ID: 1018722973

View in Genome Browser
Species Human (GRCh38)
Location 6:166587905-166587927
Sequence GAGTGAGTGAGGAGGGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 611}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018722973_1018722981 24 Left 1018722973 6:166587905-166587927 CCCTGCGCCCTCCTCACTCACTC 0: 1
1: 0
2: 2
3: 43
4: 611
Right 1018722981 6:166587952-166587974 TATTTTGTTTTTTATCTGTTTGG 0: 1
1: 3
2: 10
3: 326
4: 3487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018722973 Original CRISPR GAGTGAGTGAGGAGGGCGCA GGG (reversed) Intronic
900182157 1:1315816-1315838 GAGTGAGGGGGGCGGGGGCAGGG + Intronic
900190242 1:1350016-1350038 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190258 1:1350056-1350078 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190274 1:1350096-1350118 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190290 1:1350136-1350158 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190306 1:1350176-1350198 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190322 1:1350216-1350238 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190338 1:1350256-1350278 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190354 1:1350296-1350318 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190370 1:1350336-1350358 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190386 1:1350376-1350398 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190402 1:1350416-1350438 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190418 1:1350456-1350478 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190434 1:1350496-1350518 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190450 1:1350536-1350558 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190466 1:1350576-1350598 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190482 1:1350616-1350638 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190498 1:1350656-1350678 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190514 1:1350696-1350718 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190530 1:1350736-1350758 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190546 1:1350776-1350798 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190562 1:1350816-1350838 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190578 1:1350856-1350878 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190594 1:1350896-1350918 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190610 1:1350936-1350958 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190626 1:1350976-1350998 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190642 1:1351016-1351038 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190658 1:1351056-1351078 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190674 1:1351096-1351118 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190690 1:1351136-1351158 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190706 1:1351176-1351198 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190722 1:1351216-1351238 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190738 1:1351256-1351278 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190754 1:1351296-1351318 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190770 1:1351336-1351358 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190786 1:1351376-1351398 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190802 1:1351416-1351438 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900391570 1:2436150-2436172 GAGGAAGGGAGGAGGGAGCAGGG - Intronic
900493922 1:2967553-2967575 GAGTGACTGAGGCTGGAGCACGG + Intergenic
900932899 1:5747843-5747865 GAGGGAGGGAGGAGGGAGAAGGG + Intergenic
901080270 1:6580131-6580153 GCCTGGGTGAGGAGGGCGCGGGG + Exonic
901115566 1:6841138-6841160 GAGTGAATGAGAAGAGAGCAGGG - Intronic
901144094 1:7053618-7053640 GAGTGAGGGAGGAAGGGGAAGGG - Intronic
901930869 1:12595587-12595609 GAGCGGGTGAGGAGGGGGCCAGG + Intronic
902218531 1:14950071-14950093 GGGTGGGTGTGGAGGGTGCAGGG - Intronic
902814170 1:18906666-18906688 GGGTGAGTGAGGAGAGAGAAGGG + Exonic
903192752 1:21666088-21666110 GTGTGAGTGCCGAGGGAGCATGG + Intronic
903577253 1:24346646-24346668 GAGTAAATGAGGAGGGCGGGAGG - Intronic
903617442 1:24671237-24671259 GTGTGAGTGGGGAAGGCCCAAGG - Intronic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
904565217 1:31424690-31424712 GGGTGTGTGAGGAGGGGGCCGGG + Exonic
904982947 1:34522101-34522123 GAGTGAGTGAGTAAGGAGTAAGG - Intergenic
905293549 1:36939878-36939900 GACTGTGTCAGGAGGGCCCAGGG - Intronic
906162992 1:43664488-43664510 AAGTGAGTGATGAGGCCGGAGGG + Intronic
906483480 1:46216780-46216802 GAGGGAGAGAGGTGGGGGCAAGG - Intronic
906647539 1:47486502-47486524 GTGTGAGTGAGGAGGAGGGAGGG + Intergenic
907246114 1:53110140-53110162 GAGCCAGTGAGGAGGCTGCAGGG - Intronic
907289049 1:53401156-53401178 GAGGGAGAGAAGAGGGAGCAGGG + Intergenic
907305212 1:53509406-53509428 GAGAGAGAGAGGAGGGCCCAGGG + Intronic
908016686 1:59846582-59846604 GAGGGAGGGAGGAGGGAGGAAGG - Intronic
908422211 1:63970069-63970091 GAGTGGGGGAGGAAGACGCAAGG - Intronic
908472256 1:64455776-64455798 GAGGGAGTGGGGAGGGAGAATGG + Intergenic
908732353 1:67239022-67239044 GAGGGAGTGAGGAAGGAGGATGG + Intronic
908878230 1:68701713-68701735 GAGTTGGTGGGGAGGGTGCAGGG - Intergenic
909381465 1:75003742-75003764 GAGTGAGAGAGGAAGGTGCTAGG - Intergenic
909476666 1:76088596-76088618 GAGTGATTGAGGAGAGAACAGGG - Intronic
911396360 1:97315505-97315527 GAGGGAGTTAGGAGGGCCAAAGG - Intronic
912230616 1:107788333-107788355 GAGTGAGGGTGGAAGGGGCAGGG - Intronic
912552210 1:110491654-110491676 GAAAGAGTGAGCAGGGAGCATGG + Intergenic
