ID: 1018734177

View in Genome Browser
Species Human (GRCh38)
Location 6:166675140-166675162
Sequence CCCAGCTTGCCAGCAAGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 516}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018734170_1018734177 11 Left 1018734170 6:166675106-166675128 CCATGGCCAGGGCTTTCTGCATA 0: 1
1: 0
2: 1
3: 17
4: 229
Right 1018734177 6:166675140-166675162 CCCAGCTTGCCAGCAAGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 516
1018734173_1018734177 5 Left 1018734173 6:166675112-166675134 CCAGGGCTTTCTGCATAGGGATC 0: 1
1: 0
2: 4
3: 9
4: 157
Right 1018734177 6:166675140-166675162 CCCAGCTTGCCAGCAAGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 516
1018734166_1018734177 26 Left 1018734166 6:166675091-166675113 CCTTGGGTTCCAGTGCCATGGCC 0: 1
1: 0
2: 2
3: 19
4: 252
Right 1018734177 6:166675140-166675162 CCCAGCTTGCCAGCAAGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 516
1018734169_1018734177 17 Left 1018734169 6:166675100-166675122 CCAGTGCCATGGCCAGGGCTTTC 0: 1
1: 0
2: 1
3: 27
4: 275
Right 1018734177 6:166675140-166675162 CCCAGCTTGCCAGCAAGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018734177 Original CRISPR CCCAGCTTGCCAGCAAGCGG AGG Intronic
900003980 1:32077-32099 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
900023707 1:202596-202618 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
900490895 1:2948651-2948673 CCCAGCTCTCCAGAAAGCTGGGG + Intergenic
901091873 1:6647195-6647217 CCCAGCTACCCAGGAAGCTGAGG - Intronic
902599928 1:17534075-17534097 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
902982400 1:20134556-20134578 CCCAGCTACCCAGCAGGCTGAGG - Intergenic
903070780 1:20726118-20726140 CCCTGCTTGCCAGCCTGCAGGGG + Intronic
903533326 1:24048984-24049006 CCCAGCTTCCCAGGAGGCTGAGG + Intergenic
903655513 1:24946812-24946834 CTCAGCTTGGCAGAAAGCCGGGG + Intronic
903888030 1:26552270-26552292 CCCAGCTACTCAGGAAGCGGAGG + Intronic
904149394 1:28424908-28424930 CCCAGCTTCCCAGGAGGCTGAGG - Intronic
905443743 1:38011030-38011052 CCCAGCTAGTCAGCAGGCTGAGG + Intronic
906306386 1:44722626-44722648 CCCAGCTTCCCAGGAGGCTGAGG + Intronic
906485735 1:46233400-46233422 CCCAGCTAGTCAGTAGGCGGAGG - Intergenic
906656268 1:47550458-47550480 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
907026848 1:51128575-51128597 CCCAGCTTGTCAGGAGGCTGAGG + Intronic
908531447 1:65038312-65038334 CCCAGCTACTCAGCAAGCTGAGG - Intergenic
911010892 1:93279847-93279869 CCCAGCTAGTCAGGAAGCTGAGG - Intergenic
914259149 1:145984450-145984472 CCCAGCTAGTCAGGAGGCGGAGG - Intergenic
914730968 1:150369894-150369916 CCCAGCTACTCAGGAAGCGGAGG - Intronic
915321334 1:155057966-155057988 CACAGCTTGCCCGCCAGCGCAGG - Exonic
915373678 1:155373401-155373423 CCCAGCTACCCAGGAAGCTGAGG - Intronic
915378563 1:155420207-155420229 CCCAGCTTCTCAGGAAGCTGAGG + Intronic
915622359 1:157093350-157093372 CCCAGCTACTCAGCAAGCTGAGG - Intronic
916185043 1:162123285-162123307 CCCAGCTACCCAGCCAGCTGAGG - Intronic
916805446 1:168255758-168255780 CCCAGCTACTCAGCAAGCTGGGG - Intergenic
917138495 1:171810914-171810936 CCCAGCTATCCAGCAGGCTGAGG - Intronic
917860787 1:179141176-179141198 CCCAGCTACCCAGGAAGCTGAGG + Intronic
918337888 1:183539032-183539054 CCCAGCTACCCAGGAAGCTGAGG + Intronic
919231440 1:194779731-194779753 CCCAGCTTCCCGGGAAGCTGAGG - Intergenic
920069794 1:203294548-203294570 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
920444930 1:206008946-206008968 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
921101410 1:211932223-211932245 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
921405568 1:214775582-214775604 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
921635627 1:217488805-217488827 CCCAGCTACACAGCAAGCTGAGG - Intronic
922087015 1:222359495-222359517 CCCAGCTTCCCAGGAGGCTGAGG + Intergenic
922185327 1:223269494-223269516 CCCAACTTGGCAGCAAGGGGTGG - Intronic
922434055 1:225585671-225585693 CCCAGCTACCCAGAAAGCTGAGG + Intronic
922746997 1:228049891-228049913 CCCAGCTATTCAGGAAGCGGAGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
923329606 1:232910438-232910460 CCCAGCTCTCCAGCTAGCGTTGG - Intergenic
