ID: 1018728151

View in Genome Browser
Species Human (GRCh38)
Location 6:166628994-166629016
Sequence CCCTCCCAGCAGAACCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018728151_1018728155 29 Left 1018728151 6:166628994-166629016 CCTTTAAGGTTCTGCTGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1018728155 6:166629046-166629068 TTAGTGCCCTGTATCCCTGCTGG 0: 1
1: 0
2: 0
3: 17
4: 78
1018728151_1018728156 30 Left 1018728151 6:166628994-166629016 CCTTTAAGGTTCTGCTGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1018728156 6:166629047-166629069 TAGTGCCCTGTATCCCTGCTGGG 0: 1
1: 0
2: 1
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018728151 Original CRISPR CCCTCCCAGCAGAACCTTAA AGG (reversed) Intronic
903500857 1:23799603-23799625 TCCTCCCAGCTGACCCTTGAGGG - Intronic
907270179 1:53286502-53286524 CCCTCCCAACAGAAGCCTGAAGG + Intronic
914900751 1:151709895-151709917 CCTTCCCATCAGAAACTTAGAGG - Intronic
922731336 1:227950076-227950098 CTCTCCCAGCAGCAGCTTAGTGG + Intergenic
922897349 1:229110752-229110774 GCCTCCCAGCTGAGCCCTAAAGG + Intergenic
924047468 1:240046712-240046734 CCCTCCAAGCAGCCCCTTAAGGG + Intronic
924133651 1:240939684-240939706 CCCTCCCAGAGGAATCTTTATGG - Intronic
1063454911 10:6176274-6176296 CCCTCCCATCACCACCTCAAGGG - Intronic
1063528162 10:6803607-6803629 CCCTCCCAGGAGCACCTTTACGG - Intergenic
1065515122 10:26517028-26517050 CCCTCCCAGAGGAATCTTGATGG + Intronic
1066233863 10:33466701-33466723 GCCTCCTAGCATAACCCTAATGG + Intergenic
1067726522 10:48774974-48774996 CCCTCCCGGCAGAGCCTTCCAGG - Intronic
1068072170 10:52208613-52208635 AACTCCCAGTAGAACATTAATGG - Intronic
1068449498 10:57167055-57167077 ACCTTCCAGGAGATCCTTAAGGG + Intergenic
1070491560 10:76981507-76981529 ACCTCCCAGCAGAAATTCAAGGG - Intronic
1070542536 10:77426771-77426793 CATCCCCAGCAGAGCCTTAAAGG + Intronic
1074555897 10:114489663-114489685 CCTGCTCAGCAGAACCTTCACGG - Intronic
1075794610 10:125110144-125110166 CACTCCTAGCAGAGCCTTGAGGG - Intronic
1077902682 11:6502349-6502371 CCCTCCCAGCTCAACCTTCTTGG - Intronic
1078575980 11:12503142-12503164 CCGTCCCAGCTGCTCCTTAAAGG + Intronic
1081847638 11:46252182-46252204 GCCTCCCAGCAGAACCCCACTGG + Intergenic
1087872993 11:103322206-103322228 ACCTTCTAGCAGAACCTTAGAGG + Intronic
1089165616 11:116473923-116473945 CCCTCCCAGCTGCACTTTCAGGG + Intergenic
1089730371 11:120515216-120515238 CTCTTCCAGCAGCACCTTGAAGG - Intronic
1092559408 12:9594886-9594908 CCCTCCCAGAGGAATCTTCACGG + Exonic
1092662276 12:10751330-10751352 TCCTCCCAGCAGAAGGTTATAGG - Intergenic
1093735263 12:22613825-22613847 CCCTCCCATCAGCACCATAGCGG + Intergenic
1094829895 12:34295303-34295325 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1094830974 12:34300127-34300149 CCTTCCCAGCAGCACCTGCATGG + Intergenic