912766610 1:112418366-112418388 GAGTGAGTGAGGAGGATTCTGGG - Intronic
913109146 1:115642178-115642200 GAATGCGGGAGGAGGGCGCAGGG - Intronic
914675285 1:149903479-149903501 GAGTGAGGGACAAGGGCACAGGG + Exonic
914902991 1:151721734-151721756 GATAAAGTGGGGAGGGCGCAGGG + Intronic
915329837 1:155103999-155104021 GAGGGAGGGAGGAGGGAGGAAGG + Intergenic
915552627 1:156644187-156644209 GAGTGAGGGAAGAGGGCCTAAGG - Intronic
915908743 1:159899256-159899278 GAGTGAGTGAGGAGGGTCTCAGG - Intronic
915951740 1:160193723-160193745 TAGGGAGTGAGCCGGGCGCAGGG - Intronic
916335308 1:163664546-163664568 GAGTGGGTGAAGAAGGCCCAAGG - Intergenic
917320964 1:173781023-173781045 GAGAGAGAGAGGAGGGAGGAGGG + Intronic
917450440 1:175143531-175143553 GTGTGTGTTAGGAGGGTGCATGG + Intronic
917484922 1:175447213-175447235 GAGTGGGTGAGGAGGGGGTGGGG + Intronic
917713535 1:177711119-177711141 GGCTGAGTGTGGAGGGGGCATGG + Intergenic
917728995 1:177855350-177855372 GAGTGAGTGAGGTGGGGGGATGG + Intergenic
918147294 1:181768300-181768322 GAGAGAGTGAGGGGGGAGAAAGG + Intronic
918576196 1:186063401-186063423 GAGGGAGTGGGGAGGGAGAAAGG + Intronic
919766128 1:201128297-201128319 GTGTGAGTGTGTAGGGAGCAGGG - Intergenic
919811624 1:201412420-201412442 CAGGCAGTGAGGAGGGGGCAGGG - Intronic
920131681 1:203736896-203736918 GGGTGAGGGAGGAGAGGGCATGG - Intronic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921131843 1:212226415-212226437 CAGTGAGTGAGGAAAGGGCATGG - Intergenic
921284549 1:213597382-213597404 GAGTGAGTGAAGTGGGGCCATGG + Intergenic
922322818 1:224503048-224503070 GAGGGAGGGAGGTGGGGGCAGGG + Intronic
923714062 1:236410230-236410252 GAGGGTGGGAGGAGGGCTCAGGG - Intronic
1062825392 10:564367-564389 GAGTGAGTGAGGCTGCCCCAAGG - Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063876440 10:10484095-10484117 GAGAGAGAGAGGAGGGGGGAGGG - Intergenic
1063876460 10:10484145-10484167 GAGAGAGAGAGGAGGGGGGAGGG - Intergenic
1064645269 10:17453985-17454007 GAGTGGGGGAGGGGGTCGCAGGG - Intronic
1064876554 10:20001467-20001489 GTGTGCGTGTGGAGGGGGCAAGG + Intronic
1066356017 10:34684652-34684674 GAATGAATGAGGAGGCAGCATGG - Intronic
1066695041 10:38069762-38069784 GACTAAGTGAGGAGGTCACAGGG + Intergenic
1066997471 10:42577417-42577439 GACTAAGTGAGGAGGTCACAGGG - Intronic
1068796919 10:61093570-61093592 GAGACAGTGAGGAGGGTGGAAGG + Intergenic
1069995663 10:72340768-72340790 ATGTGAGTGAGGAGGGCGCCAGG - Exonic
1070574848 10:77670284-77670306 GAATGAGAGAGGAAGGCGGAGGG + Intergenic
1070843506 10:79504111-79504133 GAGAGAGAGAGGAGGGAGCACGG + Intergenic
1070844835 10:79513472-79513494 GGATGAGTGGGGAGGGCACAAGG - Exonic
1070928970 10:80246835-80246857 GGATGAGTGGGGAGGGCACAAGG + Intergenic
1070930159 10:80255489-80255511 GAGAGAGAGAGGAGGAAGCATGG - Intergenic
1071570246 10:86692735-86692757 GAGTCAGTGAGGTGGGCACCTGG + Intronic
1073076604 10:100828513-100828535 GAGTCAGGGAGGAGGATGCAGGG - Exonic
1073142321 10:101256333-101256355 GATTGAGTGAGGGGGCTGCAAGG + Intergenic
1073284439 10:102379210-102379232 CAGTGAGTGGGGAGGGGGAAAGG + Intronic
1073438513 10:103537380-103537402 GAGTGCGAGAGGAGGGAGTAGGG - Intronic
1074232718 10:111553836-111553858 GACTGAGGGAGGAGGGGGAAGGG - Intergenic
1074713034 10:116193254-116193276 GAGTGGGTGTGGAGGTGGCAGGG - Intronic
1075331490 10:121577449-121577471 AAATGAGAGAGGAGGGGGCAGGG + Intronic
1075636169 10:124031959-124031981 GAGTGTGTGAGGGGGCCTCAGGG - Intronic
1076304864 10:129458837-129458859 GAGGGAGAGAGGAGGGAGGAGGG - Intergenic
1076338700 10:129728120-129728142 GAGAGAGGGAGGAGGGGACATGG + Intronic
1076542028 10:131220563-131220585 GAGGGAGGGAGGAAGGGGCATGG + Intronic
1076613191 10:131738955-131738977 GGGTGGGTGGGGAGGGAGCATGG - Intergenic
1076683102 10:132185496-132185518 GGGCGAGTGTGGAGGGCGCGCGG - Intergenic
1076732048 10:132444049-132444071 GAGTGAGTGGGGAGGGAGTGAGG - Intergenic
1077081574 11:726790-726812 GCGGGGGAGAGGAGGGCGCAGGG - Intronic
1077339680 11:2020758-2020780 GAGTGAGTCAGGTGGGCCCTGGG - Intergenic
1077481748 11:2818251-2818273 GAGTGGGTGACAAGGGCACAAGG - Intronic
1077602039 11:3580906-3580928 GAGTAAGTGACGCGGGCGCTGGG - Intergenic
1078257865 11:9675411-9675433 GAGAGAGAGAGGAGGGAGGAGGG + Intronic
1078327653 11:10393659-10393681 AAGTAAGTGAGGAAGGGGCAAGG + Intronic
1078501507 11:11883686-11883708 GAGTGAGTGAGTAGGGCTTGGGG + Intronic
1079079795 11:17406268-17406290 GAGAGAGTGAGGGGAGGGCAGGG + Intronic
1079205816 11:18413405-18413427 CAGAGAGGGAGGAGGGCACAAGG - Intronic
1081502655 11:43681311-43681333 GTGTGACTGAGGAGGCAGCAGGG - Intronic
1081603694 11:44513304-44513326 GGGAGAGTGAGGAGGGAGGATGG + Intergenic
1082816808 11:57514760-57514782 GAGTGAGTGAGGGGCGCGCGGGG - Intronic
1083630148 11:64091119-64091141 GAGAGGGTGGGGAGGGGGCATGG + Intronic
1083822688 11:65181879-65181901 GAGGGAGGGCGGAGGGCGGAGGG + Intronic
1083826398 11:65206437-65206459 GTGGGAGGGAGGAGGGAGCAGGG - Intronic
1084164906 11:67371056-67371078 GAGTGGGTGAGGAGTGGGCTAGG + Intronic
1084195538 11:67522195-67522217 GAGTAGGTGAGGACGGCCCAAGG - Intronic
1084257950 11:67955461-67955483 GAGTAAGTGACGCGGGCGCGGGG - Intergenic
1084430286 11:69107054-69107076 GAAGGAGTAAGGAGGGCCCAGGG + Intergenic
1084814808 11:71639768-71639790 GAGTAAGTGACGCGGGCGCGGGG + Intergenic
1087786223 11:102357247-102357269 GAGGGAGTAAGGAGGGAGGAGGG - Intronic
1089084997 11:115809485-115809507 AATTGAGTCAGGAGGGAGCACGG - Intergenic
1089614066 11:119685361-119685383 GCGTGGGAGAGGAGGGGGCACGG + Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1089884724 11:121808976-121808998 TAGTGAGAGAGGTGGGTGCAGGG - Intergenic
1090405399 11:126473241-126473263 GAGTGGGTGGGGAGGGGGCTAGG - Intronic
1202822665 11_KI270721v1_random:75947-75969 GAGTGAGTCAGGTGGGCCCTGGG - Intergenic
1092203756 12:6603354-6603376 GAGGGAGAGAGGAGGGAGGAGGG - Intronic
