ID: 1018725896

View in Genome Browser
Species Human (GRCh38)
Location 6:166613263-166613285
Sequence CACCCCAGCCGCCTGAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018725896 Original CRISPR CACCCCAGCCGCCTGAATGG TGG (reversed) Intronic
900862526 1:5243639-5243661 CACCCCAGAGTCTTGAATGGTGG + Intergenic
901160822 1:7175649-7175671 CACCCCAGCCGCTTGAAGCGGGG + Intronic
901818779 1:11811998-11812020 CACCTCAGCCTCCTGAGTAGTGG - Intronic
902261262 1:15226553-15226575 CACCCCACCCCTCTGAAGGGAGG + Intergenic
902321368 1:15669418-15669440 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
903049364 1:20589310-20589332 CAGCCCAGCAGCCTGGGTGGTGG + Intronic
904027757 1:27515305-27515327 CACCTCAGCCTCCTGAGTAGAGG - Intergenic
904210691 1:28885208-28885230 CACCCCATCCACCTGACTGCTGG + Intergenic
904296241 1:29521443-29521465 CACCCCACCATCCTGGATGGTGG - Intergenic
905141561 1:35849571-35849593 CACCTCAGCCTCCTGAGTAGCGG - Intronic
905955945 1:41996142-41996164 CACCTCAGCCTCCTGATTGCTGG - Intronic
906687357 1:47771319-47771341 CACCCCCTCCCCCTGCATGGTGG + Intronic
907526367 1:55056352-55056374 CTCCCCAGCCTCCCGCATGGCGG - Intronic
909658173 1:78053814-78053836 CACCTCAGCCTCCTGAATACTGG - Intronic
914723360 1:150307469-150307491 CACCTCAGCCTCCTGAGTAGAGG + Intronic
915467573 1:156106395-156106417 CTCCCCGGCCTCCTAAATGGGGG - Intronic
917715095 1:177726931-177726953 CACCACAGCCTCCTGAGTGCTGG - Intergenic
917766147 1:178219525-178219547 CACCGCAGCCTCCTGAGTAGAGG - Intronic
917892744 1:179455159-179455181 CGCCTCAGCCTCCTGAATAGTGG - Intronic
918084656 1:181235411-181235433 CTCCCCAGCCTCCTGAGTAGCGG - Intergenic
922766975 1:228161116-228161138 CACCCCAGCCTCCTGAGTACTGG - Intergenic
924543599 1:245004489-245004511 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1063660210 10:8030318-8030340 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1063766966 10:9153384-9153406 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1064733975 10:18361724-18361746 CATCTCAGCCTCCTGAATAGCGG + Intronic
1064903078 10:20315326-20315348 CTCCCCAGCAACCTGCATGGAGG - Intergenic
1065186249 10:23173519-23173541 AACAGCGGCCGCCTGAATGGCGG - Intergenic
1066253184 10:33653932-33653954 CACCCCAGCCTCCCAAATGCTGG - Intergenic
1069726288 10:70582285-70582307 CACCCCAACCCCCAGAGTGGTGG + Intergenic
1070175231 10:73964352-73964374 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1070293158 10:75134945-75134967 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1072815511 10:98504674-98504696 CGCCTCAGCCTCCTGAATAGCGG - Intronic
1073551784 10:104408984-104409006 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1074861211 10:117511977-117511999 CCCCCCAGCCCCCAGCATGGGGG + Intergenic
1075478392 10:122756698-122756720 CTCCCCAGGAGCCTGGATGGAGG + Intergenic
1076550295 10:131273587-131273609 CAGCCCAGGGGCCTGGATGGAGG - Intronic
1076728767 10:132427306-132427328 CACCCCAGGCGCCGGCATGCTGG - Intergenic
1077011875 11:382440-382462 CACCCCAGCCTCCTCTAGGGTGG + Intergenic
1077470012 11:2753265-2753287 CAACCCATCCCCCTGAGTGGCGG - Intronic
1078760233 11:14245695-14245717 CAGCCCAGCTGGCTGCATGGAGG + Intronic
1079989598 11:27232880-27232902 TACCTCAGCCTCCAGAATGGTGG - Intergenic
