ID: 1018723996

View in Genome Browser
Species Human (GRCh38)
Location 6:166596792-166596814
Sequence CCTCACAGAGTGTATTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 174}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018723996_1018724005 14 Left 1018723996 6:166596792-166596814 CCTGACTAATACACTCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 174
Right 1018724005 6:166596829-166596851 AATATGGGAGACAAACAGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 239
1018723996_1018724008 17 Left 1018723996 6:166596792-166596814 CCTGACTAATACACTCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 174
Right 1018724008 6:166596832-166596854 ATGGGAGACAAACAGGGTGGGGG No data
1018723996_1018724006 15 Left 1018723996 6:166596792-166596814 CCTGACTAATACACTCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 174
Right 1018724006 6:166596830-166596852 ATATGGGAGACAAACAGGGTGGG No data
1018723996_1018724001 -1 Left 1018723996 6:166596792-166596814 CCTGACTAATACACTCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 174
Right 1018724001 6:166596814-166596836 GAAACACTGGGCCTGAATATGGG 0: 1
1: 0
2: 0
3: 15
4: 121
1018723996_1018724000 -2 Left 1018723996 6:166596792-166596814 CCTGACTAATACACTCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 174
Right 1018724000 6:166596813-166596835 GGAAACACTGGGCCTGAATATGG No data
1018723996_1018724003 10 Left 1018723996 6:166596792-166596814 CCTGACTAATACACTCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 174
Right 1018724003 6:166596825-166596847 CCTGAATATGGGAGACAAACAGG No data
1018723996_1018724007 16 Left 1018723996 6:166596792-166596814 CCTGACTAATACACTCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 174
Right 1018724007 6:166596831-166596853 TATGGGAGACAAACAGGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 282
1018723996_1018724009 18 Left 1018723996 6:166596792-166596814 CCTGACTAATACACTCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 174
Right 1018724009 6:166596833-166596855 TGGGAGACAAACAGGGTGGGGGG 0: 1
1: 0
2: 5
3: 45
4: 448
1018723996_1018724004 11 Left 1018723996 6:166596792-166596814 CCTGACTAATACACTCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 174
Right 1018724004 6:166596826-166596848 CTGAATATGGGAGACAAACAGGG 0: 1
1: 0
2: 0
3: 16
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018723996 Original CRISPR CCTCACAGAGTGTATTAGTC AGG (reversed) Intronic
902037072 1:13465604-13465626 CATTAGAGGGTGTATTAGTCAGG + Intergenic
903735188 1:25525444-25525466 TCTTCCAGACTGTATTAGTCAGG + Intergenic
908182994 1:61624593-61624615 TCTCACAAACTTTATTAGTCAGG - Intergenic
908947624 1:69518797-69518819 CTTTAAATAGTGTATTAGTCAGG - Intergenic
909209517 1:72806112-72806134 CATGAATGAGTGTATTAGTCAGG - Intergenic