1092253979 12:6916372-6916394 GAGGGAGTGAAGAGGACACAGGG - Intronic
1092428181 12:8390249-8390271 GAGTAAGTGACGCGGGCGCGGGG - Intergenic
1092429263 12:8396402-8396424 GAGTAAGTGACGCGGGCGCGGGG - Intergenic
1093094545 12:14957866-14957888 GAGAGAGAGAGGAGGGAGAAGGG + Intronic
1094120497 12:26969064-26969086 GAGAGAGTGAGGAGGGAAAAGGG + Intergenic
1094525755 12:31229585-31229607 GAGACAGTGAGGAGGGTGCAGGG + Intergenic
1095130674 12:38538610-38538632 GAATGAGTGATGAGGTCTCAGGG + Intergenic
1095976466 12:47943623-47943645 GAGTGAGAGAGAAGGGGTCATGG + Intergenic
1096101458 12:48972625-48972647 GGGTGAGTCAGGCGGGAGCACGG - Intergenic
1096121419 12:49091698-49091720 GACAGAGTTAGGAGGGCGAATGG + Intronic
1096505578 12:52090428-52090450 GAGAGAGTGGGGAGGGGGCGGGG + Intergenic
1098885358 12:75955321-75955343 GGGTGAGTGAGGAGGGCTTGGGG - Intergenic
1099886038 12:88532149-88532171 GAGTGAGTGGGGAGGATGGAGGG + Intronic
1100511933 12:95284027-95284049 GAGTGAGGGAAGATGGCTCAGGG + Intronic
1101661329 12:106768093-106768115 GGGTGGGGGAGGAGGGAGCACGG + Intronic
1101789108 12:107911917-107911939 CAGTGAGTGAGGAGGGACCCTGG - Intergenic
1102194721 12:111016889-111016911 GAGAGAGGGAGGAGGGAGGAAGG - Intergenic
1102973332 12:117188983-117189005 GAGTGGGGGTGGAGGGAGCAGGG - Intronic
1105520891 13:21130031-21130053 GAGTGAGTGAGGACTGAGGATGG + Intergenic
1105809219 13:23979770-23979792 GAGGAAATGAAGAGGGCGCAGGG + Exonic
1105853511 13:24357126-24357148 GAGTGTGTGATGAGTGTGCACGG - Intergenic
1105930418 13:25047237-25047259 GAGCAAATGAGGAGGGCGCAGGG - Intergenic
1106520936 13:30497180-30497202 GTGTGAGTGAAGAGAGGGCAGGG - Intronic
1106563286 13:30864566-30864588 GAGTCAGTGAGGAGGGGGCTGGG + Intergenic
1107302508 13:38980368-38980390 GAGTGAGTGGGGAGAGAGAAAGG - Intronic
1107823732 13:44308793-44308815 GACTGAGTGAGGAGGCTGCAGGG + Intergenic
1110134105 13:72044060-72044082 GAGTGAGAGAAGAGGGAGTATGG - Intergenic
1110294935 13:73853405-73853427 GAGTGAGTGAGGAGGAGACAGGG + Intronic
1110896139 13:80754703-80754725 GGATGAGTGAGGAGGAGGCAGGG + Intergenic
1112945131 13:104918915-104918937 GAGTGTGTGAGGAGGGTGACAGG - Intergenic
1113286304 13:108852636-108852658 GGGTGAGTGTGGAGGGCCCTGGG - Intronic
1113407408 13:110054418-110054440 GGGTGTGTGAGGAGGTGGCAAGG - Intergenic
1113939757 13:114012451-114012473 GAGTGTGTGTGGACGGTGCATGG - Intronic
1113939763 13:114012480-114012502 GAGTGAGTGGGGAGTGCGTTTGG - Intronic
1113939782 13:114012602-114012624 GAGTGAGTGGGGAGTGTGCGTGG - Intronic
1113940824 13:114017867-114017889 GAGTGAGTGGGGAGGGGAAACGG - Intronic
1113976880 13:114234690-114234712 GAGAGAGTCAGGAGGGCTCGGGG - Intergenic
1114639978 14:24213184-24213206 GAGTGGGGGAGGACGGCGGACGG + Intronic
1115217366 14:31026374-31026396 GAGTGAGTGAGACGGGCAGATGG - Exonic
1116139670 14:40975241-40975263 GAGTGATTCAGGAGAGAGCAAGG + Intergenic
1118324104 14:64769833-64769855 CAGAGAGAGAGGAGGGAGCACGG - Intronic
1118382137 14:65226107-65226129 GAGTGAGTGAGTAGCAAGCATGG - Intergenic
1118443045 14:65829123-65829145 GATGGAATGAGGAGGGCACAAGG + Intergenic
1118603959 14:67489578-67489600 AAAGGAGTGAGGAGGGAGCAGGG - Intronic
1118835365 14:69474072-69474094 GAGTGGGTGGGGAGGGTGCCTGG - Intergenic
1119021746 14:71121986-71122008 GAGTGAGTGAGTGTGGCTCATGG - Intergenic
1119748179 14:77059239-77059261 GAGTGTGGGAGGAGGGGACAGGG - Intergenic
1119770863 14:77219924-77219946 CAGGGAGTGGGGAGGGAGCAGGG + Intronic
1120648478 14:87101943-87101965 GTCTGAGTGAGGTGGGAGCACGG - Intergenic
1121321697 14:92995268-92995290 GAGTGGGTGAGCAGAGGGCAGGG - Intronic
1122271721 14:100571265-100571287 GTGGGAGTGAGGAGAGAGCAGGG - Intronic
1122825105 14:104366995-104367017 GAGTGAGTGAGCAGGGGCGAGGG - Intergenic
1122889460 14:104725673-104725695 GAGGCAGTGTGGAGGGAGCATGG - Intronic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1202900764 14_GL000194v1_random:35815-35837 GAGTGAGAGGGGAGGAGGCAAGG - Intergenic
1123827924 15:24101692-24101714 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123842383 15:24261103-24261125 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123857412 15:24427162-24427184 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123862043 15:24477694-24477716 GAGTGAGGGAGGAAGGTGGAGGG + Intergenic
1123991059 15:25683674-25683696 AAGGGAGTGAGGAGGGCGAAGGG - Intronic
1124681778 15:31738214-31738236 GAGAGAGGGAGGAGGGAGAATGG + Intronic
1125147706 15:36491431-36491453 GAGGGAGAGAGAAGGGGGCAGGG + Intergenic
1126849276 15:52787641-52787663 GAGTGGGGGGGGAGGGGGCATGG + Intronic
1127288084 15:57547795-57547817 GGGGGAGTGATGAGGGGGCAGGG - Exonic
1127872349 15:63083831-63083853 GAGGGAGAGAGGAGGGAGGAAGG + Intergenic
1128768735 15:70266521-70266543 GAGACAGGGAGGAGGGCGGAAGG - Intergenic
1128796342 15:70469465-70469487 GTGTGAGTGAGCAGGCGGCAAGG - Intergenic
1128926720 15:71662956-71662978 GAGTCAGTGAGGGGCGGGCAGGG + Intronic
1128941315 15:71790173-71790195 GAGTGTGTCGGGAGGGTGCAGGG - Intergenic
1129219071 15:74121010-74121032 GAGTGAGAGAGGAAGGGGAAGGG - Intronic
1130090983 15:80821202-80821224 GAATGAGGGAGCAGGGAGCATGG + Intronic
1130329580 15:82910926-82910948 GAGTAAGGGAGGAGGGTTCAGGG + Intronic
1130841024 15:87701352-87701374 CAGTGAGTGAGTAGTGAGCAGGG - Intergenic
1130968860 15:88717225-88717247 GAGTGAGTGAGGCGGGGGCCTGG + Intergenic
1131701568 15:94942672-94942694 GAGTGAGAGTGGAGGGCGGCAGG - Intergenic
1132250591 15:100332952-100332974 CAGTGAGGGAGGAGGAGGCAGGG - Intronic
1132484831 16:185409-185431 GAGGGAGGGAGGAGGGAGAAAGG + Intergenic
1132751057 16:1457936-1457958 GAGTGAGTGCGGGGGACGCTTGG - Intronic
1133270054 16:4606742-4606764 GATTCAGTGGGGAGGGCTCAGGG + Intergenic
1133298419 16:4766996-4767018 CAGTGAGTGCGGGGGGCGCGGGG - Exonic
