ID: 1018718531

View in Genome Browser
Species Human (GRCh38)
Location 6:166554595-166554617
Sequence CTGGCACGCGGGTGGCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018718523_1018718531 16 Left 1018718523 6:166554556-166554578 CCTAAGTCACGAGGTCTGATGCG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1018718531 6:166554595-166554617 CTGGCACGCGGGTGGCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018718531 Original CRISPR CTGGCACGCGGGTGGCCATG GGG Intronic