ID: 1018725827

View in Genome Browser
Species Human (GRCh38)
Location 6:166612800-166612822
Sequence TCAAGGGCATGGAGAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 760
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 696}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018725827_1018725831 -4 Left 1018725827 6:166612800-166612822 CCTCTCTCTCTCCATGCCCTTGA 0: 1
1: 0
2: 2
3: 61
4: 696
Right 1018725831 6:166612819-166612841 TTGACCTGTCCTCCTCCCTCTGG 0: 1
1: 0
2: 4
3: 33
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018725827 Original CRISPR TCAAGGGCATGGAGAGAGAG AGG (reversed) Intronic
900133224 1:1099540-1099562 TCTAAGAAATGGAGAGAGAGAGG + Intronic
900495165 1:2972880-2972902 ACGGGGGCATGGAGAGACAGGGG - Intergenic
900521549 1:3107801-3107823 CCCAGGGCAGGGAGAGAGTGAGG - Intronic
900887170 1:5423284-5423306 TCTCTGGCATGGAGAGAGACCGG + Intergenic
901461341 1:9393600-9393622 GAAAGGACACGGAGAGAGAGGGG + Intergenic
901463241 1:9404237-9404259 TCATGGGCGTGGAGAGAGTTGGG + Intergenic
901843310 1:11966743-11966765 ACATGGGCATGGAGGGAGGGAGG - Intronic
902152416 1:14454180-14454202 TCCAAGGCATGGAAAGAGAGGGG + Intergenic
902723642 1:18321297-18321319 TAAAGGGCAGGCAGAGTGAGTGG - Intronic
903042220 1:20539867-20539889 TCTTGGGAATGGAGAGAGAGAGG + Intergenic
903376044 1:22866623-22866645 CCAAGGACATTGAAAGAGAGAGG + Intronic
903404986 1:23088645-23088667 ACAGGGACAAGGAGAGAGAGAGG + Exonic
903449380 1:23442528-23442550 CCCAGGACATGCAGAGAGAGCGG - Exonic
903573608 1:24323912-24323934 TCAAGGGCAGGGACCGAAAGGGG + Intronic
904200962 1:28818777-28818799 TCATGGGGATGGTGAGAGGGAGG + Intronic
904226998 1:29029945-29029967 TCAGGGGTATGGAGAGAAAAAGG + Intronic
904410279 1:30320841-30320863 TCAGGGGCATGGAGTGGGTGGGG + Intergenic
904562929 1:31410819-31410841 TCTAGGTCATGGATAGGGAGGGG + Intronic
904666609 1:32126823-32126845 TCAAGGGAATGAAGACAGAATGG + Intronic
905224983 1:36473024-36473046 AGAAGGGCATAGAGAGAGAGGGG - Intronic
905260979 1:36718975-36718997 CCAAGGGGAGGGAGAGAGATGGG + Intergenic
905281132 1:36850071-36850093 TCAAGGACTTGGGGAGTGAGTGG + Intronic
905331884 1:37209141-37209163 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
905462389 1:38130204-38130226 TCAAGGGCAGGAAAAGAGAGAGG - Intergenic
905494271 1:38372251-38372273 GGAAGGGCAGAGAGAGAGAGAGG + Intergenic
906045338 1:42825748-42825770 TAAAAAGCATGAAGAGAGAGAGG - Intronic
906726862 1:48050553-48050575 CCACGGGAATGGAGAGAGAGAGG - Intergenic
907408394 1:54268100-54268122 TAGAGGTCAGGGAGAGAGAGGGG - Intronic
907420160 1:54341842-54341864 TGGAGAGCAGGGAGAGAGAGAGG + Intronic
908584445 1:65553124-65553146 TCAAGGGCAGCCAGAGAGAAAGG - Intronic
908878506 1:68704311-68704333 TCATGGCCCTGGAGAGATAGGGG + Intergenic
910177386 1:84444806-84444828 TTAAGGGCAGCCAGAGAGAGAGG + Intergenic
910387414 1:86700559-86700581 GCAAGGGCTGGGAGAGAGTGAGG + Intergenic
910770995 1:90832534-90832556 TTAGGGGGATGCAGAGAGAGAGG + Intergenic
910808305 1:91210784-91210806 GGAAGGGGAAGGAGAGAGAGAGG - Intergenic
910845592 1:91601910-91601932 TCCAGGGTTTGGAGGGAGAGTGG - Intergenic
911234888 1:95401834-95401856 AGATGGGAATGGAGAGAGAGAGG - Intergenic
911484392 1:98487551-98487573 TTAAGGGCATGGAGAAGAAGAGG + Intergenic
911502094 1:98699928-98699950 CCAAGGAAATGGATAGAGAGAGG - Intronic
911689966 1:100821673-100821695 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
912202548 1:107474721-107474743 TGAAGGGCAGAGAGAGAAAGAGG + Intronic
912303763 1:108543593-108543615 TTAAGGGCAGCCAGAGAGAGAGG + Intergenic
912759533 1:112354734-112354756 TGAGGGGCATGGAGAAAGAAGGG - Intergenic
912874017 1:113337401-113337423 TCAAGGAGAGGGAGAGAGACAGG + Intergenic
913090066 1:115470532-115470554 TAAAGGCAATGGAGAAAGAGTGG - Intergenic
914436171 1:147661494-147661516 TCAAGGAGAGGGAGAGAGATGGG - Intronic
914513117 1:148351969-148351991 TCAGGGGGAGAGAGAGAGAGAGG + Intergenic
914748656 1:150517319-150517341 TTGAGGGCATGGTGAGGGAGGGG + Intergenic
915085583 1:153386375-153386397 TAAAGGGCATGGAGAGAATCTGG - Intergenic
915267508 1:154729402-154729424 CCGAGTGCATGGAGAGAGGGTGG + Intronic
916038234 1:160940263-160940285 TTAAGGGCAGCCAGAGAGAGAGG - Intergenic
916344748 1:163775272-163775294 TCAAGGGGCTGGGGAGAGGGAGG + Intergenic
916773454 1:167936234-167936256 TCGAGGGCATGGGGAGAAGGAGG - Intronic
917439285 1:175052559-175052581 TGGAGGGCAAGGAGAGAGAAGGG + Intergenic
917842374 1:178992006-178992028 TTAAGGGCAGCCAGAGAGAGAGG - Intergenic
918107121 1:181424896-181424918 GCAAGGGCAGGGTGGGAGAGAGG - Intronic
918397932 1:184134981-184135003 TTAAGGGCAGCGAGAGAGAAAGG - Intergenic
918723303 1:187882557-187882579 TCAAGGGAAGGGAAAGGGAGAGG + Intergenic
918797993 1:188930331-188930353 TTAATGGCATAGAGAAAGAGAGG + Intergenic
919979911 1:202636374-202636396 TCCAGAGCAGGGAGAGGGAGAGG + Intronic
920230465 1:204466607-204466629 ACAAGAGAAAGGAGAGAGAGAGG + Intronic
920420341 1:205828857-205828879 TCCAGGGCTAGGAAAGAGAGGGG + Intronic
921223412 1:212992239-212992261 TCAAGGGATTGGGGAAAGAGAGG - Exonic
921343320 1:214156056-214156078 TCAAGGGCAAGGGAAGAGAAAGG + Intergenic
921888527 1:220330424-220330446 GCCAGGGCCTGGAGGGAGAGAGG - Intergenic
922126886 1:222736528-222736550 TCAGGGGCAAGGATAGAGTGAGG - Intergenic
922608799 1:226908951-226908973 CCAAGTGCAGGGGGAGAGAGAGG + Intronic
922659271 1:227415343-227415365 TCAAGGGCATTGTAAGAAAGGGG + Intergenic
923493595 1:234506067-234506089 TTAATGGAAGGGAGAGAGAGGGG - Intergenic
923875353 1:238041523-238041545 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
924206641 1:241718820-241718842 CAAATGGCAGGGAGAGAGAGGGG + Intronic
924293369 1:242561195-242561217 TCAAGGCCAGGAGGAGAGAGAGG - Intergenic
924581689 1:245329444-245329466 TCAAGTCCAAGGAGAGATAGTGG - Intronic
1062894803 10:1095070-1095092 TAATGGGCATGGAGAGAGGAGGG + Intronic
1062894811 10:1095113-1095135 TAATGGGCATGGAGAGAGGAGGG + Intronic
1064327248 10:14362996-14363018 TCAAGTGCATGGAGAGGTTGAGG - Intronic
1064655093 10:17548828-17548850 TCAGGAGTATTGAGAGAGAGAGG + Intergenic
1065125774 10:22572762-22572784 TCAAAGGCTTGGAGATAAAGGGG - Intronic
1066257468 10:33694705-33694727 TTAAGGGCAGTGAGAGAGAAAGG - Intergenic
1066267153 10:33787549-33787571 AGAAGGGCCTGGGGAGAGAGAGG + Intergenic
1066603821 10:37138959-37138981 TCAAGGGCAGCCAGAGAGAAAGG + Intronic
1067059164 10:43069058-43069080 TCAAGGGGCTGCAGAGAGTGGGG + Intergenic
1068029510 10:51689764-51689786 TCAAAGGCCTGGGGAAAGAGTGG + Intronic
1068641439 10:59412739-59412761 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
1068821083 10:61377784-61377806 TTAAGGGCAGCCAGAGAGAGAGG - Intergenic
1069093300 10:64228394-64228416 TTAAGGGCATCCAGAGAGAACGG - Intergenic
1069202640 10:65640945-65640967 ACAAAGGCATTGAGATAGAGTGG + Intergenic
1069457142 10:68561726-68561748 TCAAGAGCCTGGGGCGAGAGAGG - Intronic
1069586310 10:69605392-69605414 TGAAGAGAAGGGAGAGAGAGTGG + Intergenic