1080735744 11:35012099-35012121 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1085964495 11:81504623-81504645 CACCTCAGCCTCCTGAACAGTGG - Intergenic
1087064786 11:94017925-94017947 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1089522943 11:119077737-119077759 CACCCCATCCTCCTGAGTGGAGG + Intronic
1092193742 12:6536991-6537013 CACCCCAGCCTTCTCCATGGTGG - Exonic
1093475004 12:19544992-19545014 CACCTCAGCCTCCTGAATAGCGG + Intronic
1098791334 12:74828024-74828046 CACCTCAGCCTCCTGAAGTGTGG - Intergenic
1100520343 12:95368784-95368806 CACCTCAGCCTCCTGAGTGTAGG - Intergenic
1101137200 12:101756458-101756480 CACCTCAGCCTCCTGACTAGTGG - Intronic
1101838979 12:108314291-108314313 AACCCCAGCTTCCTGAAAGGGGG + Intronic
1101926227 12:108973503-108973525 CACCTCAGCCTCCTGAGTAGGGG + Intronic
1102476695 12:113193239-113193261 CCCCTCAGCCTCCTGAGTGGCGG + Intergenic
1104842278 12:131830797-131830819 CAGCCCAGCAGCCTGAATCCCGG - Intronic
1105213881 13:18273434-18273456 CACCCCAGGATCCTGACTGGGGG - Intergenic
1105531068 13:21220904-21220926 CACCTCAGCCTCCTGAGTGATGG - Intergenic
1110559281 13:76893005-76893027 CATCCCAGCCACCTGAGAGGAGG - Intergenic
1111193320 13:84837743-84837765 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1111788977 13:92828251-92828273 CACCCCACACACCTGCATGGTGG + Intronic
1113366107 13:109677394-109677416 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1113381152 13:109807424-109807446 CCCCCCAGCCCCATGAAAGGAGG - Intergenic
1113494003 13:110713873-110713895 CAGCCCCGCCGCCTGAGAGGGGG + Intronic
1113707974 13:112446431-112446453 CACACCTGCCTCCTGCATGGTGG - Intergenic
1114063798 14:19043068-19043090 GACCCAAGCCGACTGAAGGGAGG - Intergenic
1114098460 14:19356928-19356950 GACCCAAGCCGACTGAAGGGAGG + Intergenic
1115428258 14:33286178-33286200 CACCCCAGCCTCCTGAGTCCAGG + Intronic
1115618071 14:35115274-35115296 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1115756272 14:36528491-36528513 TTCCCCAGCCTCCTGAATGGTGG + Intergenic
1116009734 14:39337002-39337024 CTCCTCAGCCTCCTGAATAGTGG + Intronic
1116528145 14:45933141-45933163 CACCTCAGCCCCCTGAGTGGTGG - Intergenic
1116913158 14:50492918-50492940 CACCCCAGCCTCCTGAATAGTGG - Intronic
1119861014 14:77936104-77936126 CACCCCAGCCTCCTCTAGGGAGG - Intergenic
1120910943 14:89666174-89666196 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1122924494 14:104893360-104893382 CAGCCCAGCTGCCTCCATGGCGG + Intronic
1123463267 15:20493941-20493963 CACCTCAGCCCCCTGAGTAGTGG - Intergenic
1123492807 15:20796127-20796149 GACCCAAGCCGACTGAAGGGAGG + Intergenic
1123549308 15:21365223-21365245 GACCCAAGCCGACTGAAGGGAGG + Intergenic
1124274110 15:28311348-28311370 CACCTCAGCCCCCTGAGTAGTGG - Intronic
1124375070 15:29124565-29124587 CACCCCACCCCCGGGAATGGGGG - Intronic
1125560728 15:40631002-40631024 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1125580512 15:40782108-40782130 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1131033851 15:89208088-89208110 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1131322476 15:91407713-91407735 CACCCCAGCTGCTTGAATAGTGG - Intergenic
1202957644 15_KI270727v1_random:92439-92461 GACCCAAGCCGACTGAAGGGAGG + Intergenic
1132504195 16:298619-298641 CACCTCAGCCTCCAGAATAGCGG + Intronic