1094831309 12:34301558-34301580 CCTTCCCAGCAGCACCTACAGGG + Intergenic
1094831836 12:34303856-34303878 GCCTCCCAGCAGCACCTGCATGG + Intergenic
1094833617 12:34312051-34312073 CCTCCCCAGCAGAACCTGTATGG - Intergenic
1094833807 12:34312893-34312915 CCTTCCCAGCAGCCCCTTCATGG - Intergenic
1094836236 12:34323404-34323426 CCTTCCCAGCAGCACCTTCGTGG - Intergenic
1094837724 12:34329965-34329987 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1102700130 12:114831963-114831985 GCCTCCCACCAGAACCTCAGCGG - Intergenic
1105241536 13:18613118-18613140 CCCTCCCATCACAACCTGTAGGG - Intergenic
1105911937 13:24877041-24877063 CCCTGCCAAGAGAACCTTTATGG - Exonic
1106096570 13:26650332-26650354 CCCTACCAGCACAGCATTAAAGG + Intronic
1109249559 13:60002633-60002655 CCCTCCCATCAGCAACTTCATGG + Intronic
1110616539 13:77548079-77548101 CCTTCCTAGCAGACCCTAAAGGG - Intronic
1111606702 13:90547765-90547787 CCCTCCCAGCACAAGCCCAAAGG - Intergenic
1114740791 14:25095151-25095173 CCCTCCCAGAGGAACGTTTATGG - Intergenic
1117558149 14:56907574-56907596 CCCTTCCACCAGATCCTTACTGG - Intergenic
1121835342 14:97087253-97087275 CCAGGCCAGCAGAAGCTTAAAGG - Intergenic
1122463046 14:101911539-101911561 CTTTCCCAACAGGACCTTAAAGG + Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1202867831 14_GL000225v1_random:134672-134694 CCCTGTAAGCAGAACCTTAAGGG - Intergenic
1124957708 15:34370598-34370620 CCCTTCCAACAGAAGATTAATGG - Intergenic
1126660280 15:51026282-51026304 ACTTCTCAGCAGAACCTTATAGG - Intergenic
1126792332 15:52232401-52232423 CCCACCCAGCAGAAGCTTTATGG + Intronic
1127735015 15:61831775-61831797 CTCTCCCAGCAGATGCTTACAGG + Intergenic
1128108722 15:65062867-65062889 CCCTCCTAGCAGAACCTTCGAGG + Intronic
1128515195 15:68337629-68337651 CCCTCCCAGAAGACCCTGATAGG - Intronic
1129379205 15:75154828-75154850 CCCTCCCAGGTGCACCTGAATGG + Intergenic
1137667311 16:50259308-50259330 CCCTCCCACCAGATCCTCAAAGG - Intronic
1140324432 16:73987849-73987871 CCCTCCCCACAGAACCTGTAAGG - Intergenic
1142187478 16:88701404-88701426 CACTCCCCGCAGAACCTGCAGGG + Exonic
1142404635 16:89880960-89880982 CCATCCCAGCAGCACCATGATGG - Intronic
1149543477 17:57485990-57486012 CCCTCCCTGCAGTACCCTAACGG - Intronic
1150263406 17:63815304-63815326 CCCTTCCAGGAGAGCCTTGAGGG + Intronic
1151572213 17:74932499-74932521 CCCTACCAGCAGAATCATTAAGG + Intronic
1160137624 18:76286046-76286068 CCCTCCCTGCAGAAGCACAAAGG + Intergenic
1161594405 19:5143873-5143895 CCCTCCCGGCACAGCCTTCAAGG - Intronic
1168352435 19:55684372-55684394 CACCCCCTGCAGAGCCTTAAGGG + Intronic
925022582 2:583310-583332 CCGTCCCGGGAGAACCTTAGCGG - Intergenic
925327616 2:3035666-3035688 GTCTCCCAGCAGAACGTGAAAGG + Intergenic
925542960 2:4986103-4986125 CCCTGCCAGCAGAACTTTTGTGG - Intergenic
925684855 2:6459587-6459609 CCATCCCACCAGGACCTTCAGGG - Intergenic