924261105 1:242232725-242232747 CCCAGCTATCCAGGAAGCTGAGG + Intronic
924477012 1:244391344-244391366 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
924522193 1:244815059-244815081 CCCAGCTACCCAGGAGGCGGAGG + Intergenic
924932520 1:248743347-248743369 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1064281588 10:13956266-13956288 CCCAGCTACCCAGGAGGCGGAGG - Intronic
1065322352 10:24521389-24521411 CCCAGCTATCCAGGAAGCTGAGG + Intronic
1067039395 10:42940947-42940969 CCCCGCTTGCCAGGAAACCGTGG + Intergenic
1067058768 10:43067092-43067114 CCCAGCCTGGCATCAGGCGGGGG - Intergenic
1068091289 10:52435507-52435529 CCCAGCTACCCAGCAGGCTGAGG + Intergenic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069354979 10:67574694-67574716 CCCAGCTTGTCAGAAGGCTGAGG - Intronic
1070042239 10:72792992-72793014 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1070176303 10:73973035-73973057 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1070211702 10:74330050-74330072 CCCAGCTAGTCAGGAAGCTGAGG + Intronic
1070796808 10:79221623-79221645 CCCACGTTGCCAGCAGGCGTGGG - Intronic
1070987300 10:80699926-80699948 CCCTGCCTGCCAGCAAGCCCAGG - Intergenic
1072340471 10:94443394-94443416 CCCAGCTTCTCAGGAAGCTGAGG - Intronic
1072611699 10:97021355-97021377 CCCAGCTGGACAGCCAGCGGAGG + Exonic
1072654382 10:97319907-97319929 CCCTGCTTGCCAGCTCCCGGAGG - Exonic
1072657630 10:97341379-97341401 CCCAGCTTCTCAGGAAGCTGAGG - Intergenic
1073301258 10:102472376-102472398 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1073351886 10:102825753-102825775 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1073981510 10:109159252-109159274 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1075019640 10:118942218-118942240 CCCAGCTACCCAGGAGGCGGAGG - Intergenic
1075169200 10:120097530-120097552 CCCAGCTACCCAGCAGGCTGAGG - Intergenic
1075566765 10:123510671-123510693 CCCAGCTTTGCAGCAAAAGGAGG + Intergenic
1076447725 10:130529346-130529368 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1077409877 11:2399000-2399022 CCCAGCCCACCAGCGAGCGGTGG + Intergenic
1077670534 11:4153317-4153339 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
1078002372 11:7507662-7507684 CCCAGCTACCCGGCAAGCTGAGG - Intronic
1078448311 11:11421497-11421519 CCCAGCTTCCCAGCTAGCCCTGG - Intronic
1079189555 11:18266245-18266267 CCCTGCCTGCCAGGGAGCGGTGG - Exonic
1079716318 11:23750742-23750764 CCCAGCTACTCAGCAAGCTGAGG + Intergenic
1080373967 11:31685813-31685835 CCCAGCTAGCCAGGAGGCTGAGG + Intronic
1080670437 11:34371979-34372001 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1081067529 11:38564344-38564366 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1083177730 11:60962144-60962166 CCCAGCTTCTCAGAAAGCTGAGG + Intergenic
1083573746 11:63774299-63774321 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1084011476 11:66352014-66352036 CCCAGCTAGTCAGGAAGCTGAGG - Intronic
1084620450 11:70266918-70266940 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1085371136 11:76006542-76006564 CCCAGCTTCTCAGGAAGCTGAGG + Intronic
1086356771 11:86009175-86009197 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1086590698 11:88510630-88510652 CCCAGCTTCTCAGGAAGCTGAGG - Intronic
1088989926 11:114944385-114944407 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
1090823383 11:130365134-130365156 CCCAGCTACTCAGGAAGCGGAGG + Intergenic
1091377404 12:34128-34150 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1091490776 12:930849-930871 CCCAGCTAGTCAGGAAGCTGAGG + Intronic
1092277705 12:7074669-7074691 CCCAGCTATTCAGCAAGCTGAGG + Intergenic
1092854045 12:12656477-12656499 CCCAGCTACCCAGGAGGCGGAGG - Intergenic
1093041771 12:14388888-14388910 CCCAGCATGTCAGGAAGCTGAGG - Intronic
1093407605 12:18824242-18824264 CCCAGCTACTCAGCAAGCTGAGG + Intergenic
1093454905 12:19355465-19355487 CCCAGCTAGCCAGGAGGCTGGGG - Intronic
1094379699 12:29830006-29830028 CCCAGCTAGTCAGGAAGCTGAGG + Intergenic
1094500670 12:31018265-31018287 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1096184175 12:49567601-49567623 CCGAGCTTGCCGGCAAACTGAGG + Intronic