910455391 1:87392355-87392377 CCTCAAAGAATGTGTCAGTCAGG + Intergenic
911991544 1:104704493-104704515 CATCATCGATTGTATTAGTCTGG + Intergenic
913484539 1:119321869-119321891 CCTGACAGGTTGTATTAATCAGG + Intergenic
913701733 1:121380950-121380972 GCCCACAGAGTGTATGAGTGTGG - Intronic
914042293 1:144061419-144061441 GCCCACAGAGTGTATGAGTGTGG - Intergenic
914135796 1:144899069-144899091 GCCCACAGAGTGTATGAGTGTGG + Intronic
919472814 1:197999902-197999924 CCTTACAGATTGTTTTAGTCAGG + Intergenic
919558113 1:199086560-199086582 CATCAGTGAGTGGATTAGTCTGG + Intergenic
920489157 1:206399670-206399692 GCCCACAGAGTGTATGAGTGTGG - Intronic
923332300 1:232936376-232936398 GCTTACTGAGTGCATTAGTCAGG - Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1064236728 10:13582840-13582862 CCACAGTGACTGTATTAGTCAGG - Intergenic
1066294569 10:34043041-34043063 CCATACAGAGTGTTTTTGTCCGG + Intergenic
1066610586 10:37243980-37244002 CCTCACAGAGTGCTTTTGTATGG + Intronic
1067707426 10:48620180-48620202 CCTCACAGAGTTTATTGGGTTGG + Intronic
1068221354 10:54050069-54050091 CCTCACAGAGTGCGTTAGGGTGG + Intronic
1068296347 10:55077301-55077323 CCTTTCACAGTGTATTTGTCTGG + Intronic
1068419803 10:56776607-56776629 CCTCTCACAATGTATTAGTGAGG - Intergenic
1068666173 10:59678238-59678260 CCTAACAGAGTGGATCAGTTGGG + Intronic
1070473481 10:76809075-76809097 CTTCACAGAGTGTATGTTTCTGG - Intergenic
1071378730 10:85036253-85036275 GCTTACTCAGTGTATTAGTCAGG - Intergenic
1073025934 10:100487342-100487364 CCTTACAGAGTGTAGTATTAGGG + Exonic
1073149357 10:101301482-101301504 CCTCATACACTGTATTAGTCAGG - Intergenic
1074764340 10:116689551-116689573 GCTCAGACACTGTATTAGTCAGG + Intronic
1075164542 10:120055260-120055282 ATTTACACAGTGTATTAGTCAGG + Intergenic
1075210062 10:120483405-120483427 CCTAAGAGAATGTATTAATCAGG - Intronic
1076463073 10:130659618-130659640 CCTTAGTGAGTGTATTAGTCAGG + Intergenic
1080100194 11:28451192-28451214 CCTCAGACACTGTAGTAGTCTGG - Intergenic
1080254912 11:30279941-30279963 ACTTATAGAGTATATTAGTCAGG + Intergenic
1080492616 11:32782433-32782455 CCTCACAAAATGTTCTAGTCAGG + Intronic
1081095139 11:38923156-38923178 ACTCACTCATTGTATTAGTCAGG + Intergenic
1085904637 11:80745675-80745697 CCTCTCCGTATGTATTAGTCTGG - Intergenic
1086008238 11:82066143-82066165 CCTCACAGAATGAATTAGGGAGG + Intergenic
1086049192 11:82568824-82568846 TGTCACACAGTGTATTAGTCAGG + Intergenic
1087675298 11:101154656-101154678 CCATGCAGACTGTATTAGTCAGG + Intergenic
1092972888 12:13715175-13715197 CCTGACAGGGTGAATTATTCTGG + Intronic
1093259181 12:16913901-16913923 CCTTGCATGGTGTATTAGTCAGG + Intergenic
1093526896 12:20114198-20114220 CGTGACAGTCTGTATTAGTCAGG + Intergenic
1093663506 12:21785056-21785078 TGTCACATACTGTATTAGTCAGG + Intergenic
1094310263 12:29072933-29072955 CCTCAAGCATTGTATTAGTCAGG - Intergenic