1070035619 10:72720393-72720415 TCAGGAGCATGGGGAGACAGAGG - Intronic
1070276897 10:75015958-75015980 GCAAGGGCATGGATAGGGACAGG - Intronic
1070366530 10:75742367-75742389 TCAACAAGATGGAGAGAGAGGGG + Intronic
1071066569 10:81643355-81643377 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1071230246 10:83578187-83578209 TCAAAGGCACGCAGAGAGAGGGG - Intergenic
1071576808 10:86733060-86733082 TGAGGGGAATGGGGAGAGAGAGG + Exonic
1072385070 10:94916407-94916429 CCAAGGGCTTGGGGAAAGAGAGG + Intergenic
1072765827 10:98094446-98094468 TCATTGGCTAGGAGAGAGAGTGG + Intergenic
1072818934 10:98537202-98537224 GCAAGGGAATGGAGAGGTAGGGG + Intronic
1072861312 10:99007933-99007955 TACAGGGCATGGGGAGAGGGTGG - Intronic
1073546516 10:104353921-104353943 TCAAGGGAAAGGCGACAGAGGGG - Intronic
1074983020 10:118634787-118634809 TGAAGGGTCTGGAGAGAGATGGG - Intergenic
1075186147 10:120259731-120259753 TCAAGGAGAGGGAGAGAGACAGG + Intergenic
1075236722 10:120737145-120737167 TCAGGGGCTTGGAGACAGAAAGG + Intergenic
1075254360 10:120912557-120912579 TTAAGGGCAGGCAGAGAGAAAGG + Intergenic
1075267966 10:121021598-121021620 GAAAGAGCATGGAGAGACAGGGG - Intergenic
1075587071 10:123666014-123666036 TCGCGGGCATGGGGTGAGAGCGG + Intergenic
1076037527 10:127213027-127213049 TAAAGGGGATGGATAGAAAGGGG - Intronic
1076134460 10:128036032-128036054 TAAAGGGTGAGGAGAGAGAGGGG + Intronic
1076866346 10:133168164-133168186 AGAAGGGCCTGGAGAGGGAGCGG - Intronic
1077142447 11:1030545-1030567 TCCAGGGAAGGGAGAGGGAGGGG - Intronic
1077315617 11:1918174-1918196 TCGAGGACATGGACAGGGAGGGG + Intergenic
1077544195 11:3162001-3162023 ACAAGGGAAGGGAGACAGAGTGG + Intronic
1077655507 11:4015452-4015474 TTAAGGGCAGCCAGAGAGAGAGG - Intronic
1078399331 11:11010403-11010425 CCATGAGCATGGAGAGAGAATGG + Intergenic
1078527465 11:12111342-12111364 TCCTGGGCCTGGAGCGAGAGCGG - Intronic
1078730918 11:13973236-13973258 GCAATGGCATGGAGATAGACTGG + Intronic
1078744519 11:14098645-14098667 TGAAAGGCAGAGAGAGAGAGAGG + Intronic
1079090224 11:17475873-17475895 TCAAGGTCTTGGAGAGAGATGGG + Intronic
1079233461 11:18669989-18670011 TAGAGGGCAGGGAGAGGGAGTGG - Intergenic
1079244753 11:18743963-18743985 ACAAGGGTCTGGAGAGAGGGTGG - Intronic
1079319956 11:19443416-19443438 TCCATGGCAGGGAGAGAGAGTGG - Intronic
1080033417 11:27686813-27686835 TTAAGGGCAGCGAGAGAGAAAGG - Intronic
1080981618 11:37414152-37414174 TCAATTGCATGGAGAAAGACAGG - Intergenic
1082135641 11:48546311-48546333 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1083135199 11:60667226-60667248 CCAAGGAGATGGAGAGAGACAGG - Intergenic
1083783907 11:64933071-64933093 TGAAGGGCAGGGAAAGGGAGAGG + Intronic
1083827587 11:65212098-65212120 TCAAGGGGAAGGAGATGGAGGGG - Intergenic
1084591518 11:70093327-70093349 TCAAAGGGAGGGAGAGAGAAGGG - Intronic
1085811664 11:79687977-79687999 TCAGGGGAGAGGAGAGAGAGAGG + Intergenic
1085975833 11:81653658-81653680 ACAGGGGGATGGAGGGAGAGAGG - Intergenic
1086128883 11:83380166-83380188 TCAAGGCTATGGAAAGAGATAGG + Intergenic
1086298373 11:85397011-85397033 TTAAGGGCATCCAAAGAGAGAGG + Intronic
1086544365 11:87950794-87950816 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1087719006 11:101640618-101640640 TTAAGGGCATCCAGAGAGAAAGG + Intronic
1088008492 11:104970662-104970684 TTAAGGGCAGCCAGAGAGAGAGG + Intergenic
1088017992 11:105083218-105083240 TTAAGGGCAGCCAGAGAGAGAGG + Intronic
1088020565 11:105113194-105113216 TTAAGGGCAGCCAGAGAGAGAGG + Intergenic
1088632586 11:111788346-111788368 TCAAGGGCTTTGATAGAGAAAGG + Intronic
1089406031 11:118198376-118198398 TTAAGTGAATGAAGAGAGAGAGG + Intronic
1089469180 11:118707158-118707180 TCAAGGGGATGGTGTGAGATGGG + Intergenic
1089675820 11:120088356-120088378 TCAAGGGCTTGGGGTGACAGTGG + Intergenic
1090555917 11:127875519-127875541 TCAAAACCATGCAGAGAGAGAGG - Intergenic
1091078176 11:132640847-132640869 TAAAGGGCAGGGAGAGGGTGGGG + Intronic
1091278568 11:134369072-134369094 TCAAGGGCCTGGGCAGGGAGGGG - Intronic
1091618512 12:2067846-2067868 GGAAGGGCATGGAAAGACAGGGG - Intronic
1092007991 12:5085736-5085758 TCAAGTGGATGGAGTGAGTGTGG - Intergenic
1093008722 12:14081165-14081187 TTAAGGGCAGGCAGAGAGAAAGG + Intergenic
1094283077 12:28761688-28761710 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
1094480343 12:30876520-30876542 TCACAGGAATGGGGAGAGAGGGG - Intergenic
1094482174 12:30893441-30893463 TTAAGGGCAGCGAGAGAGAAAGG - Intergenic
1094781892 12:33801263-33801285 TCAAGGGCAGCCAGAGAGAATGG - Intergenic
1094875811 12:34641250-34641272 TTAAGGGCAGCGAGAGAGAAAGG + Intergenic
1095546957 12:43383810-43383832 ACAAGGGGATGGAAAGAGGGAGG - Exonic
1096749439 12:53749364-53749386 AGAGGGGCACGGAGAGAGAGGGG + Intergenic
1096836332 12:54353552-54353574 TCAGGGGGAGGGAGAGGGAGAGG - Intergenic
1096901435 12:54887290-54887312 TTAAGGGCATCCAGAGAGAAAGG - Intergenic
1096959356 12:55562162-55562184 TCAAGGGCAGACAGAGAGAAAGG + Intergenic
1097247715 12:57615731-57615753 GGGAGGGCTTGGAGAGAGAGAGG + Intronic
1097321479 12:58231348-58231370 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
1097881651 12:64691720-64691742 TGGAGGGCAGGGAGAGGGAGAGG + Intronic
1097944727 12:65354134-65354156 TCAAGGGCAGCCAGAGAGAAAGG - Intronic
1098421545 12:70303625-70303647 TTAAGGGCATCCAGAGAGAAAGG - Intronic
1098636470 12:72790240-72790262 GCTAGGGCTTGGAGGGAGAGAGG + Intergenic
1099255758 12:80309452-80309474 TCAAGAGGCTGGAGAGAGTGTGG + Intronic
1099387136 12:82028284-82028306 AGAAGGGCAAAGAGAGAGAGAGG - Intergenic
1099451936 12:82818443-82818465 TCAAGTGCATGGAAAGAGTCAGG - Intronic
1099809093 12:87557904-87557926 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
1099965685 12:89442338-89442360 TTAAGGGCAGGCAGAGAGAAAGG + Intronic
1100126671 12:91435731-91435753 GCAAAGGCATGAAGAGGGAGAGG + Intergenic
1100417307 12:94391210-94391232 TTAAGGGCAGGCAGAGAGAAAGG + Intronic
1101331097 12:103758550-103758572 GCAATGGCAGGGAGTGAGAGAGG + Intronic
1101364039 12:104055069-104055091 TGAAGGGCAACAAGAGAGAGTGG + Intronic
1101416826 12:104515708-104515730 GGAAGGGCAGGGGGAGAGAGTGG + Intronic
1101852602 12:108416155-108416177 TCAAGGGCCTGGAGAAATATTGG - Intergenic
1101986612 12:109452001-109452023 TCAAGGGGATGCAGAGAAACAGG + Intronic
1102100569 12:110275315-110275337 TCATGGGCATGTAGAAAAAGTGG + Intergenic
1102420094 12:112796651-112796673 GCAATGGCAGGAAGAGAGAGAGG - Intronic
1102541010 12:113619257-113619279 GCAGGGGCAAGGAGAGAGGGAGG - Intergenic
1102721651 12:115021737-115021759 TCAAGGTCAGGCAGAGAGTGAGG - Intergenic
1103402989 12:120655766-120655788 CCAAGTGCATGAAGAGACAGGGG - Intronic
1103417458 12:120752593-120752615 TCATGGGGATGGAGGGAGAAGGG + Intergenic
1104146019 12:126034644-126034666 TCAAAAGGATGGAAAGAGAGAGG - Intergenic
1104618291 12:130289551-130289573 TAAAGGCCGTGGAGAGACAGCGG - Intergenic