1097049238 12:56211213-56211235 CCCAGCTAGCCAGGAGGCTGAGG + Intronic
1097255398 12:57669907-57669929 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
1098434255 12:70451932-70451954 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098547422 12:71727155-71727177 CCCAGCTACCCAGCAGGCTGAGG - Intergenic
1098823925 12:75269612-75269634 CCCAGCTTCTCAGGAAGCTGAGG - Intergenic
1099231887 12:80036212-80036234 CCCAGCTACCCAGCAGGCTGGGG - Intergenic
1099862510 12:88238182-88238204 CCCAGCTACTCAGCAAGCAGAGG - Intergenic
1100258678 12:92910351-92910373 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1100741543 12:97598728-97598750 CCCAGCTACTCAGCAAGCTGAGG - Intergenic
1102250960 12:111387351-111387373 CCCAGCTACTCAGGAAGCGGAGG - Intergenic
1103079125 12:118009400-118009422 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1103183154 12:118932531-118932553 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1103259202 12:119571439-119571461 CCCAGCTACTCAGGAAGCGGAGG + Intergenic
1103282856 12:119774856-119774878 CCCAGCTACCCAGGAGGCGGAGG + Intronic
1103585430 12:121950671-121950693 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1103750404 12:123155085-123155107 CCCAGCTACCCAGCAGGCTGAGG + Exonic
1103819284 12:123684514-123684536 CCCAGCTACTCAGCAAGCTGAGG - Intronic
1103860587 12:124009764-124009786 CCCAGCATGCCAGGAGGCCGAGG - Intronic
1103912741 12:124361273-124361295 AGCAGCCTGCCAGCAAGCGCCGG + Intronic
1104376460 12:128268058-128268080 CCCAGCTTGGCAGAAACCAGGGG + Intronic
1105234096 13:18530538-18530560 CCCAGCTATCCAGGAAGCTGAGG - Intergenic
1107361790 13:39625981-39626003 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1107761337 13:43682720-43682742 CCCTGCATGCCAGCTAGCAGTGG + Intronic
1110083875 13:71352954-71352976 CCCAGCTAGTCAGGAGGCGGAGG + Intergenic
1110211815 13:72982318-72982340 CCCAGCTTCTCAGGAAGCTGAGG + Intronic
1111603576 13:90506191-90506213 CCCAGCTACTCAGCAAGCTGAGG + Intergenic
1112752458 13:102596887-102596909 CCCGGCCTGCCAGGGAGCGGTGG - Intergenic
1113068140 13:106392401-106392423 CCCAGCTTCCCAGGAGGCTGAGG + Intergenic
1113214671 13:108025201-108025223 CCCAGCTACTCAGGAAGCGGAGG + Intergenic
1114641998 14:24229952-24229974 CCCAGCTAGTCAGGAAGCTGAGG + Intronic
1114910628 14:27191132-27191154 CCCAGCTTCCCGGGAGGCGGAGG + Intergenic
1115600231 14:34949003-34949025 CCCAGCTACTCAGGAAGCGGAGG - Intergenic
1116196583 14:41735381-41735403 CCCAGCTAGTCAGCAGGCTGAGG - Intronic
1116259555 14:42606164-42606186 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1116433164 14:44869602-44869624 GCAAGCTTGCCAGCAAGCAGAGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116601541 14:46931097-46931119 CCCAGCTACCCAGCAGGCTGAGG + Intronic
1116818659 14:49606452-49606474 CCCAGCTAGTCAGGAAGCTGAGG - Intronic
1118246343 14:64114731-64114753 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1118248706 14:64137313-64137335 CCCAGCTAGCCAGGAGGCTGAGG - Intronic
1118394288 14:65322522-65322544 CCCAGCTACCCAGAAAGCTGAGG + Intergenic
1118720479 14:68590410-68590432 CCCAGCTTGCCAGCATGGCAGGG + Intronic
1120519381 14:85508840-85508862 CCCAGCTACCCAGCAGGCTGAGG + Intergenic
1122451654 14:101813506-101813528 CCCAGCTTCCCAGCACAGGGAGG - Intronic
1124250326 15:28102713-28102735 CCCAGCTTCTCAGTAAGCTGAGG - Intergenic
1124863196 15:33463049-33463071 CCCAGCTACTCAGCAGGCGGTGG + Intronic
1124927503 15:34085538-34085560 CCCAGCTGCCCAGGAAGCTGAGG - Intronic
1125229598 15:37438135-37438157 CCCAGCTAGTCAGGAAGCTGAGG - Intergenic
1125342854 15:38691856-38691878 CCCAGCTAGCCAGGAGGCTGAGG - Intergenic
1125692633 15:41608809-41608831 CCCAGCTACTCAGCAAGCTGAGG - Intergenic
1126438952 15:48666313-48666335 CCCAGCTAGCCAGGAGGCTGAGG + Intergenic
1126793831 15:52243944-52243966 ACCAGCCTGCCAGCAACAGGTGG - Intronic
1127263392 15:57342395-57342417 CCCAGCTTCTCAGGAAGCTGAGG - Intergenic
1127809894 15:62556420-62556442 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1128001836 15:64200127-64200149 CCCAGCTTCTCAGGAAGCTGAGG + Intronic
1128071825 15:64802096-64802118 CCCTGCTTGCCGGCCAGGGGAGG + Intergenic
