGGGAGGGGG - Intergenic
1155165477 18:23228705-23228727 AAACTGGCCCACGGGGGTGGGGG - Intronic
1155270123 18:24132791-24132813 TAACTAACCACCTGGGGAGAGGG + Exonic
1155750782 18:29420516-29420538 AAAGTGACCCCCAGGAGTGGGGG + Intergenic
1156177613 18:34565378-34565400 AAACTGGGCCCTTGGGCAGGGGG + Intronic
1156239181 18:35235546-35235568 AATCAGAACACCTGGGGAGGGGG - Intergenic
1157198631 18:45640334-45640356 AAACTGAGCCCCTGGAGCTGAGG + Intronic
1157681679 18:49612643-49612665 AAACAGACTGCTTGGGGAGGCGG - Intergenic
1160849643 19:1184137-1184159 AAACTGGCCCTCAGAGGAGGTGG - Intronic
1161645607 19:5451558-5451580 AAACTGAGCCCCAGAGGAGGGGG - Intergenic
1162379403 19:10322832-10322854 AAACTGACACTCTGGGGCCGGGG + Intronic
1162827789 19:13264291-13264313 AAGGTGACCCACTGGGGATGGGG - Intronic
1163395504 19:17058099-17058121 AAACTCACCCACTGGGTGGGGGG + Intronic
1164764518 19:30753909-30753931 ACACTGACCCCCAGGGAAGGTGG + Intergenic
1164885038 19:31771277-31771299 AATCTGAGCCTCTGTGGAGGGGG - Intergenic
1165522930 19:36328713-36328735 AAACTCACTCCCTGGGGGGCTGG + Intergenic
925254744 2:2473661-2473683 GAACTGACACCATGGGTAGGTGG + Intergenic
925739353 2:6992263-6992285 AAACAGAAACTCTGGGGAGGTGG - Intronic
926092824 2:10061538-10061560 AAGCTGAGCCCTGGGGGAGGTGG + Intronic
927135722 2:20094686-20094708 ACACTGAATGCCTGGGGAGGGGG + Intergenic
927654635 2:24935117-24935139 AAACTGGCTCCCTTGGGAGGGGG - Intergenic
928421510 2:31140487-31140509 AAACTGAGGCCCTGGGGTGAAGG + Intronic
931257244 2:60584388-60584410 AAACTGCCCACTTGGGAAGGGGG + Intergenic
932090297 2:68800140-68800162 GAACTGATACCCTGGGAAGGAGG + Intronic
933573004 2:84035793-84035815 ACACTCACAGCCTGGGGAGGAGG + Intergenic
933978752 2:87533427-87533449 AAAATGACTCCCTTAGGAGGTGG + Intergenic
934037043 2:88096893-88096915 CAACTGTCACCCTGGGGAGGAGG + Intronic
934038592 2:88109123-88109145 AAACTGAGGCCCAGGGAAGGAGG + Intronic
936315080 2:111417367-111417389 AAAATGACTCCCTTAGGAGGTGG - Intergenic
936589358 2:113788542-113788564 AAACTGGGACACTGGGGAGGTGG - Intergenic
947662880 2:231882868-231882890 CACCTTTCCCCCTGGGGAGGCGG - Intergenic
948017585 2:234702765-234702787 ACTCTGACCCCCGGGGTAGGTGG - Intergenic
948883841 2:240873389-240873411 AAACTGAGCCTCTGGGGGGTTGG - Intronic
1168854582 20:999723-999745 TCACTGAGCTCCTGGGGAGGTGG + Intronic
1169142725 20:3235385-3235407 CACCTGCCCTCCTGGGGAGGCGG - Intronic
1170571931 20:17637438-17637460 ACAATGAGCCCCTGGGGTGGGGG + Intronic
1171419548 20:25008671-25008693 ATTCTGACCCCCTGGGTTGGGGG + Intronic
1173026193 20:39309721-39309743 AAACAGATCCCCTGGGGACTAGG + Intergenic
1175093972 20:56527393-56527415 AACCTGGCCCCTTGGGGAAGTGG - Intergenic
1175096901 20:56548424-56548446 AACCTGGCCCCTTGGGGAAGTGG - Intergenic
1175213894 20:57379604-57379626 AAACTATCCCCTTGGGGAGGTGG - Intergenic
1175252136 20:57616220-57616242 TAACTGCCACCCCGGGGAGGCGG - Intronic