1133370046 16:5240104-5240126 GAGTAAGTGACGCGGGCGCGGGG + Intergenic
1134880863 16:17744805-17744827 GAGTGAGTTAGGAGGAGGCAGGG + Intergenic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1137581181 16:49634522-49634544 GAGGGGGTGAGGAGGGCAGAGGG - Intronic
1138998642 16:62481595-62481617 GAGTGAGTGAGCATGGGGCCTGG - Intergenic
1139193323 16:64889973-64889995 GAATGAGTGGGAAGGGAGCAGGG + Intergenic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139851276 16:69952591-69952613 GAGTGAGTGAGCAGAGAACATGG - Intronic
1139853918 16:69965865-69965887 GAGGGAGTGAGGGCGGCCCAGGG - Intergenic
1139880256 16:70175503-70175525 GAGTGAGTGAGCAGAGAACATGG - Intronic
1139882896 16:70188778-70188800 GAGGGAGTGAGGGCGGCCCAGGG - Intergenic
1140200011 16:72887505-72887527 GACTGAGTGTGGAGGGAGCTGGG + Intronic
1140369613 16:74406741-74406763 GAGGGAGTGAGGGCGGCCCAGGG + Intergenic
1140372253 16:74420014-74420036 GAGTGAGTGAGCAGAGAACATGG + Intronic
1140924801 16:79571942-79571964 GAGTGAGTCAGGCAGGGGCAGGG - Intergenic
1141177140 16:81728523-81728545 GAGGGAGGGAGGAGGGAGGAAGG - Intergenic
1141638897 16:85329840-85329862 GAATGTGTGGGGAGGGCGGAGGG + Intergenic
1141994606 16:87628408-87628430 GAGTGAGTGAGGGAGGGGCCGGG + Intronic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1142760228 17:2037597-2037619 GACTGAGTGACGTGGGCACAGGG - Intronic
1142981056 17:3671922-3671944 GAGTGAGAGAAGAGGCCACAGGG + Exonic
1143495823 17:7312173-7312195 GGATGAGTGGGGAGGGCACAAGG - Exonic
1145384543 17:22404283-22404305 GAGTGAGACAGGAAAGCGCAGGG - Intergenic
1145392074 17:22462810-22462832 GAGTGAGGCAGGAGGGTTCAGGG + Intergenic
1146176310 17:30668206-30668228 GAGGGAGGGAGGAGGGGGCTGGG + Intergenic
1146349768 17:32084320-32084342 GAGGGAGGGAGGAGGGGGCTGGG + Intergenic
1146379690 17:32319569-32319591 GTGGGAGTGCGGAGGGCGGAGGG + Intronic
1147308207 17:39578216-39578238 GAGTGAGAGAGGAGGGGGCAGGG - Intergenic
1147457322 17:40545956-40545978 GAGCCAGGGAGGTGGGCGCATGG - Intergenic
1148387420 17:47244379-47244401 GTGAGAGTGAGGAGGGCACCAGG + Intergenic
1148431916 17:47649893-47649915 GAGGGAGGGAGGAAGGCGGAGGG - Exonic
1148989431 17:51652599-51652621 GAGGAAGTTAGGAGGGGGCATGG + Intronic
1149673942 17:58441938-58441960 GTGTGAGTGAGGGGGGAGGATGG + Intronic
1150413552 17:64967748-64967770 GAGAGAGTAAGGAAGGCTCACGG + Intergenic
1151276548 17:73038773-73038795 GAGGGAGGGAGGAGGGAGGAGGG + Intronic
1151549285 17:74812673-74812695 CTTGGAGTGAGGAGGGCGCAGGG - Intronic
1151833450 17:76569112-76569134 GAGTGAGTCAGGAGGGGGTGGGG + Intronic
1152075778 17:78158861-78158883 GGATGAGTGGGGAGGGCACAAGG - Intronic
1152490964 17:80633380-80633402 GAGGAAGTTAGGATGGCGCATGG - Intronic
1152511525 17:80792891-80792913 GTGTGTGTGGGGAGGGCGCAGGG - Intronic
1152748651 17:82052484-82052506 GAGCGAGGGAGGGGGGAGCAGGG + Intronic
1152871010 17:82752835-82752857 GAATGAGAGAGGGGGACGCAGGG + Intronic
1153942650 18:9991110-9991132 GTGTGTGTGAGAAGGGAGCAGGG - Intergenic
1153955584 18:10093031-10093053 GAGTGAGGATGGAGGGCGAAGGG + Intergenic
1154105962 18:11523347-11523369 GAGTGAGTGAGAAGTGAGGAGGG - Intergenic
1156167124 18:34435598-34435620 GTGTGAGGGAGAAGGACGCAAGG - Intergenic
1157181863 18:45505428-45505450 GAGTGGGTGAGGAGCCCACAGGG + Intronic
1157404615 18:47412507-47412529 AAGTGTGTATGGAGGGCGCAGGG - Intergenic
1157944775 18:51967046-51967068 GAGTGAGGGGGGAGGGGGGAGGG - Intergenic
1157979535 18:52364787-52364809 GAGGCAGTGAGGAGGTGGCATGG + Intronic
1158058722 18:53312983-53313005 GAGGGAGGGAGGAGGGAGGAAGG + Intronic
1158338214 18:56436173-56436195 AAGTGAGTGCGGAGGACGCCAGG - Intergenic
1158427640 18:57353477-57353499 GAGTAAAGGAGGAGGGCGCGAGG - Intronic
1158435493 18:57432977-57432999 GAGTGAGGGAGGAGGGAGGGAGG + Intergenic
1158972216 18:62679239-62679261 GAGTGAATGAAGAGAGAGCAGGG - Intergenic
1160958052 19:1703792-1703814 GAGAGACTGAGGTGGGCGGAAGG - Intergenic
1161080806 19:2309071-2309093 GAGTGAGTGAGGACAGGCCAGGG - Intronic
1161137137 19:2626468-2626490 GAGGGAGTGAGGAGGCCGCACGG - Intronic
1161142037 19:2653794-2653816 GGCTGAGTGAGGAGGGGACACGG - Intronic
1161198879 19:3003222-3003244 GAGGGAGAGAGGAGGGAGGAGGG + Intronic
1161234207 19:3189986-3190008 GAGTGAGCGAGGAGGGAGAAGGG - Intronic
1161353394 19:3805991-3806013 GCGAGGGAGAGGAGGGCGCAGGG - Exonic
1161583191 19:5091760-5091782 GTGGGAGGGAGGAGGGCCCACGG + Intronic
1161650365 19:5480557-5480579 GAGTGAGTGAGGGGGAGACAAGG + Intergenic
1161727554 19:5938828-5938850 GGGTGAGTGGGGAAGGGGCAGGG + Intronic
1161818670 19:6516069-6516091 GAGGGACTGAGGAGTGGGCAGGG + Intergenic
1161983116 19:7640808-7640830 CAGTGAGTGAGGAGAGCCTAGGG + Exonic
1161989029 19:7673485-7673507 GAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1162839571 19:13346239-13346261 GAGTGAGTGAGGATGAAGGAAGG - Intronic
1162875286 19:13616841-13616863 GAGTGAGTGAGGGGGCCAGAAGG + Intronic
1162982514 19:14248689-14248711 GAGGGAGGGAGGAGGGGGCTGGG - Intergenic
1163225306 19:15956503-15956525 GAGGGTGAGAGGAGGGTGCAGGG - Intergenic
1163245058 19:16088335-16088357 GAGTGAGACAGGAGGCAGCAGGG + Intronic
1163292760 19:16391460-16391482 GAGTGAGCGAGGTGGGCGCCAGG + Intronic
1163490872 19:17616551-17616573 GAGTGTGTGTGGAGGGGGCAGGG + Intronic
1164490189 19:28703813-28703835 GAGGGAGAGAGAAGGGGGCATGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1165021530 19:32928361-32928383 GAGAGAGAGAGGAGGGAGGAAGG - Intronic
1165438831 19:35812343-35812365 GAGTGGGTGAGTAGGGAGCCAGG - Exonic
1166015318 19:39974877-39974899 CAGTGAGCGAGCAGGGAGCAAGG - Intronic
1166551040 19:43666477-43666499 GAGGGAGGGAGGAGGGAGGAAGG - Intronic
1166708632 19:44923134-44923156 GAGGAAGTGAGGAGGGAGCCAGG - Intergenic
1166710631 19:44934930-44934952 GAGGAAGTGAGGAGGGAGCCAGG - Intergenic