1128156559 15:65395297-65395319 TCCAGCTAGCCAGCACGGGGGGG - Intronic
1128189836 15:65681689-65681711 CCCAGCTACTCAGGAAGCGGAGG - Intronic
1130066836 15:80611915-80611937 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1130246155 15:82251094-82251116 CCCAGCTTCCCAGGAGGCTGAGG + Intronic
1131990245 15:98086274-98086296 CCCAGCTAGTCAGGAAGCTGAGG + Intergenic
1132449523 15:101958865-101958887 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
1133214047 16:4280013-4280035 CCCAGCTACCCAGGAAGCCGAGG + Intergenic
1133627241 16:7582141-7582163 CCCAGCTAGTCAGGAAGCTGAGG - Intronic
1134394916 16:13853914-13853936 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1134398000 16:13882937-13882959 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1134853826 16:17503458-17503480 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1135352394 16:21739958-21739980 CCCAGCTACCCAGCAGGCTGAGG - Intronic
1135450882 16:22556080-22556102 CCCAGCTACCCAGCAGGCTGAGG - Intergenic
1135474618 16:22763182-22763204 CCCATCTTGCCAGCTCACGGTGG - Intergenic
1136448202 16:30336776-30336798 CCCAGCTAGTCAGGAAGCTGAGG - Intergenic
1136453802 16:30369657-30369679 CCCGGCTTGGGGGCAAGCGGGGG + Exonic
1136526891 16:30836907-30836929 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1136750794 16:32633978-32634000 CCCAGCTACCCAGCAGGCTGAGG + Intergenic
1136850803 16:33610885-33610907 CCCAGCTACTCAGCAGGCGGAGG - Intergenic
1137388915 16:48065325-48065347 CCCAGCTAGTCAGGAAGCTGGGG + Intergenic
1137519741 16:49182052-49182074 TCCAGCTTCCCAGGAAGCAGAGG - Intergenic
1137633623 16:49966440-49966462 CCCAGCTTCTCAGAAAGCTGAGG + Intergenic
1138022752 16:53499573-53499595 CCCAGCTTCTCAGGAAGCTGAGG - Intronic
1138464161 16:57175128-57175150 CCCAGCTAGTCAGGAGGCGGAGG - Intronic
1139163174 16:64535781-64535803 CCCAGCATGGCAGCATGTGGTGG + Intergenic
1140052804 16:71497686-71497708 CCCAGCTTCTCAGGAAGCTGAGG + Intronic
1140086127 16:71798770-71798792 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1140172677 16:72623181-72623203 CCCAGCTTTCCAGGAGGCTGAGG - Intergenic
1140516890 16:75549822-75549844 CCCAGCTAGTCAGGAAGCTGAGG - Intronic
1140548789 16:75840402-75840424 CCCAGCTTCTCAGAAAGCTGAGG + Intergenic
1141041588 16:80677084-80677106 CCCAGCTTTCCAGGGAGCTGAGG - Intronic
1142283938 16:89163807-89163829 CCCAGCTTCTCAGGAAGCTGAGG - Intergenic
1142386895 16:89771047-89771069 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1142400645 16:89856558-89856580 CCCAGCTGCCCAGGAAGCTGAGG - Intronic
1203052929 16_KI270728v1_random:893238-893260 CCCAGCTACCCAGCAGGCTGAGG + Intergenic
1203112410 16_KI270728v1_random:1459340-1459362 CCCAGCTACTCAGCAGGCGGAGG - Intergenic
1142673680 17:1500061-1500083 CCCAGCTGGTCAGGAGGCGGAGG - Intronic
1142823942 17:2495577-2495599 CCCAGCTAGCCAGGAGGCTGAGG + Intronic
1142908941 17:3070838-3070860 CCCAGCTAGTCAGCAGGCTGAGG - Intergenic
1142925624 17:3233404-3233426 CCCAGCTAGTCAGCAGGCTGAGG + Intergenic
1143182873 17:4994672-4994694 CCCAGCTACCCAGAAAGCTGAGG + Intronic
1143526980 17:7478846-7478868 CCCTGGCTGCCAGCAAACGGTGG + Intronic
1143844385 17:9762907-9762929 CCCAGCTTCCCAGGAGGCTGAGG - Intergenic
1144999537 17:19293972-19293994 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1145215183 17:21045898-21045920 CCCAGCTACCCAGCAGGCTGAGG + Intergenic
1145838350 17:27972052-27972074 GCCATCTTGCCAGCAACTGGAGG + Intergenic
1148474429 17:47917780-47917802 CCCAGTTTGGCAGGAAGCAGTGG - Intronic
1149700966 17:58655126-58655148 CCCAGCTACCCAGGAAGCGGAGG - Intronic
1149707821 17:58711672-58711694 CCCAGCTGGTCAGAAGGCGGAGG + Intronic
1150486189 17:65545570-65545592 CCCAGCTACCCAGGAGGCGGAGG + Intronic
1151793758 17:76328079-76328101 CCCAGCTACCCAGGAGGCGGAGG + Intronic
1151854452 17:76710957-76710979 CCCAGCTGGCCCGCACTCGGCGG - Intronic
1151903210 17:77031194-77031216 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
1151937641 17:77272756-77272778 CCCAGCTACCCAGGAGGCGGAGG - Intergenic
1152229707 17:79108343-79108365 GCCAGCCTGCGAGCAAGAGGAGG + Intronic
1152641406 17:81450791-81450813 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1152684130 17:81685523-81685545 CCCAGCTTGGCAGCAGCTGGGGG - Intronic