927895438 2:26778619-26778641 CCCTCCCTGCAGAACCCCCAGGG + Exonic
928087178 2:28353079-28353101 CCTTCCCAGGAGAAACTCAATGG - Intergenic
928250672 2:29675485-29675507 CCCTACCAGCAAAACCTGATGGG + Intronic
928768889 2:34681606-34681628 CCCACCCACCAGAGCCTTAGTGG + Intergenic
929223319 2:39487599-39487621 CCTTTCCAGCACATCCTTAAAGG - Intergenic
933771647 2:85748405-85748427 GGCTCTCAGCAGAACCTTATGGG - Intergenic
934529266 2:95075044-95075066 CCCTCCCAGCAGAGCCATCCTGG - Intergenic
939615402 2:144356540-144356562 ACTTCCCAGCAGAAGCTTTAAGG + Intergenic
944940904 2:204625380-204625402 CCCTCTCAGCCGCATCTTAAAGG - Intronic
945200397 2:207275332-207275354 TTCTCCCAGCAGAAACTGAAGGG + Intergenic
1172355187 20:34275025-34275047 CCCTCCCAGCTGCACCATGAAGG + Intergenic
1172355206 20:34275084-34275106 CCCTCCCAGCTGCACCATGAAGG - Intergenic
1173815874 20:45987701-45987723 TCCTCCCAGCAGAACCTTCTGGG + Intergenic
1175996184 20:62813246-62813268 CCCGCCCAGCAGGACCTGCAGGG + Exonic
1177835484 21:26182613-26182635 CCCTCCCACCAGATGATTAAAGG - Intergenic
1178908256 21:36653849-36653871 CCCTCCAGGCAGAACATCAAGGG - Intergenic
1179162298 21:38908588-38908610 GCCTCTCAGCAGAACTTTAGGGG + Intergenic
1181487786 22:23242388-23242410 CCCTCCCAGAGGAATCTTTATGG + Intronic
1182421374 22:30250271-30250293 CCCTCACAGCAGACCCACAAAGG - Intergenic
1182667079 22:31967812-31967834 CCGGCCAGGCAGAACCTTAAAGG - Intergenic
1183151368 22:36040375-36040397 CCCTCCCAACTGAACATCAAGGG - Intergenic
1184620076 22:45670713-45670735 CCCTCCAAGCAGAATGTAAAGGG + Intergenic
954714748 3:52521443-52521465 CTGTCCCAGCAAAACCTGAACGG - Exonic
955552949 3:60103664-60103686 CCCTCCCAAAAGAATCTTTATGG + Intronic
956169956 3:66425199-66425221 CTCTCCTGGCAGAACTTTAAGGG + Intronic
956900973 3:73715885-73715907 TCCTCCCAGCAGAACCTCCTGGG + Intergenic
961818135 3:129561699-129561721 CCCTCCCATCAGATCCCTGAAGG - Exonic
963633065 3:147758160-147758182 CTCTCCCAGCAGAGCTTTAGAGG + Intergenic
967806319 3:193717181-193717203 CCATCCCAGCAGCACCTTGCAGG - Intergenic
969566013 4:7978667-7978689 CCCTCCCAGCAGTTCCTGACTGG + Intronic
972257016 4:37367907-37367929 TCCTACCAGCAGACCCTAAATGG + Intronic
973145731 4:46823165-46823187 CCCACCCAGCAGAACCTTGGAGG - Intronic
979139226 4:117151376-117151398 GCCTCCCAGCAGTGGCTTAAAGG - Intergenic
983574984 4:169251232-169251254 CCCTCCCTGTAAAACCTAAAGGG - Intronic
986751854 5:10794676-10794698 CCCTCCCAGAAGTAACTTCATGG - Intergenic
987092058 5:14516895-14516917 CCCTCCCAGAGGAATCTTTATGG + Intronic
987250428 5:16095293-16095315 CCCTCCCCGCTGAAGCTTAGAGG - Intronic
988592686 5:32562673-32562695 CCCTCCCAGAGGAGCCTTTATGG + Intronic
998413400 5:141928206-141928228 CCCTGCCAGCAGGACCTCAGCGG + Exonic
1002311555 5:178318280-178318302 GCCTTCCAGCAGAGACTTAAAGG + Intronic
1002518097 5:179774245-179774267 CTCTCCCAGCAGCACAATAAGGG + Exonic
