ID: 1018729365

View in Genome Browser
Species Human (GRCh38)
Location 6:166637252-166637274
Sequence GACACACGAGTGCTTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018729362_1018729365 0 Left 1018729362 6:166637229-166637251 CCGCGCAAGGCTTGTTGGCCAAG 0: 1
1: 0
2: 1
3: 6
4: 55
Right 1018729365 6:166637252-166637274 GACACACGAGTGCTTCCTACAGG No data
1018729360_1018729365 5 Left 1018729360 6:166637224-166637246 CCTGTCCGCGCAAGGCTTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1018729365 6:166637252-166637274 GACACACGAGTGCTTCCTACAGG No data
1018729359_1018729365 6 Left 1018729359 6:166637223-166637245 CCCTGTCCGCGCAAGGCTTGTTG 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1018729365 6:166637252-166637274 GACACACGAGTGCTTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018729365 Original CRISPR GACACACGAGTGCTTCCTAC AGG Intronic
No off target data available for this crispr