1166743640 19:45129655-45129677 GGGTGAGTGGGGAGGGCACAAGG - Intronic
1167250663 19:48396937-48396959 GACTGAGGGAGGAGGGCACTGGG - Intronic
1167367881 19:49064425-49064447 GTCTGAGGGAGGAGGGCGCTGGG - Intronic
1167367895 19:49064466-49064488 GTCTGAGAGAGGAGGGCGCTGGG - Intronic
1167550107 19:50154568-50154590 GGGGGACTGAGGAGGGGGCAAGG + Intronic
1167752911 19:51391179-51391201 GAGAGAGAGAGAAGGGGGCAGGG - Intergenic
1167780707 19:51597111-51597133 GAGTGTGTGTGGAGGAGGCAAGG + Intergenic
1168077712 19:53990461-53990483 GTCTGAGGGAGGAGGGGGCAGGG - Intergenic
1168102497 19:54148534-54148556 CAGTGAGTGAGGAGGCAGCGGGG + Exonic
1168135317 19:54347131-54347153 ACGTGGGTGAGGAGGGCTCAAGG + Intergenic
1168250383 19:55138116-55138138 GACTGAGGGAGGAGGGCCCTGGG + Intronic
1168291562 19:55360050-55360072 GTCTGAGGGAGGAGGGAGCAGGG - Intronic
1168294669 19:55372914-55372936 GAGTCAGTGTGGGGGGCCCAAGG + Intergenic
925022317 2:581322-581344 GAGTGGGAGAGGAGGCGGCAAGG + Intergenic
925281982 2:2691112-2691134 GAGTGAGAGAGGAGGGTGTGAGG - Intergenic
925762313 2:7197201-7197223 AAGTGAGTGAATAGGGTGCAAGG - Intergenic
925820912 2:7799295-7799317 GAGTGAGTGAGGAGGGGGTGGGG + Intergenic
926113035 2:10194795-10194817 GAGTGACAGATGAGGACGCAGGG - Intronic
926748544 2:16180195-16180217 GAGGAAGTGAGGTGGGGGCAGGG + Intergenic
927086458 2:19677823-19677845 GGGCGAGTAAGGAGGGCACAAGG + Intergenic
927594209 2:24382630-24382652 AAGTGTGTGTGGATGGCGCAGGG + Intergenic
927635681 2:24814603-24814625 GTGTGAGTGATGAGGGCAGAGGG - Intronic
928018377 2:27680548-27680570 GAGTGAGTGAGGTGGGAGGATGG + Intronic
928097332 2:28412640-28412662 GAATGAGGGAGGAGGTCCCATGG - Exonic
930622519 2:53658874-53658896 GAGGGAGTGAGGAGGGAGGGGGG + Intronic
931285731 2:60830050-60830072 GAGAGAGGGAGAAGGGTGCAGGG + Intergenic
932064902 2:68544744-68544766 TAGTGATTGAAGAGGGCACATGG + Intronic
932314346 2:70769490-70769512 GAGTGTGGAAGGAGGGTGCAGGG - Intergenic
933573499 2:84040620-84040642 GGGTGGGTGAGGAGGCAGCATGG + Intergenic
933679118 2:85083319-85083341 GAGGGAGGGAGGAGGGAGGAAGG + Intergenic
933900005 2:86842857-86842879 AAGAGAGTGAGGAGGTCTCAGGG + Intronic
934506091 2:94895741-94895763 GAGTGAGAGGGGAGGAGGCAAGG + Intergenic
934712746 2:96526625-96526647 GAGTGGGTGGGGTGGGCCCAGGG - Intergenic
934964841 2:98712056-98712078 GAGGGAATGAGGAGGGGACAGGG - Intronic
935645303 2:105329604-105329626 CGGTGAGTGAGGAGGGCGGCGGG - Exonic
935780554 2:106506368-106506390 AAGAGAGTGAGGAGGTCTCAGGG - Intergenic
936093004 2:109512816-109512838 GAGGGGGTGAGGAGGGGTCAGGG - Intergenic
937075809 2:119105670-119105692 GAATGAGTGAGGAGTGAGGAGGG - Intergenic
938310171 2:130284397-130284419 GGGTGAGTGAGGTGGGCTCTGGG + Intergenic
938444751 2:131367972-131367994 GGGTGAGTGAGGTGGGCTCTGGG - Intergenic
938595140 2:132781263-132781285 GAGTGATTGAAGAAGGAGCAAGG - Intronic
938701650 2:133885158-133885180 GAGTGGGTGATGAGGACACACGG + Intergenic
939525722 2:143291393-143291415 GAGTGAGTGAGGAGGGAGGGAGG - Intronic
940979932 2:159990310-159990332 GAGTGAGTGGGGTGGGGGTAAGG - Intronic
943419674 2:187655048-187655070 GAGTGACTGAGATGGGGGCATGG - Intergenic
944523820 2:200598127-200598149 GAGGGAGAGAGGAGGGAGGAAGG + Intronic
946038720 2:216765857-216765879 GAGTGAGAGAGAAGGGAGGAGGG - Intergenic
946226254 2:218265558-218265580 GTGTGAGTGAGGATGGGGAAAGG - Exonic
946464837 2:219902740-219902762 GAGGGTGTGAGGGGGGGGCATGG + Intergenic
946475897 2:220005998-220006020 GAGCAAGTGAGGAGGGCGGGTGG + Intergenic
947170075 2:227302077-227302099 GAAGGAGGGAGGAGGGAGCAGGG - Intronic
947531590 2:230912062-230912084 GGGTGAGAAAGGAGGGAGCAGGG - Intronic
947835033 2:233169192-233169214 CAGTGAGTGAGGAGCTGGCAAGG - Intronic
948163569 2:235844284-235844306 GAGTGGGTTTGGAGGGGGCAAGG + Intronic
948379363 2:237542041-237542063 GAGAGTGTGAGGAGGGTGGACGG + Intronic
948548034 2:238746344-238746366 CAGTGAGAGAGGAGGCTGCAGGG - Intergenic
949002001 2:241620240-241620262 GAGTGAGTGAGGAGTGAGTGAGG + Intronic
1168891253 20:1296456-1296478 GAGGGCGGGAGGAGGGCGCACGG + Intronic
1169002376 20:2177373-2177395 GAGTGGGGCAGGAGGGCACAGGG - Intergenic
1169066163 20:2695213-2695235 GAGTGGGTGAGGAGTGCTGATGG + Intronic
1169395336 20:5224071-5224093 GAGTGAAGTAGGAGGGGGCAGGG - Intergenic
1169504895 20:6198859-6198881 GAGTAAGAGAGAAGGGAGCAGGG + Intergenic
1169506153 20:6213435-6213457 GAGTGAGTGAAGCGGACGCGAGG + Intergenic
1170438346 20:16352732-16352754 GAGCGGGTGAGGAGGGCGAGGGG + Intronic
1170471915 20:16676179-16676201 GATTAAGTCAGGAGGGCTCATGG + Intergenic
1170823243 20:19771882-19771904 GAGAGAGTGAGGAGGGCAAGAGG - Intergenic
1172009647 20:31839012-31839034 GAGTGAGTGAGGGGGAAGGAAGG + Intergenic
1172281572 20:33711467-33711489 GAGTTTGTGGGGAGGGTGCAGGG + Intronic
1172450307 20:35018026-35018048 GAGTGAGACAGGAAGGCACATGG - Intronic
1172621700 20:36321712-36321734 GAGGGAGCGAGGAGGGGGAAAGG + Intronic
1172767582 20:37358957-37358979 GAGTGAGTGAAGAGTGAGCAAGG - Intronic
1172777252 20:37414858-37414880 GAGTGAGTGAGAAGGAGGTACGG - Intergenic
1172843112 20:37913877-37913899 TTCTGAGTGGGGAGGGCGCACGG + Intronic
1172858735 20:38030222-38030244 GAGGGAGGGAGGAGGGAGGAAGG + Intronic
1172888926 20:38249875-38249897 GAGGGAGTGGGGAGGGCACCTGG - Intronic
1172919798 20:38472029-38472051 GAGAGAGGGAGGAGGGGTCAGGG - Intergenic
1173541682 20:43857346-43857368 GAGAGAGGGAGGAGGGAGGAAGG + Intergenic
1175145872 20:56895816-56895838 GAGAGAGAGAGCAGGGCGGATGG - Intergenic
1175187735 20:57190304-57190326 GAGTGAGTGAGGAGCTTGAAGGG + Intronic
1175423985 20:58852961-58852983 GAAAGAGAGAGGAGGGCGTAAGG + Exonic
1175742260 20:61428006-61428028 GAGTGAATGAAGATGGTGCATGG + Intronic
1176184155 20:63769084-63769106 GGGTGGGAGAGGAGGGCACATGG + Intronic
1176305626 21:5121662-5121684 GAGGGAGGGAGGAGGGTGCGTGG - Intronic