1175438553 20:58973296-58973318 AAAGTGACCCCAGGGGCAGGAGG - Intergenic
1175924299 20:62464545-62464567 ACACTGGCCCCCTGCGGCGGAGG - Exonic
1176114194 20:63423965-63423987 AAACCGAATCACTGGGGAGGGGG + Intronic
1176163043 20:63658250-63658272 AAACTGTTCCCCCGCGGAGGGGG - Intronic
1176234948 20:64049724-64049746 AAAGGGAGCCCCCGGGGAGGAGG - Intergenic
1177388129 21:20433444-20433466 CATCTGAGCCCCTGGGGAGAGGG + Intergenic
1178478939 21:32962434-32962456 TTACTGAGCCCCTGGGGAAGAGG - Intergenic
1179634359 21:42697813-42697835 AATCTTACCCACTGGGGATGAGG + Intronic
1179790788 21:43754836-43754858 AAACTGACTTGTTGGGGAGGAGG - Intronic
1179995724 21:44973280-44973302 GAGCTGAACCCCTGAGGAGGTGG - Intronic
1180080865 21:45487007-45487029 CACCTGACCCCCTGGAGAGCCGG + Intronic
1181085949 22:20439388-20439410 GCACTGACCCCCTGGGCTGGAGG + Intronic
1181440221 22:22931854-22931876 AAACTGACTCTCTGGGTGGGGGG + Intergenic
1181727486 22:24821514-24821536 TGAATGTCCCCCTGGGGAGGTGG + Intronic
1181864430 22:25844099-25844121 AAGCTGGCCTCCTGGGGAGGTGG + Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183425203 22:37735384-37735406 AGACGGGCCCCCTGGGGAGCAGG + Exonic
1183456399 22:37925513-37925535 AGACTGTCCCCATGGGGATGGGG + Intronic
1185012349 22:48321260-48321282 AGGCTGAACCCCTAGGGAGGAGG - Intergenic
950433233 3:12963591-12963613 AAAAGAAACCCCTGGGGAGGGGG - Intronic
950809998 3:15641995-15642017 CACCTGACCACCTGGGGAGACGG - Exonic
951040577 3:17984592-17984614 AAACTGAGCCCCAGGGAAGCAGG - Intronic
952958561 3:38575768-38575790 AAACTGTCCCCCTGGGAAAATGG + Intronic
954394894 3:50288287-50288309 AGAGTGACACCCTGGGGAGCTGG + Intronic
954995245 3:54875257-54875279 AAACTGACACATAGGGGAGGAGG + Intronic
959926042 3:111922961-111922983 AAACTGACCCCAGGGGGTGAGGG - Intronic
961131911 3:124476692-124476714 AGAGTGACCCCCTGGGGCAGAGG - Intronic
961524223 3:127486393-127486415 AAACCTTTCCCCTGGGGAGGTGG + Intergenic
961547358 3:127644587-127644609 AAACGAATCCCCTGGGGAGGGGG - Intronic
963525474 3:146409839-146409861 AAACTCACTCCCTGGGGGGCTGG + Intronic
965520676 3:169665868-169665890 AGACAGACCCCCTGGGGATGAGG - Intergenic
966643568 3:182217337-182217359 ATCTTGACCCTCTGGGGAGGAGG + Intergenic
967590564 3:191269165-191269187 AAACTAAGCCCCTTGGGAGAAGG + Intronic
968074377 3:195808573-195808595 AAACTGAGCCCAGGGGGAAGGGG - Intronic
968612400 4:1563274-1563296 ACACTCACCCCGTGGGGAGCTGG - Intergenic
968659846 4:1794418-1794440 AAACTGGGGCCCGGGGGAGGGGG - Intronic
968969301 4:3785242-3785264 AAACTGAGGCCCTGAGTAGGCGG + Intergenic
973030609 4:45332782-45332804 AAATGGAATCCCTGGGGAGGGGG + Intergenic
975587932 4:75969719-75969741 ATACAGATCACCTGGGGAGGTGG - Intronic
976878580 4:89889657-89889679 AAACTAAAGCCCTGGGGAAGAGG - Intronic
978478683 4:109162844-109162866 AAATTCACTCCCTGGAGAGGAGG - Intronic