1107333375 13:39326336-39326358 CCTAACAGAGATTATTATTCAGG - Intergenic
1108735349 13:53278192-53278214 ACTCACTCACTGTATTAGTCAGG + Intergenic
1112919079 13:104587909-104587931 CCTCACAGAGTTTATTTCTGTGG + Intergenic
1114379846 14:22190962-22190984 AATCACAAAGTGTATTAGTCAGG + Intergenic
1114621920 14:24101253-24101275 CCTAACACAGGGTATTATTCTGG - Intronic
1117830853 14:59748188-59748210 CCTCACAGACTGACTTAATCGGG - Intronic
1119972417 14:78986248-78986270 ACTCACCAAATGTATTAGTCAGG - Intronic
1127244863 15:57161312-57161334 CCTCTAAGAGTTTATGAGTCTGG + Intronic
1127963905 15:63909849-63909871 CCCCACAGATTGTATCTGTCAGG + Intronic
1129653565 15:77508109-77508131 CCTCACTGAGCAGATTAGTCAGG - Intergenic
1130564899 15:84985625-84985647 TCTCACAGAGTTGATTAGTTGGG - Intronic
1131194642 15:90345834-90345856 TCACAGTGAGTGTATTAGTCTGG - Intergenic
1131748195 15:95473195-95473217 CCTCACAGATTATATTAAACAGG - Intergenic
1133678100 16:8094794-8094816 CATCACTGAATCTATTAGTCAGG + Intergenic
1137243208 16:46677314-46677336 TCTCATGGAGTGTATTATTCAGG - Exonic
1137566892 16:49538917-49538939 CCTCAGATAATGTATTAGCCAGG - Intronic
1138102617 16:54265964-54265986 CCCCACACAGTGTATAACTCAGG + Intronic
1139292758 16:65873242-65873264 ACTCACTGACTGTATTAGTCAGG + Intergenic
1139703951 16:68727432-68727454 TGTTACACAGTGTATTAGTCAGG - Intergenic
1142865420 17:2788154-2788176 TTTGATAGAGTGTATTAGTCAGG + Intronic
1148179665 17:45595160-45595182 AGTCACCGAGCGTATTAGTCAGG + Intergenic
1148269239 17:46250741-46250763 AGTCACTGAGCGTATTAGTCAGG - Intergenic
1148995874 17:51709084-51709106 CCTCAGAATCTGTATTAGTCAGG - Intronic
1149167540 17:53771021-53771043 CCTAACAGAGTCTATGATTCTGG - Intergenic
1151000285 17:70368352-70368374 CATCACCCATTGTATTAGTCAGG + Intergenic
1151338405 17:73454588-73454610 CCTCACAGAGTGTGGCTGTCCGG + Intronic
1153399759 18:4670563-4670585 CCTCACAGAATGAATTAGGAAGG - Intergenic
1157821134 18:50770297-50770319 CATTACATAGTGTATTAGTCAGG - Intergenic
1161330096 19:3682852-3682874 CCTCACACAGTTTCTGAGTCAGG - Intronic
1164675669 19:30098905-30098927 TCTCATAGCATGTATTAGTCAGG + Intergenic
1165359033 19:35322663-35322685 CCTCACATTCTGTATTTGTCTGG + Intronic
1167780264 19:51594416-51594438 CCTCCCAGAGTGTACTAGGCCGG - Intergenic
926774639 2:16409653-16409675 CCTCACTGAGTTTATTAGGCAGG + Intergenic
927431138 2:23027048-23027070 CTTCACTCAGTGTAGTAGTCAGG + Intergenic
928710253 2:33997275-33997297 CCTCACAGACTGACTTAATCTGG + Intergenic
929728235 2:44456021-44456043 CCTCAAAGAGTTTATTAGTAGGG - Intronic
930240674 2:48932821-48932843 CCTCAGAGAGGGTATTGGTGGGG + Intergenic
933326745 2:80847437-80847459 AATGAGAGAGTGTATTAGTCAGG + Intergenic
935485258 2:103645446-103645468 CCTGACAAACTGTATTAGTCAGG - Intergenic
936613351 2:114023554-114023576 CCTCACATAGTGTATATGTGAGG + Intergenic