1176620138 21:9050593-9050615 GAGTGAGAGGGGAGGAGGCAAGG - Intergenic
1179028278 21:37698396-37698418 GAGTGCGGGAGGGGGGCTCATGG + Intronic
1179514458 21:41897270-41897292 GAAGGAATGAGGAGGGCGGACGG + Intronic
1179543715 21:42100791-42100813 GGGAGGGTGAGGAGGGCACAGGG - Intronic
1179775584 21:43659784-43659806 GAGGGAGACAGGTGGGCGCACGG + Exonic
1179851431 21:44140369-44140391 GAGGGAGGGAGGAGGGTGCGTGG + Intronic
1180237955 21:46476440-46476462 GAGTGCCCGAGGAAGGCGCAGGG + Intronic
1181693989 22:24583867-24583889 CAGGGAGTCAGCAGGGCGCAAGG + Intronic
1181871439 22:25902541-25902563 GAGTGATTGAGGCAGGGGCAGGG - Intronic
1182627274 22:31656743-31656765 GAGTGAGTGAGGAGGAAGAGAGG - Intronic
1182756243 22:32682038-32682060 AAGTGAGGGAGGAGAGGGCACGG + Intronic
1183302851 22:37066784-37066806 GAGGGAGAGAGGAGGGAGAAAGG - Intronic
1183393047 22:37556733-37556755 GAGCCAGGGAGGAGGGGGCAGGG - Intergenic
1183464346 22:37972131-37972153 GAGAGAGAGAGGAGGGGGGAGGG + Intronic
1183472171 22:38015500-38015522 GAGGGAGAGAGGAGTGCTCAAGG - Intronic
1183863295 22:40684716-40684738 GAGGGAGTGAGGAGCAGGCAGGG - Intergenic
1184252223 22:43267321-43267343 AAGGGAGAGAGGAGGGAGCAAGG + Intronic
1184352727 22:43955254-43955276 GACTGTGTGGGGAGGGCGCGTGG - Intronic
1184492016 22:44815242-44815264 GTGTGGGGGAGGAGGGAGCATGG + Intronic
1184676358 22:46045342-46045364 GAGGGAAGGAGGAGGGGGCATGG + Intergenic
1185110135 22:48896206-48896228 GGGTGAGGGAGGAGGGAGGATGG + Intergenic
950141815 3:10620924-10620946 CTGTGAGTGAGGAGGACACAGGG - Intronic
950176656 3:10879528-10879550 GATTGAGGGAGGAGGGGACATGG - Intronic
950186822 3:10950640-10950662 GGGTGAGTGAGGAGGCAGCAGGG - Intergenic
950726779 3:14922020-14922042 GAGTGGGTGGGCAGGGCCCACGG + Intronic
950967965 3:17159538-17159560 GAGTGGGTGAGGATGGCAGAGGG - Intronic
951345042 3:21537704-21537726 GAGTGAGTGAGGTGGGCAGTGGG + Intronic
952107578 3:30087718-30087740 GAGGGAGGGAGGAGGACGGAGGG - Intergenic
952710631 3:36428759-36428781 GAGTGAGTGATGAAGGAGAATGG + Intronic
953124443 3:40077910-40077932 GAGTGCGGGCGCAGGGCGCAGGG - Intronic
953313336 3:41902185-41902207 AACTGAGTGAGGAAGGGGCATGG + Intronic
953843080 3:46405625-46405647 GAGTGAGTGAGTGGGGGTCATGG - Intergenic
954198522 3:49010418-49010440 GAGTGACTGATGAGGGGGCCGGG + Intronic
954200896 3:49022500-49022522 GAGTGCGGGAGCAGAGCGCAGGG - Exonic
954697634 3:52436089-52436111 GAGGGCGTGAGTAGGGTGCAAGG + Intronic
955415574 3:58688114-58688136 GAGTGAGTGAGACAGGAGCAGGG - Intergenic
955499564 3:59570505-59570527 GCGTGAGGGAGGAGGGCGAGGGG - Intergenic
956946801 3:74232504-74232526 GAGTGAGTAAGGAGGAGGGAAGG + Intergenic
956988270 3:74730248-74730270 GTGTGAGTGAGAAAGGGGCAAGG - Intergenic
957072883 3:75579957-75579979 GAGTAAGTGACGCGGGCGCAGGG - Intergenic
957211664 3:77266845-77266867 GAGAGAGTAAAGAGGGAGCAAGG - Intronic
957556231 3:81767373-81767395 GAGTGCGGGCGAAGGGCGCAGGG - Intergenic
960067975 3:113395540-113395562 GAGGCAGTGAGGAGAGAGCAAGG + Intronic
960719246 3:120609579-120609601 GAGGGAGGGAGGAGGGTGGAGGG - Intergenic
962642892 3:137406761-137406783 GAGTGAGTGTGGAGGGAGGAGGG + Intergenic
962915681 3:139901334-139901356 GAGAGAGAGAGGAGGAAGCAAGG + Intergenic
962989235 3:140563488-140563510 GAGTGTGTGTAGAGGGCTCATGG - Intronic
963229704 3:142896594-142896616 CAGTGAGTGAGGAGAGCACAGGG - Intergenic
964692205 3:159462369-159462391 CAGTCAGTGAGGAGGACGCAGGG - Intronic
964917024 3:161851595-161851617 GAGTGAGTGAGGAAGGAGAATGG + Intergenic
965404119 3:168249490-168249512 GAGGGGTCGAGGAGGGCGCAGGG + Intergenic
966211656 3:177459632-177459654 CAGTGAGAGAGGAGAGGGCAGGG + Intergenic
966876929 3:184327723-184327745 GTGTGATTGAGGAGTGGGCAGGG + Intronic
966886474 3:184380231-184380253 GCGGGAGTGCGGAGGGCGGAGGG - Exonic
966891436 3:184410200-184410222 GACAAAGTGAGGAGGGCTCACGG - Intronic
967401598 3:189068804-189068826 GAGGGAGGGAGGAGGGAGGAGGG + Intronic
967685066 3:192409068-192409090 GAGGGAGGGGGGAGGGCGCGAGG + Intronic
967988997 3:195117637-195117659 GCGTGAGAGAGGGGGGTGCATGG - Intronic
968610963 4:1556819-1556841 GAGGGAATGAGGAGGGGGCCCGG - Intergenic
968858986 4:3151398-3151420 GAGGGAGAGAGGAGGGAGAAAGG + Intronic
968948932 4:3680242-3680264 CAGTGGGTGTGCAGGGCGCAAGG + Intergenic
969016491 4:4107259-4107281 GAGTAAGTGACGCGGGCGCGGGG - Intergenic
969248745 4:5953643-5953665 GAGTCTGGCAGGAGGGCGCATGG + Intronic
969493360 4:7512413-7512435 GAGGGAGGGAGGAGGGGGAAGGG + Intronic
969737460 4:9001057-9001079 GAGTAAGTGACGCGGGCGCAGGG + Intergenic
970760562 4:19480947-19480969 GAGAGAGGGAGGAGGGAGTAAGG - Intergenic
972265194 4:37453315-37453337 GAGTGGGTGAGGAGGGGACGGGG + Intergenic
972425267 4:38927012-38927034 GAGTGAGGCAGGTGTGCGCAGGG - Intronic
973623419 4:52749495-52749517 GAGTAAGTGTGGATGGCTCAAGG - Intronic
975191353 4:71466788-71466810 GAGTAAGTGGGAAGGGAGCAAGG - Intronic
975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG + Intronic
977895289 4:102357696-102357718 GAGAGAGTGAGCAGGGAGGAAGG + Intronic
978772700 4:112473825-112473847 GAAGGAGTGAGGGGGACGCATGG - Intergenic
981027590 4:140092565-140092587 GAGTGAGTGAGCAGTGCGGCGGG - Intronic
983448995 4:167887840-167887862 GAGTGAGTGAGCGTGGGGCACGG - Intergenic
984142129 4:176016305-176016327 GAGTTAGTGGGGAGGGAGGAAGG - Intergenic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985118558 4:186616386-186616408 GAGTGGGTGGGGAGGGGCCATGG - Intronic
985530947 5:433623-433645 GGGCGAGTGAGGAAGGCCCAGGG - Intronic
985658097 5:1142406-1142428 GAGAGAGTGAGGAGGGGAGAGGG - Intergenic
985732148 5:1555325-1555347 TCGTGTGTGAGGAGGGCGCCCGG - Intergenic
985824619 5:2183195-2183217 GGGTGGGTGAGGAGGGGCCAGGG + Intergenic
986492341 5:8306223-8306245 GAGAGAGAGAGGGGGGGGCAGGG + Intergenic