1105071904 12:133239336-133239358 TAAAGAGCATGGAGGGAAAGGGG - Intergenic
1105387847 13:19948597-19948619 TATAGGGCAGGGAGAGAGATAGG + Intergenic
1105420178 13:20244980-20245002 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
1106040003 13:26081017-26081039 TTCACGGTATGGAGAGAGAGGGG - Intergenic
1106053300 13:26212118-26212140 ACAATGGAATGGAGAGAGATGGG - Intronic
1106381543 13:29244478-29244500 TGAAGGGCATGGAGACTGAATGG + Intronic
1107021226 13:35753986-35754008 TCAAAGGGAGGGAGAGAGGGAGG - Intergenic
1107248061 13:38321015-38321037 TAAAGGCTATTGAGAGAGAGAGG + Intergenic
1107632347 13:42355387-42355409 ACAAGGGCTTGGTGAGAGAGAGG - Intergenic
1107673897 13:42775352-42775374 TTAAGGGCATTCAGAGAGAAAGG - Intergenic
1107973583 13:45668473-45668495 TTAAGGGCAGCGAGAGAGAAAGG - Intergenic
1108088451 13:46820124-46820146 TAAAGTGCTTGAAGAGAGAGAGG + Intergenic
1108113655 13:47104234-47104256 TTAAGGGCAGGCAGAGAGAAAGG + Intergenic
1108162686 13:47658435-47658457 AAAAGGGAGTGGAGAGAGAGAGG - Intergenic
1108249386 13:48549774-48549796 TGAAGGGCAGGGAGAGAGAAGGG + Intergenic
1110010897 13:70332061-70332083 CCAAGGGCAGGAAGAGAGAAAGG - Intergenic
1110022681 13:70494738-70494760 TTAAGGGCAGGGAGGGAGATAGG - Intergenic
1111482062 13:88842530-88842552 TCAGGGGGAGGGAGGGAGAGAGG + Intergenic
1112245332 13:97728330-97728352 CCGAGGGGAAGGAGAGAGAGAGG - Intergenic
1112613561 13:100980251-100980273 TCAAGGGATTGGCAAGAGAGAGG + Intergenic
1112874103 13:104014424-104014446 TCAAGGGCATTGACATAGGGTGG - Intergenic
1113019488 13:105868040-105868062 TTCATGGCATGTAGAGAGAGTGG - Intergenic
1114407433 14:22469891-22469913 ACAAAGGAAGGGAGAGAGAGAGG + Intergenic
1114751409 14:25208945-25208967 TTAAGGGCAATGAGAGAGAAAGG - Intergenic
1114753551 14:25232579-25232601 ACAGGGGGAGGGAGAGAGAGAGG - Intergenic
1115714393 14:36086588-36086610 TCAGGAGCATGGTGAGTGAGGGG + Intergenic
1116013887 14:39383439-39383461 TCAAGGAGAGGGAGAGAGATGGG - Intronic
1116146376 14:41075256-41075278 TCAAGGACATGGATGGAGCGTGG + Intergenic
1116267032 14:42705497-42705519 ACAGGGGCATGGGGAGAGAGAGG + Intergenic
1116285371 14:42964535-42964557 TCAAGGGAAGGGATAGAGAGTGG + Intergenic
1116560744 14:46376000-46376022 TTAAGGGCAGCCAGAGAGAGAGG - Intergenic
1116828785 14:49697278-49697300 CCAAGGAGAGGGAGAGAGAGGGG + Intronic
1117172584 14:53115460-53115482 TTAAGGGCATCCAGAGAGAAAGG + Intronic
1119672157 14:76528049-76528071 CAAAGGGCATGGTGAGAAAGTGG - Intergenic
1120175897 14:81293091-81293113 TCAAGGGCAGGAAGATAGTGGGG + Intronic
1121431027 14:93888603-93888625 TGAAGGGCAAGGAGGAAGAGGGG + Intergenic
1121908974 14:97771748-97771770 CCAAGGGCTTGGACACAGAGAGG - Intergenic
1122270736 14:100567588-100567610 TCCAGGGCAGGGAGCCAGAGGGG + Intronic
1122376947 14:101267793-101267815 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1122412156 14:101531115-101531137 TCCAGGGCATGGACAGAAAGTGG - Intergenic
1122833991 14:104422072-104422094 TCAGGGAGATGGAGAGGGAGAGG - Intergenic
1125025205 15:35022746-35022768 GCAAGGGAAAAGAGAGAGAGAGG - Intergenic
1125054412 15:35340785-35340807 TCAAGGGCAGCCAGAGAGAAAGG - Intronic
1125058418 15:35390250-35390272 TCAAGGGCAGCCAGAGAGAAAGG - Intronic
1125257217 15:37778824-37778846 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1125812078 15:42550004-42550026 TCAAGGGCATTGAGAAAAATGGG + Intronic
1126096458 15:45094276-45094298 TCAGGAGATTGGAGAGAGAGAGG + Intronic
1126219445 15:46196056-46196078 TTAAGGGCATCCAGAGAGAAAGG - Intergenic
1127031929 15:54873422-54873444 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
1128306088 15:66599941-66599963 TCTGGGGCAAGGAGAGAAAGGGG - Intronic
1128442077 15:67719577-67719599 TGAAGGGTATGGGCAGAGAGTGG + Intronic
1128880552 15:71238475-71238497 TCCAGGGATTGGGGAGAGAGGGG - Intronic
1129094786 15:73194270-73194292 TTATGGCAATGGAGAGAGAGAGG + Intronic
1129495398 15:75975761-75975783 TCAAGGGCAGCCAGAGAGAAAGG - Intronic
1130127974 15:81110389-81110411 TAAAGGGGATGGAGGGAGTGGGG - Intronic
1130157429 15:81363786-81363808 CCTAGGGCATAGAGAGGGAGAGG + Intronic
1130649035 15:85751711-85751733 CCAAAGGCATGGGGAGAGAGGGG - Intergenic
1130685850 15:86036785-86036807 TATAGGACAAGGAGAGAGAGGGG + Intergenic
1130800098 15:87254153-87254175 TTAAGGGCATCCAGAGAGAAAGG - Intergenic
1130914358 15:88293031-88293053 TCCAGGGGCTGGAGAGAGTGGGG - Intergenic
1130922415 15:88358789-88358811 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1131850040 15:96530662-96530684 TCAAGGGCAATGAGAGTGGGAGG + Intergenic
1132221816 15:100110792-100110814 GCAAGAGCAGGGACAGAGAGAGG + Intronic
1132273845 15:100549304-100549326 TTGAGGGCATGGAGAGGGAATGG + Intergenic
1132293390 15:100718654-100718676 TGAAGGCTATGGTGAGAGAGGGG + Intergenic
1132515378 16:363544-363566 GGAAGGGCATGGAGAGCGGGCGG - Intergenic
1133927619 16:10205951-10205973 TCACCGGCATGGATAGGGAGAGG - Intergenic
1135790579 16:25390691-25390713 TCAAGGGCAGGGGTACAGAGGGG + Intergenic
1135964294 16:27023060-27023082 CGAAGGGCATGGATAAAGAGAGG - Intergenic
1136289935 16:29265434-29265456 CCAAGGCCATGGAGGGAGGGAGG - Intergenic
1136594409 16:31237924-31237946 ACAAGGACTGGGAGAGAGAGGGG + Intergenic
1136644151 16:31595105-31595127 CAAAGGGCATGGATAGAGAGAGG + Intergenic
1136660923 16:31761167-31761189 CAAAGGGCATGGATACAGAGAGG - Exonic
1137324831 16:47423836-47423858 TCAAGGGCAGCCAGAGAGAAAGG - Intronic
1137704218 16:50522926-50522948 TCACAGGGAGGGAGAGAGAGTGG - Intergenic
1137924990 16:52532195-52532217 AGAAGGGCATGGATAGACAGAGG - Intronic
1138347729 16:56330310-56330332 TCCAGGGCAGGGACAGGGAGTGG - Intronic
1138784930 16:59835131-59835153 TTAAGGGCATTCAGAGAGAAAGG - Intergenic
1139775363 16:69313406-69313428 CCCAGGGCTGGGAGAGAGAGGGG - Intronic
1140026576 16:71296172-71296194 TCAAGGGCAGAGTGATAGAGTGG + Intergenic
1140984012 16:80140724-80140746 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1141020709 16:80493552-80493574 TCAAGAGTATGTGGAGAGAGAGG - Intergenic
1141210969 16:81979275-81979297 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1141753933 16:85978828-85978850 CCAAGGGCAAGGAGAAAGGGAGG - Intergenic
1142338625 16:89506814-89506836 TGAAGGGCAGGGAGAGGGAGGGG + Intronic
1202995082 16_KI270728v1_random:101079-101101 TTAAGGGCAGCGAGAGAGAAAGG + Intergenic
1203021769 16_KI270728v1_random:413421-413443 TTAAGGGCAGCGAGAGAGAAAGG + Intergenic
1144044045 17:11438964-11438986 TGAAGGGCAGGGAAAGAGACGGG + Intronic
1144466557 17:15502141-15502163 GGAAGGACATGGAGAGAGATGGG - Intronic
1144696921 17:17310762-17310784 TCAGGGGGGTGGAGAGAGTGGGG + Intronic
1145390465 17:22451948-22451970 TCAAGGGCATGGACACACAAAGG + Intergenic
1146373079 17:32277221-32277243 TCTAGAGCATGGACAGGGAGAGG + Intronic
1146721931 17:35129965-35129987 TCAAGGGCATTGAAAGAAATAGG + Intronic
1146722895 17:35135543-35135565 TCAATGCCAGGGACAGAGAGAGG + Intronic
1147375469 17:40020143-40020165 TGAGGGGCATGGAGAGGGAAGGG + Intronic