1132758698 16:1498549-1498571 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1132949882 16:2555420-2555442 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1132964466 16:2644747-2644769 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1133770182 16:8863233-8863255 CACCCCAGCCTCCTGGGTTGTGG + Intronic
1134578449 16:15351499-15351521 CACTCCGGCCGCCTGGCTGGGGG - Intergenic
1134724140 16:16406045-16406067 CACTCCGGCCGCCTGGCTGGGGG + Intergenic
1134943289 16:18305824-18305846 CACTCCGGCCGCCTGGCTGGGGG - Intergenic
1134979576 16:18596080-18596102 CACCTCAGCCTCCAGAGTGGCGG + Intergenic
1138661409 16:58520300-58520322 CACCTCAGCCGCCTGAGATGGGG - Exonic
1141990895 16:87608921-87608943 CACCTCAGCCTCCTGAGTGGTGG - Intronic
1142584577 17:963486-963508 CACCTCAGCCCCCTGAGTAGTGG - Intronic
1145350793 17:22081301-22081323 CACCTCAGCCTCCTGAAGGCTGG - Intergenic
1148308154 17:46609933-46609955 CACCTCAGCCCCCTGAATAACGG + Intronic
1148704716 17:49619645-49619667 CACCCCAGCCTCCCGAGTAGCGG + Intronic
1150131398 17:62671183-62671205 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1150153348 17:62829297-62829319 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1150332504 17:64305605-64305627 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1152334836 17:79694909-79694931 CAGGCCAGCCGCCTGCATTGTGG - Intergenic
1154450351 18:14470664-14470686 GACCCAAGCCGACTGAAGGGAGG + Intergenic
1154971584 18:21415264-21415286 CACCTCAGCCTCCTAAATGCTGG - Intronic
1155467112 18:26148958-26148980 CACCTCAGCCTCCTGAATGCAGG + Intronic
1155954737 18:31947371-31947393 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1157611318 18:48957988-48958010 TACCCCAGCAGCAAGAATGGAGG + Intergenic
1158275041 18:55757968-55757990 CACCCCAGACTCCTGCATCGGGG - Intergenic
1158432084 18:57398544-57398566 CACCCCAGAAGGCTGAATAGAGG + Intergenic
1158573279 18:58614670-58614692 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1161077811 19:2294784-2294806 CACCCCAGCCCCCAGAATCTTGG - Intronic
1161391078 19:4020706-4020728 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1161515998 19:4696983-4697005 CACCTCAGCCTCCTGAGTAGAGG - Intronic
1162759016 19:12877351-12877373 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1162896458 19:13767449-13767471 CACCCCAGCCTCCTGATTACAGG - Intronic
1163706396 19:18816397-18816419 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1163757744 19:19116573-19116595 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1164223981 19:23225490-23225512 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1164611247 19:29633361-29633383 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1165086997 19:33357159-33357181 CACCCCAGCCTTCTGAGTAGTGG + Intergenic
1165196201 19:34105748-34105770 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1165412289 19:35669555-35669577 CGCCCCAGCCTCCTGAGTAGCGG - Intronic
1165775330 19:38401079-38401101 CACCTCAGCCTCCTGAAAGGCGG + Intergenic
1166010415 19:39936951-39936973 CACCTTAGCCTCCTGAATGGTGG - Intergenic
1166170101 19:41022223-41022245 CACCTCAGCCTCCTGATTAGTGG + Intergenic
1167017986 19:46854077-46854099 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1167367081 19:49060192-49060214 GGCCCCAGAAGCCTGAATGGGGG - Intronic
1167420463 19:49399587-49399609 CACCCCAGCAGCCTGTCTTGGGG + Intronic