978975485 4:114865015-114865037 AAACTGACCCCAAGAGAAGGTGG + Intronic
981295656 4:143127815-143127837 AACCTGTCCCCCTAGGGAAGGGG + Intergenic
981673497 4:147314333-147314355 TAACAGACCCCCAGGGAAGGTGG - Intergenic
984442836 4:179794387-179794409 AAACTCATGCACTGGGGAGGAGG - Intergenic
985492666 5:188446-188468 GAACTGACCACCTGGGGCGTAGG + Exonic
985905673 5:2833904-2833926 TAACTGACCCCTCGGGGACGAGG - Intergenic
985939079 5:3120014-3120036 AAGAAGACCACCTGGGGAGGGGG + Intergenic
986641992 5:9880976-9880998 GGACTGAGCCCCTGGGGAGGAGG + Intergenic
987109425 5:14671383-14671405 AAACTGAGGCCGTGGGGAAGTGG + Intronic
987152426 5:15056434-15056456 CACATTACCCCCTGGGGAGGTGG - Intergenic
990428520 5:55712170-55712192 AAACTCGCCCCTCGGGGAGGTGG - Intronic
990793773 5:59516276-59516298 AAAGTGACTGCCTGGGGAGGAGG - Intronic
994410570 5:99402869-99402891 AAAATGAACCCCTGGGAAAGGGG + Intergenic
995052211 5:107719533-107719555 AGACTGAGCACCTGGCGAGGGGG + Intergenic
995251712 5:110000900-110000922 AAGCTGGCCTCCTGGGGAGGAGG + Intergenic
995374775 5:111461706-111461728 AAACTGTGCCTCTGGGAAGGAGG - Intronic
997362858 5:133306169-133306191 AAGCTGACCTCCAGGTGAGGTGG + Intronic
998133818 5:139664338-139664360 AAATGGAGCCCCTGGGGAGGGGG - Intronic
998200758 5:140117250-140117272 AAAATGCACCTCTGGGGAGGGGG - Exonic
1000351006 5:160352776-160352798 ATACTAATCTCCTGGGGAGGAGG + Intronic
1001452350 5:171836438-171836460 GAACTGGCCTCCTGGGGATGTGG - Intergenic
1001522303 5:172403364-172403386 AAACTGACCCCTAGGAGAGGGGG + Intronic
1001591583 5:172869180-172869202 GATCTTCCCCCCTGGGGAGGAGG + Intronic
1004420426 6:15464647-15464669 AAAATGAACTCCAGGGGAGGAGG - Intronic
1004743981 6:18491677-18491699 GAGCTGAGCCCCTGTGGAGGGGG - Intergenic
1005613825 6:27553622-27553644 AAACTTGCCCCCAGGGGAGCTGG - Intergenic
1006612191 6:35300851-35300873 AAACTGCTCCCCTGGGTAAGAGG - Intronic
1006678625 6:35781164-35781186 AAAGTGAGCCCCTGGTGAGGAGG - Exonic
1007162358 6:39801795-39801817 ACACTGACCCCCCGGGAATGTGG - Intronic
1011356194 6:86475320-86475342 AAACTCACTCCCTGGGGGGCTGG - Intergenic
1011657678 6:89566397-89566419 CCACTGACCCACTGGGGAAGCGG + Intronic
1017024857 6:150172805-150172827 CATCTGGCCTCCTGGGGAGGAGG - Intronic
1018070963 6:160164086-160164108 ACACTGACTCCCTGGGGTGGGGG - Intergenic
1018471680 6:164102722-164102744 AAAGAGACCACCTGGGGAGGAGG - Intergenic
1018715640 6:166530498-166530520 AAACTGACCCCCTGGGGAGGAGG - Intronic
1019165510 6:170095364-170095386 AAAATGAGCCCCTGGGCAGGAGG + Intergenic
1019321535 7:417710-417732 AAACTGAGGCCCAGGGGCGGGGG - Intergenic
1019369832 7:656026-656048 AAAATGACTTTCTGGGGAGGTGG - Intronic
1021695224 7:23269731-23269753 AAAGTGAGGCCCTGGGGTGGAGG - Intronic
1024241152 7:47437861-47437883 AAACTGACCCGATAGAGAGGTGG + Intronic
1030854638 7:114539746-114539768 AGGCTGACACCCTGTGGAGGAGG + Intronic