1003674801 6:8193179-8193201 CCCTCCAAACTGAACCTGAAAGG + Intergenic
1006411561 6:33876984-33877006 CCATCCCAGCAGGACCCTAATGG + Intergenic
1007341234 6:41192621-41192643 ACCACCCAGCACAACCCTAAGGG - Intronic
1007591014 6:43021008-43021030 CCTTCCCAGCAGAACCTGGCTGG - Exonic
1011835023 6:91421256-91421278 CCCTCCCATCACAAGCGTAAAGG + Intergenic
1014469947 6:121801624-121801646 CCCTCCCATCAGAAGCCTGAAGG + Intergenic
1018728151 6:166628994-166629016 CCCTCCCAGCAGAACCTTAAAGG - Intronic
1019176418 6:170161480-170161502 GCCTCCCAGGAGAACCTGACAGG + Intergenic
1019760698 7:2810380-2810402 CCCTAACACCAGCACCTTAAGGG + Intronic
1022101139 7:27169757-27169779 CCCTCCCAGGAATACCTTACTGG - Intronic
1022534156 7:31085462-31085484 CCTTCCCGGCAGAGCCCTAATGG - Intronic
1032574649 7:133040395-133040417 CCCTCCCAGAGGAATCTTGATGG - Intronic
1034466994 7:151235676-151235698 TCCTCCCAGCAGCACCTTAGAGG + Intronic
1037671003 8:21015315-21015337 CCTTCCCAGAGGATCCTTAAAGG + Intergenic
1038215602 8:25559073-25559095 CCCTCACAGCAAAGCCCTAATGG + Intergenic
1038419342 8:27422392-27422414 CCCTCCCAGCAGAGGCCTCAGGG - Intronic
1038667456 8:29551906-29551928 CCACCCCAGCAGAACACTAAAGG - Intergenic
1038941332 8:32309169-32309191 CCCTCCCAGAGGAATCTTTATGG - Intronic
1040632452 8:49231013-49231035 CCCTCCCAGAGGAATCTTTATGG + Intergenic
1042635472 8:70868626-70868648 CCCTCCCATCACAGCCTCAAAGG - Intergenic
1046526369 8:115386579-115386601 CACTCCCACCAGCACCGTAATGG - Intergenic
1049525871 8:143126713-143126735 CCCTCCCAGTAGCACCTGAGTGG - Intergenic
1049994836 9:1025098-1025120 ACCTTCCAGCAGAACCTCAGAGG + Intergenic
1051864281 9:21661895-21661917 CCCTACCTGCAGCACCTGAAGGG + Intergenic
1057686456 9:97238746-97238768 TCCTCCCAGCAGCACCTGATTGG + Intergenic
1060796645 9:126516434-126516456 CCCTCCCAGCTGAGCCCTAAGGG - Intergenic
1061387209 9:130297383-130297405 TTCTCCCAGCAGAACCATAGCGG - Intronic
1203736940 Un_GL000216v2:145595-145617 CCTTGTAAGCAGAACCTTAAGGG + Intergenic
1186844168 X:13514598-13514620 CCCTTCCAGCAAAACATAAAAGG + Intergenic
1186985185 X:15005177-15005199 CCTTCTCAGCAGAAGCTTATAGG + Intergenic
1188679391 X:32983049-32983071 CCCTCCCAGAGGAATCTTTATGG - Intronic
1189675150 X:43453778-43453800 CCCTCCCAGAGGAATCTTTATGG - Intergenic
1189675970 X:43460963-43460985 CCCTCCAAGAAGAACCTTTATGG - Intergenic
1190263577 X:48814778-48814800 CCCTCACAGCCTAACCTTCAAGG - Intronic
1190710713 X:53067306-53067328 CCCTCCCAGTAGAATCTCACAGG - Intronic
1193478767 X:82000244-82000266 GCCTTCCAACAGATCCTTAAGGG - Intergenic
1194226027 X:91258842-91258864 CAGTCCCAGCAGATCCCTAAAGG + Intergenic
1199808974 X:151330168-151330190 CCCTCCCAGAAGCACAGTAAAGG - Intergenic
1202124674 Y:21557397-21557419 CACTCACAGCAGAAACTTGAAGG - Intergenic
1202154334 Y:21871983-21872005 CACTCACAGCAGAAACTTGAAGG + Intergenic