1167653949 19:50751117-50751139 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1168244254 19:55103077-55103099 TACCTCAGCCTCCTGAATAGTGG - Intronic
926191954 2:10734969-10734991 CACCACAGCCTCCTGAGTAGTGG - Intronic
927137158 2:20105438-20105460 AGCCCCAGCCGCCTGGAGGGAGG + Intergenic
929782534 2:44966257-44966279 CAGCCTAGCTGCCTGCATGGGGG - Intergenic
930157219 2:48118118-48118140 CACCTCAGCCTCCTGATTAGAGG - Intergenic
933675246 2:85050034-85050056 CACCTCAGCCTCCTGAGTAGCGG - Intronic
934300443 2:91773315-91773337 CACCCCAGGACCCTGAACGGGGG + Intergenic
934718095 2:96554748-96554770 CTCACAACCCGCCTGAATGGTGG + Intergenic
935117079 2:100145923-100145945 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
935241838 2:101185608-101185630 GACCCCAGCTTCCAGAATGGAGG + Intronic
936025483 2:109028155-109028177 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
936603515 2:113924181-113924203 CACCTCAGCCTCCTGAGTAGCGG + Intronic
937108004 2:119337167-119337189 CACCTCAGCCTCCTGAGTGCTGG + Intronic
945140889 2:206685273-206685295 CATCTCAGCCACCTGAATAGCGG + Intronic
945470994 2:210227816-210227838 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
945621667 2:212147102-212147124 CACCTCAGCCTCCTGAGTAGTGG + Intronic
947119337 2:226799531-226799553 CTCCCCAGCCGCCTGGAGCGAGG - Exonic
948810499 2:240473008-240473030 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1169042595 20:2508471-2508493 CACCCCAGCCGCGGGGATGTTGG + Intronic
1169052361 20:2591589-2591611 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1169079033 20:2783450-2783472 CACCTCAGCCTCCTGAATAGTGG - Intergenic
1169131923 20:3170373-3170395 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1170200505 20:13738425-13738447 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1170302270 20:14897769-14897791 CTTCCCAGCCTCCAGAATGGTGG - Intronic
1170882922 20:20313428-20313450 CACCGCAGCCTACTGAATTGCGG - Intronic
1171150571 20:22823431-22823453 CACCCAAGCAGCCTGAATGGAGG - Intergenic
1171772848 20:29338818-29338840 CGCCTCAGGCTCCTGAATGGAGG + Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172118146 20:32583774-32583796 AACCGCAGCCGCCTAAAGGGAGG - Intronic
1172734925 20:37119352-37119374 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1173627911 20:44487326-44487348 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1173963728 20:47094916-47094938 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1174263201 20:49312445-49312467 CACCACACCCGGCTGAAAGGTGG + Intergenic
1174344281 20:49918445-49918467 CACCTTAGCCTCCTGAGTGGCGG + Intergenic
1175487615 20:59356645-59356667 CACCCCAGCAACCTGCATGATGG - Intergenic
1175578415 20:60079862-60079884 CTGCTCAGCCTCCTGAATGGAGG - Intergenic
1178945487 21:36943703-36943725 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1180149180 21:45939056-45939078 CACCCCAGCAGCCTCACGGGAGG + Intronic
1180318244 22:11296691-11296713 CACCTCAGGCTCCTGAATGGAGG + Intergenic
1182602311 22:31475759-31475781 CACCGCAGCCTCCTGAGTAGCGG - Intronic
1183541319 22:38430966-38430988 CACTCCAGCCCCCTGCAGGGAGG - Intronic
1183672610 22:39282050-39282072 CACCCCAGCTTCCTGAGTGCTGG + Intergenic
1183820983 22:40345916-40345938 CACCGCAGCCGGCTCACTGGGGG + Intergenic