1152909858 17:82996404-82996426 CCCAGCTGCTCAGCAAGCTGAGG + Intronic
1153540449 18:6148539-6148561 CCCAGCTACCCAGCAGGCTGAGG - Intronic
1154515442 18:15159344-15159366 CCCAGCTATCCAGGAAGCTGAGG + Intergenic
1155028755 18:21965775-21965797 CCCAGCTACTCAGCAAGCTGAGG + Intergenic
1155485173 18:26333503-26333525 CCCAGCTACTCAGCAAGCTGAGG - Intronic
1158186945 18:54781114-54781136 CCCAACTGGCCAGCTAGCTGTGG + Intronic
1158465461 18:57686144-57686166 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1158650202 18:59277364-59277386 CCCAGCTTTGCAGGAAGCTGAGG - Intronic
1158691731 18:59667151-59667173 CCCAGCTACCCAGGAAGCTGGGG + Intronic
1158998459 18:62947908-62947930 CCCAGCTATCCAGGAAGCTGAGG + Intronic
1159817959 18:73100597-73100619 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1160194405 18:76740334-76740356 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1160635732 19:73686-73708 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1160800501 19:965576-965598 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1161429523 19:4223521-4223543 CCCAGCTAGTCAGGAAGCTGAGG - Intronic
1161488174 19:4547073-4547095 CCCAGCTACCCAGAAAGCTGAGG - Intronic
1161996242 19:7713515-7713537 CCCAGCTTCTCAGGAAGCTGGGG + Intergenic
1162431004 19:10628435-10628457 CCCAGCTACCCAGCAGGCTGAGG + Intronic
1162916680 19:13878022-13878044 CCCAGCTACCCAGGAAGCTGGGG - Intronic
1162994753 19:14327176-14327198 CCCAGCTTGTCAGGAGGCTGAGG + Intergenic
1163108650 19:15143210-15143232 CCCAGCTACTCAGCAGGCGGAGG + Intergenic
1163194232 19:15703355-15703377 CCCAGCTACTCAGCAAGCTGAGG - Intergenic
1163308544 19:16497989-16498011 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1163947388 19:20551311-20551333 CCCAGCTACCCAGCAGGCTGAGG + Intronic
1164483060 19:28630772-28630794 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
1164955604 19:32380810-32380832 CTCAGCTTCCCAGCAAGCGCAGG - Intronic
1165083302 19:33324123-33324145 CCCAGCTTCTCAGGAAGCTGAGG - Intergenic
1165223293 19:34335639-34335661 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1165305007 19:34998417-34998439 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1165331848 19:35144579-35144601 CCGCGCTTCCCAGCAGGCGGGGG + Intronic
1166778201 19:45324904-45324926 CCCAGCTAGCCAGGAGGCTGAGG + Intergenic
1167132588 19:47596870-47596892 CCCAGCTAGCCAGGAGGCTGAGG + Intergenic
1167936629 19:52914007-52914029 CCCAGCTACCCAGAAAGCTGGGG + Intergenic
1168035195 19:53713792-53713814 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1168241052 19:55089071-55089093 CCAAGCTTGGCAGCAGGAGGAGG - Intergenic
1168255575 19:55162919-55162941 TCCAGCTTCCCAGCTAGCTGGGG + Intronic
1168619420 19:57866076-57866098 CCCAGCTACCCAGCAGGCTGAGG - Intronic
1168643396 19:58044693-58044715 CTCAGCTTGCCAGCACCCTGGGG + Intronic
925142842 2:1561830-1561852 CCCACCTTGACAGCAGGTGGGGG + Intergenic
925311220 2:2883587-2883609 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
927508160 2:23627989-23628011 CCCAGCTCCCCGGGAAGCGGAGG - Intronic
927522036 2:23704649-23704671 CCCAGCTTCTCAGGAAGCTGAGG + Intronic
927581785 2:24257202-24257224 CCCAGCTAGCCGGGAAGCTGAGG + Intronic
929009841 2:37430363-37430385 CCCAGCTAGTCAGGAAGCTGAGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
931129339 2:59316253-59316275 CCCAGCTTTCCAGGAGGCTGAGG - Intergenic
931311790 2:61088634-61088656 CCCAGCTTCTCAGGAAGCTGAGG - Intronic
931352562 2:61505124-61505146 CCCAGCTAGTCAGCTAGCTGAGG - Intronic
931865608 2:66407993-66408015 CCCAGCTACCCAGCAGGCTGAGG - Intergenic
933757790 2:85653766-85653788 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
935173217 2:100626798-100626820 CCCAGCTTGGCAGGCAGAGGAGG + Intergenic
935258894 2:101337535-101337557 CCCAGCTTGTCAGGAGGCTGAGG + Intergenic
935978519 2:108603608-108603630 CCCAGCTAGCCAGGAGGCTGAGG - Intronic
936565743 2:113581365-113581387 CCCAGCTGGCCAGCAAAGGCAGG + Intergenic
937713861 2:125009917-125009939 CCCAGCTACTCAGCAAGCTGAGG + Intergenic
938049259 2:128152281-128152303 CCCAGCTTCTCAGGAAGCTGAGG - Intronic
938515704 2:132004118-132004140 CCCAGCTATCCAGGAAGCTGAGG + Intergenic