986806289 5:11311694-11311716 GAGTGTGTGGTGAGGGTGCATGG - Intronic
987201257 5:15580370-15580392 AAGTGAGTGAGGAGGCTGCCTGG + Intronic
987258537 5:16180409-16180431 GAGCGGGTGAGGAGGACACAGGG - Intronic
988140522 5:27233212-27233234 GAGTGAGTGTGGAGGAGGAAAGG - Intergenic
992069575 5:73136505-73136527 GGGTGAGTGAGTAGGTCGCGGGG + Intergenic
992890320 5:81198254-81198276 GAGGGAGGGAGGTGGGGGCAAGG - Intronic
994639561 5:102389977-102389999 GGCTGAGTGAGGAGGGAGGATGG - Intronic
995597067 5:113759088-113759110 GAGTGAGTGAGGAGGCATGAGGG + Intergenic
996792872 5:127312093-127312115 CAGTGAGAGAGGAAGGAGCAAGG - Intronic
997356074 5:133263840-133263862 GAGTGGGTGAGGCAGGGGCACGG + Intronic
997379640 5:133426425-133426447 TAGGGAGTGCGGAGGGGGCAGGG - Intronic
999116193 5:149165698-149165720 GAATGAGTGAGCAGGGAGAAAGG - Intronic
999282244 5:150373584-150373606 GAGTTAGTGAAGAGGGGGCCAGG + Intronic
1000043448 5:157502255-157502277 CAGTGAGTGTGGAGGGTACACGG - Intronic
1000212418 5:159119507-159119529 GAGTGCGGGTGCAGGGCGCATGG + Intergenic
1002192850 5:177487805-177487827 GTGGGAGTCAGGAGGGCCCAGGG + Intronic
1002301017 5:178257315-178257337 GAGGGAGTGAGGGAGGCACATGG + Intronic
1002335872 5:178478012-178478034 GGGTGTGGGAGGAGGGAGCATGG + Intronic
1002897794 6:1389521-1389543 GAGGGAGCGAGGAGGGCGGCCGG + Intergenic
1002915858 6:1527237-1527259 GGGTGTGTGTGGAGGGGGCAGGG - Intergenic
1003088015 6:3076982-3077004 CATTGAGTGAGTAGGGAGCAGGG + Exonic
1003256682 6:4481276-4481298 GTGTGAGTGGGGAGAGCACAAGG - Intergenic
1003529867 6:6928441-6928463 GAGGGAGTGAAGAAGGCACAGGG + Intergenic
1004584595 6:16987306-16987328 GAGTCACTGAGGAGGGCACATGG + Intergenic
1004775667 6:18841564-18841586 CCGTAAGTGAGGAGGGTGCACGG + Intergenic
1005359206 6:25014848-25014870 GAGTGTGTGAGAAGGGCCCGAGG + Intronic
1005582190 6:27245978-27246000 GAGTGAGTGGGGAGGGAGGAAGG - Intergenic
1006162859 6:32048208-32048230 GAGTGGGAGAGGAGAGCTCAGGG + Intronic
1006164813 6:32058033-32058055 GAGTGAGTGTGGGTGGGGCAGGG - Intronic
1006187711 6:32190182-32190204 GAGAGAGGGAGGAGGGAGGAGGG + Exonic
1006376271 6:33673294-33673316 GACTGAGTGGGCCGGGCGCAGGG + Intronic
1006447395 6:34087485-34087507 GAGTCACTGAGGAGGGAGAAAGG - Intronic
1006814158 6:36839531-36839553 GAGAGAGGGAAGAGGGCGGAGGG + Exonic
1007657985 6:43464143-43464165 GAGTGAGGTAGGAGTGTGCAGGG - Intergenic
1007922540 6:45623863-45623885 GAATGAGTGAGGATGGAGGATGG - Intronic
1008920934 6:56843696-56843718 GAGGGAGGGAGGAGGGTGGAGGG + Intronic
1008927027 6:56897832-56897854 TAGTGAGTCAGGAGGGAGCAGGG - Intronic
1010630681 6:78193678-78193700 GAGAGAGAGAGGTGGGAGCAAGG - Intergenic
1011615237 6:89192129-89192151 GAGACAGGGAGGTGGGCGCAGGG + Intronic
1013194909 6:107836520-107836542 GAGTCAGTGAGGATGCCCCATGG - Intergenic
1014466753 6:121765212-121765234 GAAAAAGTGAGGAGGGCGCAAGG + Intergenic
1015871595 6:137781276-137781298 GAATAAGTGAGGAAGGTGCAGGG - Intergenic
1017959340 6:159208193-159208215 GAGTGAGTGAGCTGGGCTCAGGG + Intronic
1018301012 6:162403218-162403240 GAGTGAGTGAGGAGAGCTGGAGG - Intronic
1018639054 6:165890061-165890083 GAGTGAGTGAGGAGTGAGGGAGG - Intronic
1018648648 6:165972326-165972348 GAGAGAGTGTGGAGGACCCAGGG - Intronic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1018844673 6:167547371-167547393 GACTGATTGAGGAGGGAGGAGGG - Intergenic
1018902195 6:168057234-168057256 GGCTGAGTGAGGTGGGCGCTGGG + Exonic
1018924813 6:168198675-168198697 GGGTGAGGGAGAAGGGAGCACGG - Intergenic
1018985909 6:168636983-168637005 GAGTGAGGGAGGCGGGAGGAGGG - Intronic
1019295487 7:271935-271957 GGGGGAGCGAGGAGGGAGCACGG + Intergenic
1019483532 7:1277158-1277180 GAGGGAGGGAGGAGGGAGAAGGG - Intergenic
1019483547 7:1277201-1277223 GAGGGAGGGAGGAGGGAGAAGGG - Intergenic
1019530134 7:1499173-1499195 GAGGGAGCGAGGAGGGAGGAAGG + Intronic
1019801086 7:3088993-3089015 GGGGGAGTGAGGAGGGCTAATGG - Intergenic
1020264646 7:6552239-6552261 TAGGGAGTGAGGAGGGCCCATGG - Intergenic
1020672085 7:11128744-11128766 GAGGGAGAGAGGAGGGAGAATGG - Intronic
1021525339 7:21580135-21580157 GAGTGAGTGAGAAGGGAGGGAGG + Intronic
1021874176 7:25033044-25033066 TGCTGAGTGTGGAGGGCGCAGGG + Intergenic
1021896682 7:25243196-25243218 GAGGGAGTGGGGAGAGCGGAAGG - Intergenic
1022975041 7:35549020-35549042 GAGCAAGGGAGGAGGGCTCAAGG + Intergenic
1023139909 7:37091579-37091601 CAGTGAGAGTGGAGGGGGCAGGG - Intronic
1023967785 7:44971983-44972005 GCGTGAGTGGGGAGGGTGCTCGG - Intronic
1026020942 7:66705477-66705499 GAGAGAGAGAGGAGGGGGGAGGG + Intronic
1026871307 7:73853841-73853863 GAGTGGATGAGGATGGGGCAGGG + Intergenic
1027464463 7:78498328-78498350 CAGTGATTGGGGAGGGAGCATGG - Intronic
1027605568 7:80294311-80294333 GAGGGAGTGGGGAGGGAGGAAGG - Intergenic
1029074955 7:97928061-97928083 GAGTAAGTGACGCGGGCGCGGGG - Intergenic
1029476132 7:100785952-100785974 AAGAGAGTGAGGAGGGGGCTGGG - Intronic
1029805506 7:102991961-102991983 GAATGAGTGAGGAGGGTGATAGG - Intronic
1030496569 7:110308018-110308040 GAGTGTGTGAGGAGGGAGGCTGG + Intergenic
1031051559 7:116950633-116950655 GAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1031110031 7:117596488-117596510 GAGTGTGGGTGCAGGGCGCAGGG + Intronic
1032007067 7:128311124-128311146 GAGTGAGTGCACAGGGAGCAGGG + Intronic
1032339117 7:131054534-131054556 GAGGGAGGGAGGAGGGAGGAAGG + Intergenic
1032904010 7:136343471-136343493 GAGTAACTGAGGAGGGGACAAGG + Intergenic
1032904998 7:136354191-136354213 AATTGAGTGAGGAGGTCACAAGG - Intergenic
1033609729 7:142953876-142953898 GAGGGACTGAGAAGGGCTCAGGG + Exonic
1033646927 7:143312032-143312054 GATGGAGTGAGGAGTGGGCATGG + Intergenic
1034447418 7:151120759-151120781 GGGTGAGTGAGGAGCTCACAAGG - Intronic
1035056560 7:156040087-156040109 GAGTGAGAGCAGAGGGCCCAGGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035624672 8:1061879-1061901 GAGTGAGTGGGCAGGGTGCTCGG - Intergenic