949394806 3:3603229-3603251 CACCTCAGCCGCCTGAGTAGTGG - Intergenic
950436714 3:12984569-12984591 CTTCCCAGCCCCCTGAAAGGAGG - Intronic
951311602 3:21133048-21133070 CAGCCCATCCACCTGTATGGTGG + Intergenic
952456863 3:33480949-33480971 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
952859583 3:37801902-37801924 TACCCCAGCTGCGGGAATGGAGG + Intronic
953477538 3:43218416-43218438 CACCCCAGAGGCATGAATGTTGG - Intergenic
954508925 3:51104900-51104922 AACCCCAGCCTCCTGAGTAGCGG + Intronic
954602705 3:51882502-51882524 CATCTCAGCCTCCTGAATGCTGG + Intergenic
955151607 3:56372612-56372634 CACCTCAGCCTCCTGAGTAGCGG - Intronic
955671898 3:61410985-61411007 CACCTCAGCCTCTTGACTGGAGG - Intergenic
955835331 3:63048236-63048258 CACCTCAGCCTCCTGAGTGCTGG - Intergenic
959928835 3:111956079-111956101 TACCTCAGCCTCCTGAGTGGTGG - Intronic
960037111 3:113112916-113112938 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
960102176 3:113755485-113755507 CACCTCAGCCTCCCGAATAGCGG - Intronic
960732268 3:120740373-120740395 CACCTCAGCCTCCTGAGTAGCGG + Intronic
961184124 3:124899738-124899760 CACTTCAGCCTCCTGAGTGGTGG - Intronic
961256591 3:125559707-125559729 CACCTCAGCCTCCTGAGTTGGGG + Intronic
961481541 3:127183882-127183904 CACCTCAGCCTCCTGAATGATGG + Intergenic
961648706 3:128406697-128406719 CACCTCAGCCTCCTGAGTAGTGG - Intronic
962118421 3:132536275-132536297 CACCCCAGCCTACTGAGTAGCGG - Intronic
963804418 3:149709087-149709109 CACCCCAGCCTCCTGAGTACTGG + Intronic
963868224 3:150385682-150385704 CACACCATCCCCCAGAATGGAGG + Intergenic
964591268 3:158364705-158364727 CACCCAAGCCCCCTGACTTGAGG - Intronic
964721462 3:159770767-159770789 CCACCCAGCCACCTGAAGGGAGG - Intronic
965575604 3:170214724-170214746 CACCACAGCCTCCTGAGTAGTGG - Intergenic
967019594 3:185511144-185511166 CACCTCAGCCTCCTGAGTAGTGG + Intronic
968464117 4:741958-741980 CATCCCAGCAGCTGGAATGGAGG - Intronic
968601388 4:1511611-1511633 CGCCCCAGCTGCCTTGATGGCGG - Intergenic
971349762 4:25845380-25845402 CACCTCAGCCTCCTGAGTAGCGG - Intronic
972665659 4:41162739-41162761 CACCTCAGCCTCCTGAGTGCTGG - Intronic
975536682 4:75458825-75458847 CACCTCAGCCTCCTGAATACTGG + Intergenic
976302225 4:83526070-83526092 CACCCCAGCCTCCTGAGTAGTGG + Intergenic
977053355 4:92158517-92158539 CACCTCAGCCTCCCGAGTGGCGG + Intergenic
977582110 4:98736446-98736468 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
977601038 4:98933849-98933871 CACCTCAGCCTCCTGAACGATGG + Intergenic
978420981 4:108532580-108532602 CACCCCAGCCTCCTGACAGCTGG - Intergenic
979372987 4:119911682-119911704 CACCAGAGCTGCCTGAAAGGTGG - Intergenic
982341177 4:154300571-154300593 CACCCCAGCCTCCTGAGCAGCGG - Intronic
982731333 4:158958246-158958268 CACCTCAGGCTCCTGAATAGCGG + Intronic
984369645 4:178846476-178846498 CACCTCAGCCCCCTGAGTAGCGG - Intergenic
984612673 4:181858198-181858220 CACCTCAGCCTCCTGAATTTTGG + Intergenic
988842303 5:35094939-35094961 CACCTCAGCCTCCTGAGTAGTGG + Intronic
990316167 5:54585176-54585198 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
990427261 5:55698901-55698923 CACTCCAGCCACCTGGATGATGG + Intronic
992042838 5:72853325-72853347 CACCTCAGCCTCCTGAGTAGCGG - Intronic
992617453 5:78558588-78558610 CACCTCAGCCTCCTGAATACTGG + Intronic
992732315 5:79684368-79684390 CACCTCAGCCTCCTGAGTGCTGG + Intronic