940954803 2:159715460-159715482 CCCAGCTACCCAGGAAGCTGAGG - Intronic
941373785 2:164702446-164702468 CCCAGCTACTCAGCAAGCTGAGG + Intronic
941403594 2:165061687-165061709 CCCAGCCTGCAAGCAATGGGGGG - Intergenic
941549759 2:166900694-166900716 CCCAACTTTCCAGCCAGCAGGGG - Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943339909 2:186668339-186668361 CCCAGCTACTCAGCAAGCTGAGG - Intronic
944437021 2:199701353-199701375 GCAACCTTGCCAGCATGCGGTGG - Intergenic
944773297 2:202935537-202935559 CCCAGCTTCTCGGCAAGCTGAGG - Intronic
944784587 2:203055487-203055509 CCCAGCTTCTCAGGAAGCTGGGG + Intronic
945207091 2:207343792-207343814 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
945213087 2:207404223-207404245 CCCAGCCTGCCTGCAAGAGAAGG + Intergenic
945608372 2:211966096-211966118 CCCAGCTACCCAGGAAGCTGAGG + Intronic
946090542 2:217218900-217218922 CACAGCTAGCAAGCAAGAGGAGG + Intergenic
946522496 2:220481927-220481949 CCCAGCTACTCAGCAAGCTGAGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947415522 2:229891307-229891329 CCCAGCTACTCAGCAAGCTGAGG + Intronic
948051235 2:234980973-234980995 CCCAGCTACCCAGGAGGCGGAGG - Intronic
1169239928 20:3968187-3968209 CCCAGCTTCTCAGGAAGCTGAGG + Intronic
1169428392 20:5513714-5513736 CCCAGCTAGTCAGGAAGCTGAGG - Intergenic
1169888423 20:10428148-10428170 ACTAGCTTACCAGCAAGCTGTGG + Intronic
1170260749 20:14404511-14404533 CCCAGCTACCCAGGAGGCGGAGG + Intronic
1170369734 20:15635950-15635972 CCCAGCTGGTCAGCAGGCTGAGG + Intronic
1170903180 20:20486021-20486043 CCCAGCTATCCAGGAAGCCGAGG + Intronic
1171047963 20:21828588-21828610 CCCAGCTAGCCAGGAGGCTGAGG - Intergenic
1171545025 20:25993490-25993512 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1172660044 20:36561729-36561751 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1172761166 20:37323525-37323547 CCCAGCTACTCAGAAAGCGGAGG - Intergenic
1174579085 20:51558224-51558246 CCCAGCTACCCAGCAGGCTGAGG + Intronic
1175706600 20:61183172-61183194 CCCAGCCTGCCAGCAAGGGGCGG + Intergenic
1176778079 21:13158799-13158821 CCCAGCTATCCAGGAAGCTGAGG - Intergenic
1177051975 21:16247878-16247900 CCCAGCTACTCAGGAAGCGGAGG + Intergenic
1177975701 21:27847805-27847827 CCCAGCTATCCAGGAAGCTGAGG - Intergenic
1178080203 21:29055557-29055579 CCCAGCTTTTCAGGAGGCGGAGG + Intergenic
1179411508 21:41167240-41167262 CCCAGCTTCGCAGCTAGCTGTGG + Intergenic
1179825499 21:43963457-43963479 CCCAGCATTCCAGGAAGCTGAGG + Intronic
1179843491 21:44093337-44093359 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1179914557 21:44467748-44467770 CTCAGCTTGGCAGCATGCTGGGG + Intergenic
1180224695 21:46385238-46385260 CCCAGCTTCTCAGAAAGCTGAGG + Intronic
1180641813 22:17304956-17304978 CCCAGCTTCCCAGGAGGCTGAGG - Intergenic
1180805286 22:18658726-18658748 CCCAGCTACCCAGCAGGCTGAGG + Intergenic
1182653829 22:31873906-31873928 CCCAGCTAGTCAGGAAGCTGAGG - Intronic
1182928046 22:34145701-34145723 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
1183394804 22:37565693-37565715 CCCAGCTACCCAGGAAGCTGTGG - Intronic
1183686679 22:39365041-39365063 CCCAGGTCACCAGCAAGCAGAGG - Intronic
1183900350 22:41001103-41001125 CCCAGCTATCCAGGAAGCTGAGG - Intergenic
1184338037 22:43866957-43866979 CCCAGCTAGTCAGCAGGCTGAGG - Intergenic
1184613426 22:45621474-45621496 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1184903104 22:47459793-47459815 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1185286357 22:50001540-50001562 CAGAGCTTGCCAGCAAGTCGTGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950395405 3:12730132-12730154 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
950633533 3:14299470-14299492 CCCAGCTAGCCAGCCAGCCTGGG - Intergenic
950660485 3:14463978-14464000 CCCAGGTCACCAGCAAGGGGTGG + Intronic
950803376 3:15574250-15574272 CCCAGCATGTCAGGAAGCTGAGG + Intronic
952617874 3:35297170-35297192 CCCAGCTAGTCAGCAGGCTGAGG - Intergenic
952925261 3:38315452-38315474 CCCAGCTGGCCAGCAGGCTCAGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953252731 3:41261389-41261411 GTCAGCTAGCCAGCAAGCAGTGG + Intronic
954350246 3:50037283-50037305 CCCAGCTTGTCAGGAAGCTGAGG + Intronic