1148403018 17:47384749-47384771 TTAAGGGCAGCCAGAGAGAGAGG - Intronic
1149591336 17:57831944-57831966 TGAAGGGCATGGGGAGGCAGTGG - Intergenic
1149730982 17:58945995-58946017 TCTAGGGAAGGGAGAGAGATGGG - Intronic
1150196325 17:63303503-63303525 TTAAGGGCAGGCAGAGAGAAAGG - Intronic
1150218609 17:63483673-63483695 TCAAAGGCCTGGAGTTAGAGTGG + Intergenic
1150509350 17:65733182-65733204 CCAAGGAGATGGAGAGAGATGGG + Intronic
1150601597 17:66655534-66655556 TAAAGGGCATGGAGAGAAAGTGG - Intronic
1151392802 17:73799098-73799120 TGAGGGGGAGGGAGAGAGAGAGG + Intergenic
1151477817 17:74353772-74353794 TCAAGGACATTTAGAGAGATGGG + Intronic
1151843426 17:76634112-76634134 TCTATGGCATGGAGAGCGAGCGG + Intronic
1152287582 17:79421794-79421816 ACAAGGGCAGAGAGAGAGAAGGG + Intronic
1152331596 17:79676610-79676632 GCCGGGGGATGGAGAGAGAGAGG + Intergenic
1152464426 17:80457870-80457892 GCGTGGGGATGGAGAGAGAGTGG - Intergenic
1152786117 17:82248971-82248993 TCTCCGGCATGGAGAGAGAGCGG - Exonic
1152796147 17:82308004-82308026 CCAATGTCATGGAGAGAGGGAGG - Intergenic
1153413237 18:4817306-4817328 AAAATAGCATGGAGAGAGAGAGG + Intergenic
1153991484 18:10404342-10404364 ACAATGGCATGGAGAGAGAATGG - Intergenic
1154057948 18:11029736-11029758 TCAGAGGCAGGGAGGGAGAGGGG - Intronic
1154959733 18:21296426-21296448 TGGAGGGGATGGAGAGAGGGTGG + Intronic
1155053149 18:22165411-22165433 TAACAGGCTTGGAGAGAGAGCGG + Intergenic
1155188814 18:23411250-23411272 GGAAGGGCAGGGAGAGAGAAGGG + Intronic
1155303880 18:24459829-24459851 CCCAGGGCATGGGCAGAGAGGGG - Intergenic
1155694312 18:28666472-28666494 TCAAGGAGAGGGACAGAGAGTGG + Intergenic
1156131006 18:33974458-33974480 TCAAGGAGAGGGAGAGAGATGGG + Intronic
1156484339 18:37455522-37455544 TTATGGGCCTGGAAAGAGAGGGG - Intronic
1157724843 18:49956328-49956350 ACAAGGAAATGGAGACAGAGAGG + Intronic
1157828162 18:50831282-50831304 CAGAGGGCATGGAGAGAGATTGG - Intergenic
1158398857 18:57102862-57102884 TTAAGGGCATCCAGAGAGAAAGG - Intergenic
1159488498 18:69098031-69098053 TCGTGGGCAAGGAGAGAGAATGG - Intergenic
1160767709 19:815737-815759 CGTAGGGCATGGAGAGAGTGCGG + Exonic
1160825984 19:1080799-1080821 TGACGGGGCTGGAGAGAGAGGGG + Intronic
1161005930 19:1936469-1936491 ACAAGGAGAGGGAGAGAGAGAGG + Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1161516260 19:4698239-4698261 TCCAGGGTATTGAGAGATAGGGG + Intronic
1161977362 19:7613817-7613839 CCATGGGAATGGAGAGACAGTGG - Intronic
1162568410 19:11457058-11457080 TCAGGGGCATGGATGGTGAGGGG + Intronic
1162640861 19:12009197-12009219 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1162811171 19:13164999-13165021 TCCAGGGCATGGACAGGGATGGG + Intergenic
1163156676 19:15443442-15443464 TGAAGGGCCAGGAGAGAGAGGGG - Intronic
1164246464 19:23434540-23434562 TTAAGGGCAGCCAGAGAGAGAGG - Intergenic
1165797662 19:38528242-38528264 TCCAGGGCTGGGAGTGAGAGGGG + Intronic
1166022805 19:40048421-40048443 CCATGGTCATGAAGAGAGAGAGG + Intronic
1166179832 19:41100237-41100259 TTAAGGGCAGTGAGAGAGAAAGG + Intergenic
1166408949 19:42543492-42543514 TCAGGAGCAGGGAGAGGGAGAGG + Intronic
1166517892 19:43461034-43461056 TCACGGGGAAGGTGAGAGAGAGG - Exonic
1166925696 19:46265618-46265640 TCAAGGACAGGGAGAGAAATAGG - Intergenic
1167114241 19:47479827-47479849 TTGAGGGGATGGGGAGAGAGCGG - Intronic
1167299364 19:48670321-48670343 GCAAAGGCAGGGAGAGTGAGGGG + Intronic
1167419994 19:49397247-49397269 GCCGGGGCATGGAGACAGAGAGG + Intronic
1167472998 19:49685782-49685804 TCAAGGGGTTGGGGAGACAGTGG + Intronic
1167565323 19:50252444-50252466 TAGAGGGGAAGGAGAGAGAGGGG + Intronic
1167570293 19:50282958-50282980 AGAAGGGGAAGGAGAGAGAGTGG - Intronic
1167784978 19:51629305-51629327 TCAAGGGCAGTGGGAGTGAGGGG - Intronic
925461618 2:4068069-4068091 TCGCGGGCAAGGGGAGAGAGAGG - Intergenic
925494337 2:4429355-4429377 TCAAGGGCAGAGAGAAGGAGAGG - Intergenic
925947863 2:8882371-8882393 GGAAGTGCATGGAGAGAGTGAGG + Intronic
926568613 2:14505863-14505885 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
926696191 2:15771433-15771455 TGAAGGGCAGGCAGAGTGAGGGG + Intergenic
926764149 2:16307990-16308012 TCAAGGTAATGGAGAGTGACTGG + Intergenic
926972096 2:18476509-18476531 TCAAGGGCATTGAGAAATTGAGG - Intergenic
927866429 2:26590851-26590873 CAAGGGGCCTGGAGAGAGAGTGG + Intronic
929039029 2:37724869-37724891 TTAAGGGCAGGCAGAGAGAAAGG + Intronic
930086550 2:47501754-47501776 TCCAGGAGGTGGAGAGAGAGGGG + Intronic
930359509 2:50359840-50359862 TCAAGGGCACGCAGAGAGAAAGG + Intronic
930586141 2:53269049-53269071 TCAAGGGCAGCTAGAGAGAAAGG + Intergenic
930803208 2:55463876-55463898 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
930951503 2:57148291-57148313 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
931669141 2:64630998-64631020 TCAGAGGCAAGGAGAGAGAAAGG + Intergenic
931784162 2:65604248-65604270 TGAAGGGAAGGGAGAGAAAGCGG + Intergenic
931798985 2:65740435-65740457 TCAAAGACAGAGAGAGAGAGAGG - Intergenic
932103435 2:68922104-68922126 TCAAATGCTTGGAAAGAGAGAGG + Intergenic
932305012 2:70695823-70695845 TCAGGGGCAAGGAGGGAGAAAGG + Intronic
933187490 2:79294284-79294306 TCAAGGAGAAAGAGAGAGAGAGG + Intronic
933269130 2:80214666-80214688 TTAAGGGCAGCCAGAGAGAGAGG - Intronic
934531763 2:95094467-95094489 TCAAGGGCAGCCAGAGAGAAAGG + Intronic
935480613 2:103583813-103583835 TGAAGGGAATGGGGAGAGAAAGG - Intergenic
935482767 2:103613957-103613979 TCACGTGGATGGAGAGAGACTGG - Intergenic
937964395 2:127491390-127491412 TCGAGAGCATGGAGAAAGAGAGG - Intronic
938079827 2:128363944-128363966 GCAAGGGCTTGGAGCGTGAGGGG + Intergenic
938722800 2:134081158-134081180 TCAAGGGCAGGAGAAGAGAGGGG + Intergenic
938823749 2:134983868-134983890 TCACTGGGATGGAGAGAAAGGGG + Intronic
939308957 2:140447888-140447910 CCAAGGACAGGGAGAGAGAGAGG + Intronic
939715085 2:145573893-145573915 TCAAGGGAATGAAGAGTGGGTGG - Intergenic
939947101 2:148423164-148423186 TTAAGGGCAGCGAGAGAGAAGGG + Intronic
939965980 2:148610719-148610741 TCAAGGGCAGGGAGAATGTGGGG + Intergenic
939988906 2:148858991-148859013 CACATGGCATGGAGAGAGAGAGG + Intergenic
940092015 2:149931281-149931303 GAAGGGGCATGGAGAGAGGGAGG + Intergenic
940145027 2:150537048-150537070 TTGAAGTCATGGAGAGAGAGAGG - Intronic
940854511 2:158719265-158719287 TAAAGGGCATGGATTCAGAGAGG + Intergenic
941553003 2:166939855-166939877 TGAAGGGCAGGCAGAGAGAAAGG - Intronic
941719659 2:168799881-168799903 CAAAGGGCATAGAGACAGAGAGG - Intronic
941826817 2:169908048-169908070 ATAAAGGCATGGAGGGAGAGGGG - Intronic
942079530 2:172386850-172386872 TAAAGGGCTTGGGGTGAGAGGGG - Intergenic
942385247 2:175436038-175436060 CCAAGGGCATGGATAAAGAAAGG - Intergenic
942411224 2:175710846-175710868 TTAAGGGCAGTGAGAGAGAAAGG + Intergenic
942461475 2:176171496-176171518 TCCTGGGCAGGGAGGGAGAGAGG - Exonic
942799454 2:179860262-179860284 TCATGGGCGTGGGGAGAGGGGGG + Intronic
943038303 2:182773240-182773262 TTAAGGGCAGGCAGAGAGAAAGG - Intronic