1035635320 8:1139740-1139762 GAGGGAGTGAGGATGGTGCCTGG + Intergenic
1036117158 8:5971076-5971098 GAGAGAGTGAGAAAGGCGAACGG + Intergenic
1036242563 8:7092319-7092341 GAGTAAGTGACGCGGGCGCGGGG + Intergenic
1036258233 8:7221692-7221714 GAGTAAGTGACGCGGGCGCTGGG - Intergenic
1036259288 8:7227832-7227854 GAGTAAGTGACGCGGGCGCGGGG - Intergenic
1036307337 8:7611689-7611711 GAGTAAGTGATGCGGGCGCGGGG + Intergenic
1036310281 8:7680288-7680310 GAGTAAGTGACGCGGGCGCTGGG - Intergenic
1036311330 8:7686402-7686424 GAGTAAGTGACGCGGGCGCGGGG - Intergenic
1036358181 8:8059673-8059695 GAGTAAGTGATGCGGGCGCGGGG + Intergenic
1036359256 8:8065815-8065837 GAGTAAGTGACGCGGGCGCCGGG + Intergenic
1036891702 8:12601137-12601159 GAGTAAGTGACGCGGGCGCCGGG - Intergenic
1036892769 8:12607270-12607292 GAGTAAGTGATGCGGGCGCGGGG - Intergenic
1036899252 8:12659109-12659131 GAGTAAGTGACGCGGGCGCGGGG - Intergenic
1036900321 8:12665257-12665279 GAGTAAGTGACGCGGGCGCGGGG - Intergenic
1037808323 8:22070476-22070498 GAGTGAGTGAGCAAGGAGCCTGG - Intronic
1037877366 8:22554611-22554633 GAGTGAGTCAGTAGGGAGGAGGG + Intronic
1038311582 8:26449561-26449583 GAGTGAGCGAAGAGGGGACAAGG + Intronic
1039964283 8:42272242-42272264 GAGGCAGTGAGGAGGGGGCCTGG - Intronic
1041792847 8:61715508-61715530 GAGTGTCTCAGGAGGGCTCAGGG + Intergenic
1043835129 8:85036816-85036838 GAGGGAGGGAGGAGGGCGGAGGG + Intergenic
1046588367 8:116175753-116175775 GAGGGAGTGAGGTGGGAGGAAGG + Intergenic
1047058412 8:121193805-121193827 GAGTGAGTGTGGAGGAAACATGG + Intergenic
1047060188 8:121216658-121216680 GAGAGAGAGAGGAGGGCAGAGGG + Intergenic
1047953663 8:129956805-129956827 GAGGGAGGGAGGAGGGAGGAAGG - Intronic
1048205792 8:132414283-132414305 CAGAGAGTCAGGAGGGAGCAGGG + Intronic
1049032232 8:140046452-140046474 GAGACAGGGAGGAAGGCGCAAGG - Intronic
1049718169 8:144103528-144103550 GAGTGGGGGCGGAGGGCGCGCGG - Intronic
1050975685 9:11935383-11935405 GAGTGGGAGGGGAGGGTGCAGGG + Intergenic
1052857160 9:33414672-33414694 GACTGAGTGGGCAGGGGGCATGG + Intergenic
1053130157 9:35610044-35610066 GGGTGGGGGAGGAGGGCGCACGG - Exonic
1054355016 9:64051943-64051965 GAGTGAGAGGGGAGGAGGCAAGG - Intergenic
1055605035 9:77960308-77960330 GAGGGAGTGAGGAGAAGGCATGG + Intronic
1055666165 9:78555221-78555243 GAAGGAGAGAGGAGGGAGCATGG + Intergenic
1056100114 9:83293052-83293074 GTGTGAGTGAGGAGAGAGCCAGG + Intronic
1056214906 9:84397739-84397761 AAGTGAGGGAGGAAGCCGCAGGG + Intergenic
1057200865 9:93139368-93139390 GAGTGGGTGAGGGGAGGGCAAGG - Intergenic
1057887367 9:98840136-98840158 GAGTGAGGGTGGTGGGCCCACGG + Intronic
1058128779 9:101226265-101226287 GGATGAGTGAGGAGGGGGGAGGG - Intronic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060597475 9:124856930-124856952 GAGTGAGTGCTGAGGGCTCCTGG - Intronic
1060720180 9:125971320-125971342 GAGGGAGGGAGCAGGGGGCATGG + Intergenic
1060823426 9:126674128-126674150 GACAGAGTGAGGAGGGCTCCAGG + Intronic
1061404411 9:130385498-130385520 GGCTGAGTGGGGAGGGCGCAGGG + Intronic
1061587094 9:131576268-131576290 GACAGAGTGAGGAGGCCCCAGGG - Intergenic
1062144065 9:134979112-134979134 GAGGGAGGGAGGAGGGGGGAGGG + Intergenic
1062185649 9:135216871-135216893 GTGTGAGTGAGGAGGGGGAAGGG + Intergenic
1062250779 9:135592528-135592550 GAGTGAGGGTGGGGGGCTCAGGG + Intergenic
1062503059 9:136859461-136859483 GGCAGAGTGAGGAGGGCACAGGG - Intronic
1203743348 Un_GL000218v1:21048-21070 GAGTGAGAGGGGAGGAGGCAAGG - Intergenic
1185708521 X:2282879-2282901 GAGGGAGGGAGGAGGGAGAAGGG + Intronic
1185886667 X:3789421-3789443 GTGTGTGTGGGGAGGGAGCAGGG - Intergenic
1187028700 X:15463019-15463041 GAGGGAGAGAGGAGGGGGCTTGG - Intronic
1188734586 X:33696735-33696757 GAGAGAGGGAAGAGGGTGCAAGG + Intergenic
1188913971 X:35887511-35887533 TTGTCAGTGAGGAGGGGGCACGG + Intergenic
1192222991 X:69210092-69210114 GAGTGATAGAGGAGGGGGCTTGG + Intergenic
1192234500 X:69287124-69287146 GAGGGACTGAGGAGGGCGGCTGG - Intergenic
1195025053 X:100868493-100868515 GAGGGAGTGGGTAGGGCACAGGG - Intronic
1195990297 X:110675757-110675779 GAGGGAGTGAGGAGGGAGGATGG + Exonic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196106253 X:111899092-111899114 TAGTGGGTGAGGAGAGGGCAAGG - Intronic
1198177825 X:134173029-134173051 TAGTGGGTGAAGAGGGCGCCTGG - Intergenic
1198716873 X:139566960-139566982 GAGAGAGAGAGGAGGGAGGAAGG + Intergenic
1199264748 X:145817717-145817739 GAGGGAGTGAGGAGGGAGGAGGG - Intergenic
1199264754 X:145817735-145817757 GAGGGAGGGAGGAGGGAGGAGGG - Intergenic
1200067647 X:153511873-153511895 GAGTGGCTGTGGAGGGCACAGGG + Intergenic
1200685428 Y:6254495-6254517 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200687814 Y:6273104-6273126 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200830225 Y:7681509-7681531 GAGTGAATGAGGATGGCAGAGGG - Intergenic
1200990957 Y:9345736-9345758 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200993616 Y:9366029-9366051 GGGTGAATGAGGATGGCGGAGGG + Intronic
1200996278 Y:9386347-9386369 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200998793 Y:9454902-9454924 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201001448 Y:9475211-9475233 GGGTGAATGAGGATGGCGGAGGG + Intronic
1201004113 Y:9495513-9495535 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201006769 Y:9515825-9515847 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201009421 Y:9536131-9536153 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1201047455 Y:9901598-9901620 GGGTGAATGAGGATGGCGGAGGG - Intergenic
1201156875 Y:11138519-11138541 GAGTGAGAGGGGAGGAGGCAAGG - Intergenic
1202186171 Y:22186492-22186514 GTGTGAGTGATGATGGCGGAGGG - Intergenic
1202205188 Y:22399904-22399926 GTGTGAGTGATGATGGCGGAGGG + Intronic