954360133 3:50117663-50117685 CCCAGCTAGTCAGGAAGCTGAGG + Intronic
956154734 3:66283394-66283416 CCCAGCTTCTCAGGAAGCTGAGG - Intronic
956644251 3:71440747-71440769 CCCAGCTACCCAGGAAGCTGAGG + Intronic
957065348 3:75517600-75517622 CCCAGCTAGCCAGGAGGCTGAGG - Intergenic
957450583 3:80377071-80377093 CCCAGGATGCCAGAAGGCGGAGG - Intergenic
958800951 3:98755160-98755182 CCCAGCTACCCAGGAAGCTGAGG - Intronic
958997851 3:100926537-100926559 CCCAACTTCCCAGCAAGTGTTGG + Intronic
959547498 3:107614065-107614087 CCCAGCTAGTCAGGAAGCTGAGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960876974 3:122306518-122306540 CCCAGCTACTCAGCAAGCTGAGG + Intergenic
960892978 3:122470394-122470416 CCCAGCTACCCAGGAAGCTGAGG + Intronic
961039531 3:123667486-123667508 CCCAGCTACCCAGGAAGCTGAGG + Intronic
961512026 3:127409101-127409123 GCCAGCTTACCTGGAAGCGGTGG + Intergenic
961755849 3:129126987-129127009 CCCAGCTGACTAGCAAGCAGAGG - Intronic
962820805 3:139045732-139045754 CCCAGCTTGTCAGGAAGCTGAGG - Intronic
964056860 3:152471861-152471883 CCCAGCTATCCAGCAGGCTGAGG - Intergenic
966164490 3:177001760-177001782 CCCAGCTACCCAGCAGGCTGAGG + Intergenic
966521472 3:180878618-180878640 CCCAGCTATCCAGGAAGCTGAGG - Intronic
967280387 3:187816858-187816880 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
968164548 3:196454023-196454045 CCCAGCTACTCAGCAAGCTGAGG - Intergenic
968485064 4:856102-856124 CCCAGCTACTCAGCAAGCTGAGG - Intronic
968485352 4:858355-858377 CCCACCGAGCCAGCAGGCGGAGG + Intronic
968637654 4:1690065-1690087 CCCAGCTACTCAGGAAGCGGAGG - Intergenic
969854364 4:9987233-9987255 CCCAGCTACCCAGGAAGCTGAGG - Intronic
970315843 4:14827578-14827600 CCCAGCTACTCAGGAAGCGGAGG + Intergenic
970661513 4:18290763-18290785 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
970784141 4:19775699-19775721 CCCAGCTACCCAGGAGGCGGAGG + Intergenic
971675702 4:29625964-29625986 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
971845227 4:31910498-31910520 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
972017720 4:34266972-34266994 CCCAGCTTCTCAGGAAGCTGAGG - Intergenic
972133737 4:35865489-35865511 CCCAGCTAGCCAGGAAGCTGAGG + Intergenic
972512960 4:39786609-39786631 CCCAGCTACTCAGGAAGCGGAGG + Intergenic
972606739 4:40620387-40620409 CCCAGCTAGCCAGGAGGCTGAGG + Intronic
972771624 4:42202831-42202853 CCCAGCTACTCAGCAAGCTGAGG - Intergenic
975140150 4:70910154-70910176 CCCAGCTACTCAGCAGGCGGAGG - Intronic
976528125 4:86117156-86117178 CCCAGCTACCCAGAAAGCTGAGG + Intronic
976723343 4:88192054-88192076 CCCAGCTACCCAGGAAGCTGAGG + Intronic
977241380 4:94574380-94574402 CCCAGCTAGCCAGGAGGCTGAGG + Intronic
978785037 4:112600145-112600167 CCCAGCTACCCAGCAGGCTGAGG - Intronic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
983007007 4:162495583-162495605 CCCAGCTAGTCAGGAAGCTGAGG - Intergenic
983657054 4:170093709-170093731 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
984575153 4:181439070-181439092 CCCAGCTTCTCAGAAAGCTGAGG - Intergenic
984661025 4:182375655-182375677 CCCAGCTGCCCAGGAGGCGGAGG - Intronic
985304925 4:188529021-188529043 ACTCGCTTGGCAGCAAGCGGGGG - Intergenic
985967934 5:3351906-3351928 CCAAGCTGGCCACCAAGCAGGGG + Intergenic
986473494 5:8099092-8099114 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988400063 5:30750951-30750973 GTCAGCTTGGCAGCAAGTGGCGG + Intergenic
990670751 5:58127503-58127525 CGCTGCCTGCCAGCAAACGGAGG - Intergenic
991920361 5:71650578-71650600 CCCAGCTTCTCAGGAAGCTGAGG - Intronic
992202163 5:74395287-74395309 CACAGCATGCCAGCAGGTGGAGG + Intergenic
992539577 5:77751275-77751297 CCCAGCTACCCAGGAAGCTGAGG - Intronic
992854671 5:80848111-80848133 CCCAGCTTCCCAGCAGGCTGAGG + Intronic
993218569 5:85059533-85059555 CCCAGCTAGCCAGGAGGCTGAGG - Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
993956838 5:94244446-94244468 CCCAGCTAGCCAGAAAGCTGAGG - Intronic
994608600 5:102005726-102005748 CCCAGCTTTCCATCAAGAAGTGG - Intergenic
998105686 5:139467770-139467792 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
999435357 5:151559394-151559416 CCCAGCTTGGCCCCAAGCTGAGG + Intronic