943866382 2:192929580-192929602 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
944497379 2:200321897-200321919 TCAAGGTCACAGAGAGATAGTGG + Intronic
944921928 2:204423544-204423566 TTAAGGGCAGCTAGAGAGAGGGG + Intergenic
945371319 2:209021887-209021909 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
945456425 2:210057026-210057048 TCAAAGGGATGGAGAAATAGGGG - Intronic
945987539 2:216367343-216367365 TGAAGGGGAGGGAGAAAGAGAGG - Intronic
946188101 2:217992621-217992643 GCAAAGGCATAGAAAGAGAGGGG + Intronic
946335033 2:219030585-219030607 CCAAAGGCATGGAGAGAAAGGGG + Intronic
946722689 2:222627166-222627188 GCAAGGCCATGGATACAGAGAGG - Intronic
946996673 2:225400351-225400373 TCAGGGGCAGGGAGGGAGGGAGG + Intergenic
947106613 2:226674447-226674469 ACAAGGGACTGGGGAGAGAGGGG + Intergenic
947130859 2:226923617-226923639 GAAAGAGGATGGAGAGAGAGAGG - Intronic
947181751 2:227417402-227417424 TTGAGGGCATGGGGAGAAAGAGG + Intergenic
947770878 2:232669150-232669172 TCAAGGGGATGGTGACACAGGGG - Intronic
948509872 2:238456971-238456993 TCAAGGTCAAGGACAAAGAGAGG + Intergenic
948665552 2:239532700-239532722 TCCAGGGCAGGGAGAGAGGAGGG - Intergenic
1169032833 20:2424901-2424923 CCAAGGACAGGGAGAGAGATAGG + Intronic
1169217479 20:3801959-3801981 TGCAGGGCATGGACGGAGAGCGG - Exonic
1169319863 20:4623724-4623746 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1169415503 20:5412856-5412878 TGTAGGGCATGGAGACAGAGGGG - Intergenic
1169969900 20:11258670-11258692 TAAAGGGCATGGATATAGAGAGG - Intergenic
1170266206 20:14469336-14469358 TTAAGGGCATCCAGAGAGAAAGG - Intronic
1170586543 20:17739099-17739121 TCTAGGGAAAGGAAAGAGAGAGG + Intergenic
1170946643 20:20896709-20896731 GAAAGGGCATGGAGGGAGAGAGG + Intergenic
1171136460 20:22699247-22699269 TTCAGGCCATGGAGTGAGAGCGG + Intergenic
1172028627 20:31966780-31966802 TCAAGGGGAGGGAGAGAGGAGGG - Intergenic
1172170456 20:32927989-32928011 TCCAGGGTTTGGAGGGAGAGGGG - Intronic
1172776217 20:37408726-37408748 AAAAGGGGATGGAGACAGAGGGG + Intergenic
1172935354 20:38616180-38616202 TGAAGGGAAAGGAGGGAGAGAGG - Intronic
1173181612 20:40810413-40810435 TCCAGAGCATGGAGACAGAAGGG - Intergenic
1173685087 20:44917714-44917736 TCAGGGCCATGGAGAGAAGGTGG + Intronic
1174391477 20:50220772-50220794 CCAGGGGCATGGCGAGAGGGTGG + Intergenic
1174787455 20:53446043-53446065 TCAAGGGCATGAATACAGAGCGG - Intronic
1174842758 20:53915590-53915612 AGACGGGCATGGAGAGCGAGAGG - Intergenic
1175031488 20:55959196-55959218 TCAAGGGCATGGAGAAGAAAGGG - Intergenic
1175334170 20:58184352-58184374 TGTGGGGCAGGGAGAGAGAGAGG - Intergenic
1175514007 20:59557205-59557227 TCAAGGAGAGAGAGAGAGAGAGG - Intergenic
1175544865 20:59771597-59771619 AAAAGGGCTGGGAGAGAGAGTGG - Intronic
1175687281 20:61040807-61040829 TCCTGGGCATGGAGGGAGTGGGG - Intergenic
1176364041 21:6021846-6021868 ACAAGCACATGGAGAGGGAGAGG - Intergenic
1176631436 21:9142385-9142407 TAAAGGGCATCCAGAGAGAAAGG - Intergenic
1177203066 21:17978922-17978944 TCATGTGCATGGACAGAGAGGGG - Intronic
1178355620 21:31908574-31908596 TGAAAGGCAGGGAGGGAGAGTGG + Intronic
1178441207 21:32599843-32599865 ACAAGGGCAGGGAGAGAGGATGG + Intronic
1178722476 21:35022266-35022288 GCAAGGGCATGTTGAGAGATAGG + Intronic
1178786809 21:35661304-35661326 TGAAGGGTTTGGAGAAAGAGAGG + Intronic
1178894187 21:36545086-36545108 TGAAGCCCATGGAGAGAGGGAGG + Intronic
1178988706 21:37333046-37333068 TCAGGGACTTGGGGAGAGAGAGG - Intergenic
1179409959 21:41154792-41154814 TCAAGAGAATGGAGTTAGAGTGG + Intergenic
1179429183 21:41307681-41307703 TCAAGGAGAGGGAGAGAGATGGG + Intronic
1179455951 21:41500138-41500160 TCCAGGTCATGGAGAGTGAGTGG - Intronic
1179759477 21:43516699-43516721 ACAAGCACATGGAGAGGGAGAGG + Intergenic
1180387326 22:12190245-12190267 TTAAGGGCATCCAGAGAGAAAGG - Intergenic
1181675766 22:24450697-24450719 ACAAGCCCAGGGAGAGAGAGAGG + Intergenic
1181928555 22:26380165-26380187 CCAAGGGCATGGACATACAGAGG + Intronic
1182117539 22:27765830-27765852 TGAAGGGGGTGGAGAGAGACGGG + Intronic
1182362631 22:29755927-29755949 ACAGTGGGATGGAGAGAGAGTGG - Intronic
1182703125 22:32256580-32256602 ACCAGGGCCTGGAGAGAGGGAGG - Intergenic
1182774542 22:32821098-32821120 TGAAGGGTTTGGAGAGACAGTGG + Intronic
1182789971 22:32943179-32943201 TCAAGGGCAGCCAGAGAGAAAGG + Intronic
1183543053 22:38441021-38441043 CCAAGGGCATGGAAAAGGAGAGG + Intronic
1183782048 22:40005225-40005247 TCAAGTACATGGACAGAGCGAGG - Intronic
1184071872 22:42151797-42151819 CCCAGGGCAAGGAGAGAGGGTGG - Intergenic
1184425403 22:44406294-44406316 TCAAGACCCTGGACAGAGAGAGG - Intergenic
1184582857 22:45429072-45429094 TCAGGGACTTGGAGAGAGAGTGG + Intronic
1184683026 22:46082292-46082314 TCAAGGGGATGGATAGGGAATGG + Intronic
1184884388 22:47333415-47333437 TCTAGGGCACGGAGGAAGAGGGG + Intergenic
949809803 3:7994377-7994399 CCAAGGAGATGGAGAGAGAAAGG - Intergenic
949907601 3:8871743-8871765 TTCAGGGAGTGGAGAGAGAGAGG - Intronic
950125126 3:10505925-10505947 TCAAGGGCACGGAGAGGGTAGGG + Intronic
950567988 3:13782580-13782602 TGAAGGGGTTGGAGTGAGAGAGG - Intergenic
950628616 3:14266811-14266833 TCTAGGGCATAGAGATGGAGAGG - Intergenic
951446847 3:22792200-22792222 ACAGGAGCATGGAGAGATAGAGG - Intergenic
951747689 3:25997822-25997844 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
951854067 3:27175264-27175286 GCCAGGCCATGGAGAGTGAGAGG + Intronic
952224800 3:31364572-31364594 TGAAGAGCATGGAGAAAGAATGG - Intergenic
952268138 3:31806685-31806707 GCAAGGGCATAGAGAGTGATGGG + Intronic
952612478 3:35227530-35227552 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
952880129 3:37979951-37979973 CCTAGGGGATGGGGAGAGAGTGG - Intronic
954916526 3:54152605-54152627 TCAAGGGCCCAGAGAGGGAGAGG + Intronic
954999155 3:54910806-54910828 TCAAGGCTATGGAGAAAGGGTGG - Intronic
956764690 3:72474479-72474501 TCAGGGGCTTGGAGGGAGAGAGG - Intergenic
956790795 3:72678577-72678599 TCCAGGGCATGGGGGGAGACAGG + Intergenic
957155828 3:76542673-76542695 TGAAAGGAAAGGAGAGAGAGAGG - Intronic
957622734 3:82615541-82615563 TCAAGGACATGCAGAGAATGGGG + Intergenic
958148413 3:89657754-89657776 TCCAGAGCATGGAGAGAGCAAGG + Intergenic
958155365 3:89749208-89749230 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
958185008 3:90109398-90109420 TTAAGGGCATCCAGAGAGAAAGG - Intergenic
958741442 3:98078235-98078257 TAAATCACATGGAGAGAGAGAGG - Intergenic
958990903 3:100843589-100843611 TCTGGGAGATGGAGAGAGAGAGG + Intronic
958993362 3:100873419-100873441 TCCAGGGCAGGGAGGGAAAGGGG + Intronic
959027068 3:101251877-101251899 GCAAGGGCATGAAGAAAGGGAGG + Intronic
959392824 3:105797447-105797469 TGAAGGGCAGGAGGAGAGAGAGG + Intronic
960409748 3:117308419-117308441 AGAAGGTGATGGAGAGAGAGAGG + Intergenic
960956180 3:123033116-123033138 TCAAGGGTGTGGTGAGAGATTGG + Intergenic
961211873 3:125131832-125131854 TCGGGGGCAGGGAGAGAGAGAGG + Intronic