937278065 2:120698781-120698803 GCTCACAGATTCTATTGGTCAGG - Intergenic
939204342 2:139080827-139080849 CCTTACAGGGTGCATTAGTCAGG + Intergenic
940469319 2:154074569-154074591 CCTCATAGAATGAATTAGTCAGG - Intronic
942815052 2:180042989-180043011 CATCACAGAGTGCAATACTCTGG - Intergenic
943019404 2:182553983-182554005 CATCACAGACTGTTTTAGGCAGG + Intergenic
943244536 2:185429406-185429428 CCTAACCCATTGTATTAGTCAGG - Intergenic
943383726 2:187178281-187178303 TGTGACAGACTGTATTAGTCAGG + Intergenic
947046319 2:225990813-225990835 CCTCACTGAGTGTATTAGTAAGG + Intergenic
948533355 2:238628006-238628028 AGTCATACAGTGTATTAGTCAGG - Intergenic
1169992537 20:11519384-11519406 CTTTACAGAGTGTATTAGGCTGG - Intergenic
1170160781 20:13308092-13308114 GATCACAGAGTGGAGTAGTCAGG - Intergenic
1170317995 20:15063358-15063380 CCTCACAGAGTGTGGTAGAAAGG - Intronic
1171426979 20:25055200-25055222 CCTCGCAGAGTCTGTGAGTCAGG - Intronic
1174709923 20:52693547-52693569 CGTCACACTGTGTATTAATCAGG - Intergenic
1174712381 20:52720646-52720668 GCTTACATATTGTATTAGTCAGG + Intergenic
1175580460 20:60094842-60094864 CCTCAGAGAGTGTCTCAGACTGG + Intergenic
1176226192 20:64001069-64001091 CCTCACAGAGTGAAGATGTCTGG + Exonic
1177489669 21:21805905-21805927 GCTTAAAGAGTGTATTAGTCAGG - Intergenic
1177528425 21:22329032-22329054 CTTAACATAGTGTATTAGTCAGG + Intergenic
1178012922 21:28307267-28307289 CCTCACTGCCTGTACTAGTCAGG - Intergenic
1178471350 21:32895766-32895788 GGTAACAGAGTATATTAGTCAGG - Intergenic
1180017064 21:45094265-45094287 CCTCACAGAGGTTATCAGTGAGG - Intronic
1182853390 22:33495914-33495936 CCTCTGTGAGTGTATTAGTCAGG + Intronic
1183783464 22:40015022-40015044 CCTCAGTGCCTGTATTAGTCAGG + Intronic
949949298 3:9216096-9216118 CCTCTGAGTGTGCATTAGTCAGG - Intronic
950133672 3:10565287-10565309 CTTCATAGAATGTATTAGTTAGG - Intronic
950421055 3:12899778-12899800 CCTCAGAGAGTGTTTTCATCAGG - Intronic
951163122 3:19450859-19450881 TCTCACAGAGAGTCCTAGTCAGG - Intronic
951499181 3:23364754-23364776 CCTCACAGAATGAATTAGAGAGG - Intronic
952078785 3:29731751-29731773 ACTAACACATTGTATTAGTCAGG + Intronic
955823664 3:62922718-62922740 GGTCACACACTGTATTAGTCAGG - Intergenic
956684848 3:71816515-71816537 TATCCCACAGTGTATTAGTCAGG + Intergenic
957010086 3:74994416-74994438 CCTCTAAGAGTGTATTAGGTAGG - Intergenic
958834058 3:99123445-99123467 CCTGACACCCTGTATTAGTCAGG + Intergenic
962472806 3:135728193-135728215 CCTCACAGAGTGAGTTAGGGAGG + Intergenic
964067113 3:152593538-152593560 GCTGACAGAGTGAATCAGTCAGG + Intergenic
967692525 3:192493488-192493510 CCTCAAAGAATGTATTCGTCAGG + Intronic
968271389 3:197406227-197406249 CCTCAGACTGTGTATTAGTCAGG + Intergenic
970189427 4:13498559-13498581 CCTCACAGCATGTATCAATCAGG - Intergenic