1031770418 7:125834349-125834371 AAAATGACACACTGGGGAGTTGG - Intergenic
1032120169 7:129149778-129149800 ACACTGTCCCCCTGGAGTGGAGG - Intronic
1035260776 7:157660216-157660238 AATGTGACCCTCTGGGGAAGAGG + Intronic
1035519523 8:266037-266059 TCAGTGTCCCCCTGGGGAGGGGG + Intergenic
1035752770 8:2007965-2007987 TATCTGACACCCTGGGGTGGGGG - Intergenic
1035752802 8:2008083-2008105 CATCTGACACCCTGGGGTGGGGG - Intergenic
1035752817 8:2008142-2008164 CATCTGACACCCTGGGGTGGGGG - Intergenic
1035752828 8:2008173-2008195 CATCTGACACCCTGGGGTGGGGG - Intergenic
1035752839 8:2008203-2008225 CATCTGACCCCCTGGGGTTGGGG - Intergenic
1035753140 8:2009651-2009673 CATCTGACCCCCTGGGGTTGGGG - Intergenic
1035753148 8:2009681-2009703 CATCTGACACCCTGGGGTGGGGG - Intergenic
1035753165 8:2009740-2009762 CATCTGACCCCCTGGGGTTGGGG - Intergenic
1035753176 8:2009771-2009793 CATCTGACCCCCTGGGGTGGGGG - Intergenic
1036162977 8:6406485-6406507 GAGCTGAGCCCCCGGGGAGGGGG - Intergenic
1036599136 8:10242960-10242982 GAAATGACCCCATGAGGAGGAGG - Intronic
1036661390 8:10711265-10711287 AACCTGTCTTCCTGGGGAGGAGG - Intronic
1038244662 8:25844400-25844422 AAACTGACCCTCTTGGGACAAGG - Exonic
1038764250 8:30412886-30412908 ATACTGACAACCTGGGTAGGAGG - Intronic
1039441096 8:37595849-37595871 AAACTCACTTCCTGGGGAGCTGG - Intergenic
1039549095 8:38430302-38430324 GAACTGAGCATCTGGGGAGGGGG - Intronic
1040474344 8:47763565-47763587 AAACAGTCCCCCTGGGACGGTGG + Intergenic
1042092425 8:65173148-65173170 ACACTGAACCCCTGGGATGGTGG + Intergenic
1045356844 8:101396930-101396952 AAACTGGCCTCCCTGGGAGGTGG + Intergenic
1046638787 8:116702695-116702717 AAGCTGATTCACTGGGGAGGGGG + Intronic
1048423598 8:134302006-134302028 AAACTGAGGCCCAGGGGAGAAGG + Intergenic
1049160701 8:141095813-141095835 AGACTGAGGCCCTGGGGTGGGGG + Intergenic
1057860986 9:98640678-98640700 ATTCTAACCCCCTGGAGAGGAGG + Intronic
1058078384 9:100674043-100674065 AAATTGACCCTATGGGGAAGTGG + Intergenic
1060794017 9:126502808-126502830 AAACTGTCCCGCTGGGTGGGAGG + Intronic
1061721767 9:132556417-132556439 AAGCTGAGCCGCCGGGGAGGGGG - Intronic
1062483869 9:136764667-136764689 GAAATGACCCCCTGGGCTGGGGG - Intronic
1062555434 9:137111694-137111716 AACCTGGACCCCTGGGCAGGGGG - Exonic
1190179962 X:48183849-48183871 AAACTGAAGGCCTGGCGAGGTGG + Intergenic
1195280517 X:103328447-103328469 AAACTGACCCCCTGGGCTGCAGG + Intergenic
1195934317 X:110110661-110110683 AATCAGACCCTCTGGGGATGGGG - Intronic
1198146662 X:133864207-133864229 ATACTGAGCACCTTGGGAGGAGG + Intronic
1199955551 X:152739464-152739486 ATACTGACACCCTGGGGCTGAGG - Intergenic
1200213499 X:154357196-154357218 AAGCTGCCCCTCTGGGCAGGAGG + Intronic
1200523922 Y:4247705-4247727 AAACTGAGCCCCTTGGGGGTGGG + Intergenic
1201763901 Y:17562817-17562839 AAACAGGCCCCCAGGGGAAGGGG - Intergenic
1201837652 Y:18343173-18343195 AAACAGGCCCCCAGGGGAAGGGG + Intergenic