996074080 5:119169013-119169035 CACCCCAGCGTCCTGAGTAGCGG + Intronic
997457124 5:134025842-134025864 CACCTCAGCCTCCCAAATGGAGG + Intergenic
997519569 5:134514085-134514107 CACCTCAGCCTCCTAAATGCTGG + Intergenic
997550430 5:134747753-134747775 CACCTCAGCCTCCCGAATAGCGG + Intronic
997708420 5:135981212-135981234 CACCTCAGCCTCCTGAGTGCTGG + Intergenic
998076080 5:139237508-139237530 CACCTCAGCCTCCTGAGTAGCGG + Intronic
998594507 5:143514689-143514711 CCCCCCAGCATCCTGGATGGAGG + Intergenic
999999827 5:157127140-157127162 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1000308094 5:160014587-160014609 CACCTCAGCCTCCTGAGTGGTGG - Intronic
1001725226 5:173890682-173890704 CACCGCAGAGGGCTGAATGGTGG + Exonic
1004976675 6:20974863-20974885 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1006114696 6:31769319-31769341 CACCCCAGCAGCCAGAAGGCAGG - Intronic
1006475325 6:34249142-34249164 CACCCCCGCCTCCGGATTGGCGG - Exonic
1007486682 6:42185283-42185305 AGCCCAAGCAGCCTGAATGGAGG + Intronic
1007609342 6:43139225-43139247 CACCCCAGCCGGCAGCATCGAGG + Exonic
1009928234 6:70145832-70145854 CACCCCAGCCTCCTGAATAGTGG + Intronic
1012901793 6:105014569-105014591 CACCTCAGCTTCCTGAATGCTGG + Intronic
1013193032 6:107820086-107820108 CACCCCATCCGCCTGAAGGCAGG + Intronic
1013664698 6:112335500-112335522 CACAGCAGCCTCCTAAATGGTGG - Intergenic
1014094954 6:117449724-117449746 CACCCCAGCCTCCCAAATGTTGG - Intronic
1014401569 6:120996596-120996618 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1014898503 6:126933539-126933561 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1015017760 6:128434908-128434930 TACCTCAGCCTCCTGAGTGGTGG - Intronic
1016330675 6:142948937-142948959 CACCTCAGCCTCCCGAGTGGAGG + Intergenic
1016504326 6:144761530-144761552 CACCTCAGCCTCCTGACTGCTGG - Intronic
1017649510 6:156568010-156568032 CACCTCAGCCACCTGAGTAGTGG - Intergenic
1018725896 6:166613263-166613285 CACCCCAGCCGCCTGAATGGTGG - Intronic
1018846142 6:167557960-167557982 CAGCCCAGCAGCCTGCAGGGTGG + Intergenic
1019283098 7:210400-210422 CACCACAGCATCCTGAAAGGAGG - Intronic
1021745089 7:23732195-23732217 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1022946948 7:35295484-35295506 CACCTCAGCCTCCAGAATCGCGG - Intergenic
1023050878 7:36250106-36250128 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1025032931 7:55572209-55572231 GCCCCCAGCCGCCAGCATGGTGG + Intronic
1026888743 7:73969887-73969909 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1026939772 7:74280813-74280835 CACCTCACCCTCCTGAATAGCGG + Intergenic
1027167325 7:75844369-75844391 TACCTCAGCCTCCTGAGTGGTGG + Intronic
1027245307 7:76363101-76363123 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1030222268 7:107109509-107109531 CACCTCAGCCTCCTAAATTGTGG + Intronic
1032380394 7:131473898-131473920 CACCTCAGCCTCCTGAAGTGCGG - Intronic
1033013362 7:137645678-137645700 CATCTCAGCCTCCTGAATAGTGG + Intronic
1033134219 7:138771513-138771535 CATCTCAGCCTCCTGAATAGCGG + Intronic
1033146098 7:138871180-138871202 CTCCCCAGCCGACCGAGTGGCGG - Exonic
1033194952 7:139319786-139319808 CACCACACCCGCCTGAGTGTTGG - Intergenic
1033239468 7:139665149-139665171 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1035987107 8:4446432-4446454 CACCTCAGCCACCTGAGTAGCGG - Intronic