962656139 3:137545422-137545444 TTAAGGGCAGGCAGAGAGAAAGG + Intergenic
962907464 3:139817638-139817660 TTAAGGGCATCCAGAGAGATAGG - Intergenic
964223697 3:154372667-154372689 TGGAGGTCATGGAGAGAGAATGG + Intronic
966080759 3:175997209-175997231 TTAAGGGCAGCCAGAGAGAGAGG + Intergenic
966140981 3:176755337-176755359 TCAAGAGCTTTGAGACAGAGTGG - Intergenic
966150549 3:176863017-176863039 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
966248712 3:177837779-177837801 TACAGTGTATGGAGAGAGAGGGG - Intergenic
966466632 3:180236806-180236828 TCATGGCCAGGGAGAGAGAGAGG + Intergenic
967396405 3:189014415-189014437 TTAAGGGCAGTGAGAGAGAAAGG - Intronic
968185703 3:196632508-196632530 TCAGGGGCAGGGGGAGGGAGAGG - Intergenic
968315393 3:197720059-197720081 AGAAGGGCATGGAGAGAGATCGG - Intronic
968315406 3:197720151-197720173 AGAAGGGCATGGAGAGAGATTGG - Intronic
968620051 4:1599952-1599974 TCAGGGGAAGGGAGAGGGAGAGG - Intergenic
968768292 4:2486559-2486581 GCCAGGGCATGGAGAATGAGGGG + Intronic
969323061 4:6424681-6424703 GGAAGGGCATGGAGGCAGAGGGG + Intronic
969509991 4:7612302-7612324 AGAAGGGCATGGAGACAGGGTGG + Intronic
969609141 4:8217240-8217262 TCAAGGGGATGGACAGGGAATGG + Intronic
969973618 4:11074095-11074117 GGAAGAGCATGGAGGGAGAGAGG - Intergenic
970036783 4:11745248-11745270 ACAAGGAGAAGGAGAGAGAGAGG - Intergenic
970057382 4:11989923-11989945 TCAAGGGCCTGGAGACAGTCTGG + Intergenic
970170091 4:13280739-13280761 ATAAGGCCATGGAGAAAGAGAGG - Intergenic
970243605 4:14035203-14035225 TGAGTGGCATGGGGAGAGAGGGG - Intergenic
971482823 4:27129317-27129339 TCATGGCCATGAAGACAGAGAGG + Intergenic
971590098 4:28456423-28456445 TGAAGGGCAGGCAGAGAGAAAGG - Intergenic
971836630 4:31772864-31772886 TCAAGGTCATGGAGACAAAAGGG + Intergenic
972426666 4:38939752-38939774 TAAAGGGATTGGAGAGAGAGAGG - Intronic
972742802 4:41905019-41905041 TTAAGGGCATCCAGAGAGACAGG - Intergenic
973679732 4:53304235-53304257 TTAAGGGCAGGCAGAGAGAAAGG - Intronic
973799397 4:54461507-54461529 TTAAGGGCAGTGAGAGAGAAAGG + Intergenic
974485226 4:62495148-62495170 TCAAGGGCAGGGCCAGAGGGAGG + Intergenic
974820976 4:67066775-67066797 TTAAGGGCATCCAGAGAGAAAGG - Intergenic
975154656 4:71058242-71058264 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
975158856 4:71102503-71102525 TTAAGGGCAGGCAGAGAGAAAGG + Intergenic
975165831 4:71176911-71176933 TTAAGGGCAGGCAGAGAGAAAGG + Intergenic
975283967 4:72595437-72595459 TCAAGGGCAGGCAGAGAGAAAGG + Intergenic
975348590 4:73321425-73321447 TGAAGGGCAGGCAGAGAGAAAGG + Intergenic
975892202 4:79043377-79043399 TCAAGAGCAGGGAAAGAGAAGGG - Intergenic
976780559 4:88753968-88753990 TCTAGAGCAAGGAGAGAGATAGG + Intronic
976830140 4:89306665-89306687 GCAAGGGCTTGGAGGGGGAGGGG - Intronic
976962712 4:90998880-90998902 ACTAGGGCATGGAGGGAGGGAGG - Intronic
977072080 4:92403845-92403867 TCAAAGACAGGGAGAGAGATAGG + Intronic
977149639 4:93494360-93494382 TGAAGGGGAGAGAGAGAGAGAGG + Intronic
978832365 4:113103932-113103954 TCAAAGGCATGGAGGAAAAGGGG - Intronic
979384501 4:120048594-120048616 TACATGGCAGGGAGAGAGAGAGG + Intergenic
979421574 4:120510841-120510863 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
979599616 4:122573593-122573615 TTAAGGGCAGCCAGAGAGAGAGG - Intergenic
980217835 4:129875148-129875170 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
980221316 4:129919637-129919659 CCAAGGAAATGGAGAGAGATAGG - Intergenic
980989690 4:139728688-139728710 TCCAGAGCATGGAGAGAGCTGGG - Intronic
981038359 4:140195539-140195561 TAAAGGGCAAGCAGAGAGAGTGG - Intergenic
982714329 4:158791053-158791075 TTAATGGAATGGAGAGAGAGGGG + Intronic
983385591 4:167057019-167057041 TTAAGGGCATCCAGAGAGAAAGG + Intronic
983820704 4:172190617-172190639 TGAGAGGCATGGAGGGAGAGAGG + Intronic
984493846 4:180470120-180470142 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
984758930 4:183347597-183347619 TCAAGGGGAAAGAGAGAGAAAGG - Intergenic
986110539 5:4711375-4711397 TCAAGGGCAACCAGAGAGAAAGG + Intergenic
986484518 5:8221748-8221770 TCAAGGGCAGTCAGAGAGAAAGG + Intergenic
986752808 5:10804717-10804739 TCAAGGAGAGGGAGAGAGATAGG - Intergenic
987333274 5:16875553-16875575 TTCAGGGTATGGGGAGAGAGGGG - Intronic
987658782 5:20845053-20845075 TCAAAGGCAGGCAGAGAGGGAGG - Intergenic
987966333 5:24880665-24880687 TCAAGGAGAGGGAGAGAGATGGG - Intergenic
988083325 5:26440962-26440984 TGAAGGGGATGGGGAGAAAGTGG + Intergenic
988591586 5:32554349-32554371 TCAAAGAGATGGAGACAGAGAGG - Intronic
988859245 5:35260368-35260390 TTAAGGGCAGTCAGAGAGAGAGG - Intergenic
990212502 5:53495362-53495384 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
990955574 5:61334908-61334930 TCAAGCACAGGGAGAGGGAGGGG - Intronic
991927493 5:71719462-71719484 TCAAGGGGGTCGAGAGCGAGGGG - Intronic
992334844 5:75756088-75756110 TCCAGGGCATGGGGAGAGAGTGG + Intergenic
992826141 5:80552116-80552138 GGGAGTGCATGGAGAGAGAGAGG + Intergenic
993052889 5:82945755-82945777 TTAAGGGCAGCCAGAGAGAGAGG + Intergenic
994147343 5:96410127-96410149 TCAAGGGCATGACGATGGAGGGG - Intronic
994340826 5:98625696-98625718 TCCAGGGCAGGAAGAGAGAGTGG - Intergenic
994851418 5:105058498-105058520 TCAAGGAAATGGAGAGAAATGGG - Intergenic
995266795 5:110171518-110171540 CAAAGGGCATGGAAAGAAAGAGG + Intergenic
995340789 5:111056858-111056880 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
995430794 5:112074144-112074166 TCAAAGGCCTGGAGAGACAGAGG + Intergenic
995460413 5:112397468-112397490 TCAAGTGCATGTAAAGTGAGTGG + Intronic
995498661 5:112778290-112778312 TCATTGACATGGAGAGGGAGAGG - Intronic
995958554 5:117810814-117810836 GCAAGGGAAGGGAGAGAGAAGGG - Intergenic
996012904 5:118501178-118501200 TTAAGGGCAGCGAGAGAGAAAGG - Intergenic
996097598 5:119415179-119415201 TCAGGGGCTTGGGGAGAGGGAGG + Intergenic
996859253 5:128045645-128045667 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
997254877 5:132420766-132420788 GCAGAGGCATGGACAGAGAGAGG + Intronic
999054856 5:148563384-148563406 TCAAGAGAATAGAGAGTGAGGGG - Intronic
999348978 5:150848778-150848800 TCGGGGGCATGTAGAGAGTGTGG + Intronic
999577054 5:152990487-152990509 ATAAGGGAATGGAGAGTGAGGGG - Intergenic
999696652 5:154192996-154193018 TTTTGGGCAGGGAGAGAGAGGGG + Intronic
1000377266 5:160594121-160594143 TCAAGGGCAGCCAGAGAGAAAGG + Intronic
1000441632 5:161270737-161270759 TGGTGGGCATGGAGAGAGGGGGG + Intergenic
1000901589 5:166917992-166918014 ACAAGGGAATGAATAGAGAGGGG + Intergenic
1001083426 5:168683544-168683566 TCAAGGGCACGGAGGGAGCAGGG - Intronic
1001119521 5:168968226-168968248 GCAAGGGCATGGGAGGAGAGGGG - Intronic
1001372441 5:171219299-171219321 TTAAGGGCAGCCAGAGAGAGAGG - Intronic
1001819155 5:174696221-174696243 TCCACTGCATGGAGAGGGAGGGG - Intergenic
1002772650 6:302856-302878 CCAAGGGCAGGGTGAGGGAGTGG + Intronic
1003002222 6:2346907-2346929 TCAAAGGCAAGGAGAGAGGTAGG - Intergenic
1003005267 6:2375451-2375473 ACAAGGGAATGGTGAGGGAGTGG + Intergenic