972229128 4:37049925-37049947 CATTACAGTGGGTATTAGTCAGG + Intergenic
974574870 4:63705608-63705630 CTTAAGAGACTGTATTAGTCAGG + Intergenic
978587425 4:110288841-110288863 CCTCAAAGAATGTCATAGTCTGG + Intergenic
981055382 4:140355284-140355306 CCTAAGAGACTGTATTAGTCAGG - Intronic
982560632 4:156924954-156924976 CCTCACACAGTGAAAGAGTCAGG + Intronic
984401306 4:179268712-179268734 ATTGACAGAGTGTATTATTCTGG - Intergenic
984413468 4:179427068-179427090 CTACACCAAGTGTATTAGTCAGG + Intergenic
984452049 4:179914603-179914625 CTACACAGAGTGTATTAGTCAGG - Intergenic
986013481 5:3737850-3737872 CCTTTCAGAGTCTATTCGTCAGG - Intergenic
987450116 5:18072704-18072726 TTTCACTGGGTGTATTAGTCAGG - Intergenic
988847383 5:35141911-35141933 CCTCACAGAGTGGAGGAGACGGG - Intronic
989756590 5:44962665-44962687 CATGACAGACTGTATTAGTTAGG + Intergenic
990144642 5:52745275-52745297 CCTACCCTAGTGTATTAGTCAGG + Intergenic
990988738 5:61664582-61664604 CCTCTCAGATTCTATCAGTCTGG + Intronic
991461527 5:66863981-66864003 CCACACACAGTGTTTCAGTCAGG - Intronic
991560668 5:67948214-67948236 ACCTACAGAGTATATTAGTCTGG + Intergenic
992191699 5:74298393-74298415 CCTCACAGAGCCTTTCAGTCTGG + Intergenic
992631964 5:78690364-78690386 CATCCCTTAGTGTATTAGTCCGG - Intronic
994837284 5:104872017-104872039 CCTTGCAAGGTGTATTAGTCAGG - Intergenic
995127219 5:108590296-108590318 AAATACAGAGTGTATTAGTCAGG - Intergenic
995945660 5:117642572-117642594 CCACACACAGTGTATTAGTTAGG + Intergenic
996953952 5:129161615-129161637 CCTCACTGAGAGTATTAAGCAGG - Intergenic
1004377650 6:15104606-15104628 TCTCACTTTGTGTATTAGTCAGG + Intergenic
1007928186 6:45667214-45667236 ACTCACATGGTGTATGAGTCCGG + Intergenic
1009889127 6:69658779-69658801 TCTTAGAGACTGTATTAGTCAGG + Intergenic
1010430085 6:75768786-75768808 CCATAGAGAATGTATTAGTCTGG + Intronic
1012015130 6:93840576-93840598 GCTCAGAAACTGTATTAGTCAGG + Intergenic
1012039957 6:94191320-94191342 ACTTACAGGTTGTATTAGTCAGG - Intergenic
1012096347 6:94967580-94967602 CCTCACAGAGTGAGTTAGGAAGG - Intergenic
1013962253 6:115914391-115914413 TCTCACTGAGTGTATTGGTTTGG - Intergenic
1014372840 6:120634096-120634118 CCACACACATTGTATTAGTCAGG + Intergenic
1016151130 6:140744563-140744585 CATCAAGGACTGTATTAGTCAGG + Intergenic
1017225949 6:152021444-152021466 ACACACTGGGTGTATTAGTCAGG - Intronic
1017558701 6:155603696-155603718 CATGACACACTGTATTAGTCAGG + Intergenic
1018234633 6:161712104-161712126 CCTCACCTCATGTATTAGTCAGG - Intronic
1018723996 6:166596792-166596814 CCTCACAGAGTGTATTAGTCAGG - Intronic
1018844270 6:167544497-167544519 ACTCACAGAGTGTCATAGACAGG - Intergenic
1018955886 6:168410415-168410437 GCTCACAGAGTGAATCAGACTGG + Intergenic
1019044130 6:169130019-169130041 ATTTAGAGAGTGTATTAGTCAGG + Intergenic
1021920704 7:25482084-25482106 TCTAACACAGTGTACTAGTCAGG + Intergenic