1036497074 8:9279298-9279320 CACCCCAGCCCCTGGAGTGGAGG + Intergenic
1037236135 8:16721409-16721431 CACTCCAGCCGCCTGTATGATGG - Intergenic
1037802266 8:22042328-22042350 CACCCCTGCCCCCTGGAGGGAGG + Intergenic
1038422146 8:27440229-27440251 CACCCCAGCCGTGTGCATGTGGG + Exonic
1039048874 8:33474692-33474714 CACCTCAGCCTCCTGAGTGGCGG - Intronic
1039331570 8:36543191-36543213 CACCCCAGCCCCATCAAGGGAGG + Intergenic
1039630546 8:39107536-39107558 CACCCCAGCCGCGTGGTTGCTGG - Intronic
1041090528 8:54297308-54297330 CACACCAGACCCCTGAGTGGAGG + Intergenic
1041115902 8:54536573-54536595 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1043927921 8:86059051-86059073 CACCTCAGCCTCCAGAATAGCGG + Intronic
1045748772 8:105456784-105456806 TGCCTCAGCCTCCTGAATGGCGG + Intronic
1047512949 8:125529437-125529459 CACCCCAACCGAATGAATGAGGG - Intergenic
1047614301 8:126550575-126550597 CACCTCAGCCTCCTGAGTGCTGG + Intergenic
1048475215 8:134736707-134736729 CACCGCAGCCTCCTGAGTAGTGG + Intergenic
1049215127 8:141404327-141404349 TACCCCAACCCCCTGAAAGGGGG - Intronic
1050193733 9:3057850-3057872 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1050302443 9:4273477-4273499 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1051871045 9:21738079-21738101 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1054151387 9:61608609-61608631 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1058457983 9:105155947-105155969 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1058469645 9:105264275-105264297 CACCTCAGCCTCCTGAATAGCGG + Intronic
1058880478 9:109281586-109281608 GACCTCAGCCTCCTGAATAGCGG - Intronic
1060648244 9:125301181-125301203 CACCTCAGCCTCCTGAGTGCTGG + Intronic
1060884299 9:127139675-127139697 CACACCACACGCCTGACTGGTGG - Intronic
1061471521 9:130830385-130830407 CACCCCCGCATCTTGAATGGGGG - Intronic
1062395089 9:136349604-136349626 CCCGCCAGTCCCCTGAATGGTGG - Exonic
1062414113 9:136439357-136439379 CCCCGCAGCCGCCGGAAGGGAGG - Exonic
1203366471 Un_KI270442v1:262453-262475 CACCTCAGGCTCCTGAATGGAGG + Intergenic
1187169341 X:16836142-16836164 CATCTCAGCCTCCTGAATAGAGG - Intronic
1187343362 X:18441299-18441321 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1189340860 X:40203684-40203706 CACCTCAGCCTCCTGAATAGCGG + Intergenic
1190078019 X:47332978-47333000 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1192116432 X:68416154-68416176 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1192677112 X:73209626-73209648 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1193118055 X:77794643-77794665 CACCTCAGCCTCCTGAGTGCTGG - Intergenic
1194010385 X:88554090-88554112 CACCCCAGCCTGCGGGATGGGGG + Intergenic
1195927859 X:110044551-110044573 CACCACAGCCTCCTGAGTAGCGG + Intronic
1196950926 X:120875210-120875232 CACCTCAGCCGCCTGATGGTGGG - Exonic
1197329234 X:125133240-125133262 CACCTCAGCCTCCTAAAGGGAGG + Intergenic
1200307527 X:155043048-155043070 CACCTCAGCCTCTTGAATAGTGG + Intronic
1200781084 Y:7216328-7216350 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1201072205 Y:10157778-10157800 CGCCTCAGGCTCCTGAATGGAGG - Intergenic
1201265098 Y:12198691-12198713 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1201918550 Y:19209147-19209169 AACCTCAGCCTCCTGAATAGTGG + Intergenic