1003475071 6:6474229-6474251 TCCAGCGCAAGGAGCGAGAGAGG + Intergenic
1003555692 6:7137784-7137806 TCCAGGGCAGGGAGAGGAAGAGG - Intronic
1003755994 6:9121336-9121358 TCAAGCTCATGGGGCGAGAGAGG - Intergenic
1004020853 6:11774631-11774653 TCAGGGGCGTGGGGAGGGAGGGG + Intronic
1004051334 6:12082692-12082714 TCAAGGGCATTCAGGTAGAGGGG - Intronic
1004717318 6:18229961-18229983 TCAAGGGCAGCCAGAGAGAAAGG + Intronic
1004761540 6:18672160-18672182 TCAGGGGGACAGAGAGAGAGAGG + Intergenic
1005061098 6:21777744-21777766 TAAGAGGTATGGAGAGAGAGGGG + Intergenic
1005822004 6:29606308-29606330 TAGAGGGCTTGGAGGGAGAGGGG - Intronic
1005898016 6:30195033-30195055 TCAAGGGAAGGGAGAGAAAATGG - Intronic
1006182721 6:32163793-32163815 GAATGGGCATTGAGAGAGAGCGG - Intronic
1006197453 6:32254757-32254779 CCGAGGGCAGGGAGAGGGAGGGG + Intergenic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1008319421 6:50089771-50089793 TTGAGGGCAGGGAGAGAGATTGG - Intergenic
1008633328 6:53384458-53384480 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1008635234 6:53404478-53404500 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
1008679513 6:53857261-53857283 TCAAGGGAAAGCAGAGAAAGAGG + Intronic
1009175908 6:60459759-60459781 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1009727685 6:67556764-67556786 TTAAGGGCAGCCAGAGAGAGTGG - Intergenic
1009963476 6:70552792-70552814 AAAAGGGTAGGGAGAGAGAGAGG + Intronic
1011031947 6:82932873-82932895 GCTAGAGCATGGAGAGAGAGAGG + Intronic
1011062839 6:83291528-83291550 TTAAGGGCAGTGAGAGAGAAAGG - Intronic
1011065668 6:83322888-83322910 TTAAGGGCAGTGAGAGAGAAGGG + Intronic
1011291942 6:85786493-85786515 TTAAGGGCAGTGAGAGAGACAGG - Intergenic
1011295060 6:85817657-85817679 TTAAGGGCATCCAGAGAGAAGGG + Intergenic
1011411968 6:87075343-87075365 TCAGAGGCATGGAGTGAGGGAGG - Intergenic
1011571497 6:88741433-88741455 TCAAGGGAAGGGAGAAAGAGGGG + Intronic
1012304535 6:97636526-97636548 TCAAGGAGAGGGAGAGAGATGGG - Intergenic
1013353078 6:109323382-109323404 TCACGAGCAAGGAGAGAGTGCGG + Intergenic
1013901726 6:115165065-115165087 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
1013906315 6:115223791-115223813 TTAAGGGCATTCAGAGAGAGAGG + Intergenic
1014355086 6:120398535-120398557 ACAGGGGGATGGAGGGAGAGGGG + Intergenic
1014367368 6:120561612-120561634 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
1015469138 6:133583588-133583610 TCCAGGGCATGGGAGGAGAGGGG + Intergenic
1016995403 6:149959143-149959165 AGAAGGGGATGGAGAGAGTGAGG - Intergenic
1017537251 6:155361974-155361996 TTAAGGGCATGGGGAGATGGTGG + Intergenic
1017622335 6:156311665-156311687 TCTAGGGCTTGGAGACAGGGAGG + Intergenic
1017803542 6:157922148-157922170 ACAGGGGCAGGCAGAGAGAGAGG - Intronic
1018587264 6:165375053-165375075 TCAAGGACAGGGAGGGAGATGGG - Intronic
1018725827 6:166612800-166612822 TCAAGGGCATGGAGAGAGAGAGG - Intronic
1018927263 6:168215093-168215115 TCAGGTGCAGGGAGAGGGAGGGG - Intergenic
1019108324 6:169688754-169688776 TCAAAGACATGGAGAGACAAGGG + Intronic
1021763762 7:23926713-23926735 ACAAGGGACTGGAGAGAGAGGGG - Intergenic
1022076090 7:26972579-26972601 TCAAGGGCAACTAGAGAGAAAGG - Intronic
1022830855 7:34065249-34065271 TCATGGGGAGAGAGAGAGAGAGG - Intronic
1022957693 7:35396553-35396575 TGAAGAGAAGGGAGAGAGAGTGG + Intergenic
1022994758 7:35743604-35743626 TCAAGGGCACCCAGAGAGAAAGG - Intergenic
1023232890 7:38052260-38052282 TCAAAAGCATGGAAGGAGAGGGG - Intergenic
1024346272 7:48317568-48317590 TCAAGGACAGTGAGACAGAGAGG + Intronic
1026054030 7:66969567-66969589 TCCAGGTCATGGACAGGGAGTGG + Intergenic
1026143711 7:67727511-67727533 TCCAGGGGAAGGAGAGAGAGAGG + Intergenic
1026231626 7:68488860-68488882 CCAAGGGCTGGCAGAGAGAGAGG + Intergenic
1026430483 7:70342133-70342155 TGCAAGGCAGGGAGAGAGAGAGG - Intronic
1026955022 7:74371626-74371648 GGAGGGGAATGGAGAGAGAGAGG + Intronic
1027172771 7:75884539-75884561 TCCAGGGCATGCAGAGGGTGTGG + Intronic
1027411106 7:77918740-77918762 TAAAGAGGATGGAGAGAGGGAGG - Intronic
1027717685 7:81693468-81693490 TGAAGGGCAAGGAGAGATTGGGG + Intergenic
1027794425 7:82674675-82674697 TCAAGGGGTTGGAGAAAGAGAGG - Intergenic
1028159219 7:87466632-87466654 TTAAGAGCATGCAGAGAGAAAGG + Intronic
1028539573 7:91927186-91927208 TCAAGGTAAGGGAGGGAGAGAGG + Intergenic
1029496094 7:100896002-100896024 TCCAAGGGAGGGAGAGAGAGGGG - Intronic
1029647016 7:101863742-101863764 TCAAAGGCATAGAGACAAAGTGG - Intronic
1029780249 7:102724274-102724296 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1029900906 7:104037975-104037997 CCAGGGGCAGGGTGAGAGAGAGG + Intergenic
1030483451 7:110134322-110134344 TCCTGGGCATTGAGAGAGAAAGG - Intergenic
1030969294 7:116034475-116034497 TGAAGGGTATAGAGAAAGAGAGG - Intronic
1031336963 7:120546963-120546985 TCATGGGCATAGTGAGACAGAGG - Intronic
1031624441 7:123975944-123975966 TTAAGGTCACAGAGAGAGAGGGG + Intergenic
1031929599 7:127671080-127671102 GCATGTGCATGGAGAGAGGGAGG + Intronic
1032447662 7:131998621-131998643 TTCAGGGCATGGAGAAGGAGAGG + Intergenic
1033177713 7:139140827-139140849 TCAAGGAAATGCAGAGAAAGTGG + Intronic
1033279732 7:139997161-139997183 TGAGGGGCAGGGAAAGAGAGGGG - Intronic
1033445355 7:141416753-141416775 TCAAGGGCAGAGGGAGAGATTGG + Intronic
1033536825 7:142320419-142320441 TCCAGGGCAGGGACAGATAGAGG + Intergenic
1034573850 7:151980502-151980524 TCAAGGGAATGGAGAGTCCGAGG - Intronic
1035039502 7:155917190-155917212 TGGAGGGGATGGTGAGAGAGGGG - Intergenic
1035732104 8:1860460-1860482 TCAGGGGCATGGAGAGGAGGAGG - Intronic
1035900541 8:3454721-3454743 TAAAGGGCAGGCAGAGAGAAAGG - Intronic
1036430868 8:8689297-8689319 TCTAGGGCATGTATAGAGAGAGG - Intergenic
1038060189 8:23903999-23904021 TCAAGTGCCTGCAGAGAGTGGGG - Intergenic
1039126192 8:34204254-34204276 TAAAGGGCATGAAGAGATACGGG + Intergenic
1039170537 8:34739773-34739795 TCAAGGGCAACCAGAGAGAAAGG + Intergenic
1039281346 8:35988702-35988724 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1039797354 8:40926644-40926666 TTAGGGGCAGGGAGGGAGAGAGG - Intergenic
1039849955 8:41356349-41356371 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1041185913 8:55300475-55300497 TCGAGGGCAAGGAGATAGAGTGG + Intronic
1041439337 8:57877286-57877308 AAAAGGGCATGAAGAGAGAAAGG - Intergenic
1041497869 8:58506989-58507011 TCAGGGGGAGGGAGAGAAAGAGG + Intergenic
1042579345 8:70259210-70259232 TTCAGGGGATTGAGAGAGAGGGG - Intronic
1042760424 8:72266484-72266506 GCATGGGGAAGGAGAGAGAGAGG + Intergenic
1043165694 8:76900483-76900505 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
1043488038 8:80718372-80718394 TAAAGGGGATGGAGACAGGGAGG - Intronic
1043995111 8:86804758-86804780 TTAAGGGCAGCGAGAGAGAAAGG - Intergenic
1044836160 8:96297639-96297661 TGAAGGGCAAGAAGAGAGGGAGG - Intronic
1045277913 8:100722900-100722922 TGGGGGGCAGGGAGAGAGAGGGG + Intergenic