1022160580 7:27706579-27706601 TGTCAGAGAATGTATTAGTCAGG - Intergenic
1024745905 7:52405799-52405821 TCTCACAGAGTGTTTTGGCCAGG + Intergenic
1026275250 7:68870690-68870712 GATCACAGAGGGGATTAGTCGGG + Intergenic
1028721210 7:94033940-94033962 ACACACAGTCTGTATTAGTCAGG + Intergenic
1031669216 7:124522150-124522172 CCTCATAGAGTGTGTTAGGGAGG + Intergenic
1032670362 7:134076554-134076576 ACTCAAGGAGTGTATTAGCCAGG + Intergenic
1032846745 7:135757908-135757930 ACAGACACAGTGTATTAGTCAGG - Intergenic
1033484901 7:141779078-141779100 CCTCAAGGAGTGTATTAGCAAGG - Exonic
1034215890 7:149405303-149405325 AATCCCAGAGTGTATGAGTCTGG + Intergenic
1035006504 7:155666064-155666086 ACTCATGCAGTGTATTAGTCAGG + Intronic
1039013847 8:33124466-33124488 CCTCACAGAGTCTATTTCTTTGG + Intergenic
1039826261 8:41176273-41176295 GGTTACAGATTGTATTAGTCAGG + Intergenic
1044853830 8:96454349-96454371 GCTCACAGTTTGTACTAGTCAGG + Intergenic
1045831549 8:106467655-106467677 CTTCTCAGAGTGTATTTGCCAGG - Intronic
1047722466 8:127653775-127653797 GCTCAGAGGGTGTATTAGTCAGG - Intergenic
1048744816 8:137602299-137602321 TCTCCCATAGTGTATTACTCTGG - Intergenic
1049922600 9:379375-379397 CCCCAGAGAGTGTATTAATCAGG - Intronic
1050775147 9:9250394-9250416 TCTCTCAGAGGGTATAAGTCAGG + Intronic
1055585650 9:77756728-77756750 GCTTAAAGAGTGTATTAGTCAGG - Intronic
1056821050 9:89842388-89842410 CCTCTCAGAGTGTGACAGTCAGG + Intergenic
1057882581 9:98803659-98803681 ACTGACAGAGTGGATTAGGCAGG + Intergenic
1058355806 9:104082495-104082517 TCTTATAGGGTGTATTAGTCAGG + Intergenic
1059580977 9:115547949-115547971 CCTGAGTGAGTGTATTGGTCAGG - Intergenic
1060618817 9:125044346-125044368 TCCCACAGAGGGTATGAGTCTGG - Intronic
1062179290 9:135182258-135182280 GGTGACAGACTGTATTAGTCAGG - Intergenic
1185652241 X:1656365-1656387 CCATATAGATTGTATTAGTCAGG + Intergenic
1186688141 X:11947058-11947080 GCTGTAAGAGTGTATTAGTCAGG - Intergenic
1187339052 X:18405189-18405211 GCTAGCAGGGTGTATTAGTCAGG + Intergenic
1187515524 X:19966386-19966408 CCTCACAGAGGATATTCGCCTGG - Exonic
1191595257 X:62936457-62936479 CTTCACAGTGTGTCTGAGTCTGG + Intergenic
1192891138 X:75392060-75392082 CCTTACAGTTTGTATTAGTCAGG + Intronic
1193391611 X:80935782-80935804 ATTCAAAGAGTGTATTAGTCAGG - Intergenic
1193872450 X:86817169-86817191 CCTAACATAGTGCATTAGTTAGG - Intronic
1194440206 X:93923318-93923340 CATCATAGAGTGTATTAGGTTGG + Intergenic
1194446463 X:93993401-93993423 CATCACAGAGTGTCATAGTTGGG + Intergenic
1196887391 X:120261155-120261177 CCTCACAGAGTTAATGAGCCTGG + Intronic
1196975830 X:121156589-121156611 CTTAACAGATTGTATTAGTGAGG - Intergenic
1197075929 X:122351991-122352013 ACTCACAGATTGTACTTGTCAGG - Intergenic
1199046729 X:143182908-143182930 GGTCACACAATGTATTAGTCAGG - Intergenic
1200624443 Y:5493825-5493847 GCTCACAGTGTGTATTAGGAGGG - Intronic