1045385668 8:101668855-101668877 TAAAGAGGCTGGAGAGAGAGGGG - Exonic
1045429760 8:102102781-102102803 TCAAGGGAGAGGAGAGAGAGAGG + Intronic
1045433351 8:102134475-102134497 TTAAGGGCAGCGAGAGAGAAAGG + Intergenic
1046649326 8:116819436-116819458 ACCAGGGGCTGGAGAGAGAGGGG + Intronic
1047152091 8:122275095-122275117 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1047212823 8:122853751-122853773 AAAAGGGCATGGGGAGATAGTGG - Intronic
1047525556 8:125631098-125631120 TGAAGGGAATGGGGAGAGATTGG + Intergenic
1047667086 8:127104046-127104068 TCTAGGGAATGGAGGGAGAAGGG + Intergenic
1048902468 8:139051947-139051969 CCAAGGAGATGGAGAGAGATGGG - Intergenic
1049224723 8:141444738-141444760 TTTTGGGCATGCAGAGAGAGTGG + Intergenic
1050065129 9:1751261-1751283 TTAAGGGCAGGCAGAGAGAAAGG + Intergenic
1050390175 9:5134425-5134447 TTAAGGGCATCCAGAGAGAAAGG + Intronic
1050889392 9:10804696-10804718 AAAAGGGCATGGTGAGAGGGAGG + Intergenic
1050992719 9:12173257-12173279 TCATGAACATGGAGATAGAGTGG - Intergenic
1051548892 9:18306927-18306949 TTAAGGGCAGGAAGAGAGAAAGG + Intergenic
1051611451 9:18966150-18966172 TTAAGGGCATCCAGAGAGAAAGG - Intronic
1052899903 9:33784146-33784168 TGAAAGGCATGTAAAGAGAGGGG + Intronic
1053317538 9:37064757-37064779 TGAAGGGCACAGAGAGAAAGTGG + Intergenic
1053521182 9:38781082-38781104 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1054193344 9:62005075-62005097 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1054645063 9:67583616-67583638 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1056017487 9:82405758-82405780 ACAAAGACAAGGAGAGAGAGAGG - Intergenic
1056078014 9:83061617-83061639 TTCAGGGCCTGGAGGGAGAGAGG - Intronic
1056288846 9:85120513-85120535 TCATGTGCATGAAGAGCGAGAGG + Intergenic
1057315727 9:93967155-93967177 TGCAGGGCATGGAGAGGGAGGGG - Intergenic
1059035236 9:110747483-110747505 GCAAGGGCATGGACACAGGGAGG + Intronic
1059266301 9:113034605-113034627 TGAAAGGAATGGAGAGAAAGAGG - Intergenic
1059360357 9:113737259-113737281 TCAAGAGGATAGAGAGAGACTGG + Intergenic
1059501199 9:114755736-114755758 TGAAGGGCACAAAGAGAGAGAGG - Intergenic
1059778996 9:117507384-117507406 GCAAATGCATGGAGATAGAGAGG - Intergenic
1060131084 9:121100142-121100164 TTAAGGGCAGGCAGAGAGAAAGG + Intronic
1061395812 9:130342805-130342827 TCAGGGGCATGGGGAGAGGCGGG - Intronic
1061400795 9:130367262-130367284 TCAAGTGGATGGTGAGAGACAGG + Intronic
1061455267 9:130692895-130692917 TGCAGGGCAAGGAGAGGGAGAGG + Intergenic
1061495369 9:130970959-130970981 GGAAGGGCAAAGAGAGAGAGAGG + Intergenic
1061642641 9:131971351-131971373 GCAAGGACAGGGGGAGAGAGAGG + Intronic
1062707362 9:137952995-137953017 TCCAGGGGATGGTGAGAGAGAGG + Intronic
1203754267 Un_GL000218v1:109990-110012 TAAAGGGCATCCAGAGAGAAAGG - Intergenic
1185863929 X:3605761-3605783 TGATGGGCATGGAGAGGGAGTGG + Exonic
1185952657 X:4453362-4453384 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1186039937 X:5464523-5464545 GAAAGGGAATGGAGAGAGGGAGG + Intergenic
1186452293 X:9683851-9683873 GAAAGGGCAGGGAGAGAGGGAGG - Intronic
1186655894 X:11611703-11611725 GCAAGGGCAAGGAGTGAGACAGG - Intronic
1186671659 X:11773306-11773328 TGAAGGCCAAGGAGAGAAAGTGG - Intronic
1187308042 X:18114992-18115014 CAAAGGGCATGGATAAAGAGAGG + Intergenic
1187413454 X:19071058-19071080 TGGAGGGCATGGAAAGAAAGGGG + Intronic
1187436715 X:19277774-19277796 TTAAGGGCAGCCAGAGAGAGAGG - Intergenic
1187459950 X:19477956-19477978 GGAAGGACAGGGAGAGAGAGGGG + Intronic
1187575324 X:20547776-20547798 TCCAGGGCCTGGGGAGAGAGAGG + Intergenic
1187605373 X:20876317-20876339 TTAAGGGCAGGCAGAGAGAAAGG + Intergenic
1187839765 X:23475412-23475434 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
1188491889 X:30746656-30746678 TCAAAGGCATGGATACAGAGAGG - Intergenic
1188543312 X:31273766-31273788 GCAAAGGCATGAAGATAGAGGGG + Intronic
1189190973 X:39105373-39105395 TCAAGGATTTGGAGAGGGAGTGG + Intergenic
1189233667 X:39471501-39471523 TACAGGGCATGGAGAGAGGCTGG + Intergenic
1189754310 X:44254856-44254878 TCAAGGGCAGCCAGAGAGAAAGG + Intronic
1189796625 X:44651934-44651956 TCAAGGGAATGGTGAAAGAATGG + Intergenic
1189867748 X:45349065-45349087 TCATGGGCAAGGAAACAGAGAGG + Intergenic
1190477204 X:50840041-50840063 GTAAGGGCCTGGAGAGAGAAGGG - Intergenic
1191170561 X:57443018-57443040 TCAAGGGCAGACAGAGAGAAAGG - Intronic
1191848793 X:65570378-65570400 TCAATGGAGTGGAGAAAGAGAGG + Intergenic
1191861553 X:65669545-65669567 TCCTGGGAATGGAGAGAGAATGG + Intronic
1191925884 X:66309398-66309420 TTAAGGGCAGCGAGAGAGAAAGG + Intergenic
1192585205 X:72313682-72313704 TCAAAGGCAGGGAGGGAGAGAGG + Intergenic
1193025561 X:76842212-76842234 TTAAGGGCAGGCAGAGAGAAAGG + Intergenic
1193376570 X:80768313-80768335 TTAAGGGCAGAGAGAGAGAAAGG + Intronic
1193391868 X:80938280-80938302 TCAAGGGCAGCCAGAGAGAAAGG + Intergenic
1193534173 X:82692234-82692256 CCAAGGGCATAGACAAAGAGAGG - Intergenic
1194806510 X:98335379-98335401 TGAAGTGAATGGAGAGAGAAAGG + Intergenic
1194937445 X:99968614-99968636 TTAAAGGCCAGGAGAGAGAGAGG - Intergenic
1195203910 X:102576020-102576042 TTAAGGGCATCCAGAGAGAAAGG + Intergenic
1195580107 X:106492234-106492256 TTAAGGGCATCCAGAGAGAAAGG - Intergenic
1195617474 X:106923812-106923834 TCACTGGCATGGAGACAGAGAGG + Intronic
1195760960 X:108245990-108246012 TCAGGGCCATGGAAAGTGAGAGG - Intronic
1196112760 X:111964557-111964579 TTAAGGGCAGCGAGAGAGAAAGG + Intronic
1196460286 X:115922785-115922807 TCAAGGAGAAAGAGAGAGAGAGG - Intergenic
1196752261 X:119128632-119128654 ATAATGGGATGGAGAGAGAGTGG - Intronic
1197988093 X:132288883-132288905 TCAAGGGCAGCCAGAGAGAAAGG - Intergenic
1198058643 X:133021137-133021159 GCAAGGGCATGCAGAGGGAGTGG + Intergenic
1198335646 X:135663919-135663941 TTAAGGGCAGGCAGAGAGAAAGG - Intergenic
1198602092 X:138294977-138294999 TCATGGACGTGGAGAAAGAGAGG - Intergenic
1198999206 X:142613538-142613560 CCAGGGGAATGGAGAAAGAGTGG - Intergenic
1199271332 X:145885895-145885917 TCAGGGGGATGGAAATAGAGTGG + Intergenic
1199290165 X:146096184-146096206 TCAAGGAGAGGGAGAGAGAAGGG + Intergenic
1199876703 X:151936641-151936663 TCTAAGGCAAGGAGAGAGATGGG - Intergenic
1199969930 X:152852211-152852233 AGAAGGGCAAGGAGAGAGATGGG + Intronic
1200114331 X:153763531-153763553 TCATGGGCATGGAGAGAGGCGGG - Intergenic
1200800235 Y:7380172-7380194 TGATGGGCATGGAGAGGGAGTGG - Intergenic
1200829996 Y:7680167-7680189 GCAAGAGCATGGAGAGTGTGGGG - Intergenic
1202275747 Y:23117970-23117992 AAAAGGGCATGGAGTGAGATGGG + Intergenic
1202290281 Y:23302721-23302743 AAAAGGGCATGGAGTGAGATGGG - Intergenic
1202327452 Y:23706196-23706218 TTAAGGGCAGGCAGAGAGAAGGG + Intergenic
1202428739 Y:24751689-24751711 AAAAGGGCATGGAGTGAGATGGG + Intergenic
1202442052 Y:24918400-24918422 AAAAGGGCATGGAGTGAGATGGG - Intergenic
1202543318 Y:25963856-25963878 TTAAGGGCAGGCAGAGAGAAGGG - Intergenic
1202599857 Y:26582239-26582261 AGAGGGGGATGGAGAGAGAGGGG - Intergenic