999443025 5:151617163-151617185 CCCAGCTAGGCAGCAAGCAGAGG + Intergenic
1002372587 5:178767120-178767142 CACAGCTTGCCTGCAAGCCAGGG + Intergenic
1003312445 6:4981370-4981392 CCCAGCTTCTCAGAAAGCTGGGG + Intergenic
1004076482 6:12348551-12348573 CCCAGCTCCCCAACAAGCTGGGG + Intergenic
1004457510 6:15804583-15804605 CGCAGCTTAGCAGCAAGCTGGGG + Intergenic
1004652117 6:17619980-17620002 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1004673892 6:17823150-17823172 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1006135492 6:31893431-31893453 CCCAGCTTCCCAGGAAGCTGAGG - Intronic
1006194745 6:32232247-32232269 CCCAGCTATCCAGGAAGCTGAGG - Intergenic
1006847210 6:37070941-37070963 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
1008585039 6:52940987-52941009 CCCAGCTACTCAGCAAGCTGAGG + Intergenic
1008615579 6:53222555-53222577 CCCAGCTAGTCAGGAAGCTGAGG - Intergenic
1008668989 6:53747437-53747459 CCCAGCTTCTCAGGAGGCGGAGG - Intergenic
1009388986 6:63122505-63122527 CCCAGCTAGCCAGGAGGCTGAGG + Intergenic
1009641084 6:66337684-66337706 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1011651783 6:89513038-89513060 CCCAGCTACTCAGGAAGCGGAGG - Intronic
1012640675 6:101607987-101608009 ACCAGCTTGGCTGCAAGCAGAGG + Intronic
1012870756 6:104670632-104670654 CCCAGCTTCCCAGGAGGCTGAGG + Intergenic
1013687855 6:112606802-112606824 CCCAGCTCAGCAGCAAGAGGTGG - Intergenic
1014256837 6:119169103-119169125 CCCAGCTACCCAGGAGGCGGAGG + Intergenic
1014451920 6:121591886-121591908 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1015372455 6:132469721-132469743 CCCAGCTACTCAGCAAGCTGAGG + Intronic
1016071284 6:139742034-139742056 CCCAGCTAGTCAGGAAGCTGAGG - Intergenic
1016417540 6:143848802-143848824 CCGAGCTGGCCACCAAGTGGTGG + Intronic
1017184707 6:151589137-151589159 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1017446890 6:154515082-154515104 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1018219479 6:161564160-161564182 CCCAGCATTCCTGCCAGCGGTGG - Intronic
1018234341 6:161708771-161708793 CCCAGGTTGCCTGTAAGCAGTGG + Intronic
1018677293 6:166234252-166234274 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
1018734177 6:166675140-166675162 CCCAGCTTGCCAGCAAGCGGAGG + Intronic
1019283420 7:211601-211623 CCCAGCTTGCCTGAAGGCCGAGG + Intronic
1020440350 7:8210826-8210848 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1020629430 7:10622580-10622602 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1020966587 7:14877437-14877459 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1021723277 7:23525705-23525727 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1022090709 7:27106401-27106423 CCCAGGTCTCCAGCAAACGGAGG - Exonic
1022262502 7:28719942-28719964 CCCAGCTTCTCAGGAAGCTGAGG + Intronic
1022669644 7:32443757-32443779 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
1022714146 7:32882867-32882889 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1023811821 7:43917846-43917868 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1023813111 7:43927426-43927448 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1023910432 7:44551678-44551700 CCCAGCTTCCCAGGAGGCTGAGG + Intergenic
1024310432 7:47964260-47964282 CCCAGCTAGTCAGGAAGCTGAGG + Exonic
1024619480 7:51145492-51145514 CCCAGCTACTCAGGAAGCGGAGG - Intronic
1024942149 7:54774670-54774692 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1025296433 7:57778555-57778577 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1026129568 7:67609009-67609031 GCCAGCCAGCCAGCAAGGGGAGG + Intergenic
1026197563 7:68186073-68186095 CCCACCCTTCCAGCAACCGGTGG + Intergenic
1026945032 7:74310404-74310426 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1027167366 7:75844613-75844635 CCCAGCTTCTCAGAAAGCTGAGG + Intronic
1027218907 7:76201897-76201919 TCCAGCATTTCAGCAAGCGGCGG + Exonic
1027395927 7:77754151-77754173 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1028409611 7:90514363-90514385 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1029596833 7:101542501-101542523 CCCAGCAAGCCAGCAAGCTGGGG + Intronic
1029732019 7:102444779-102444801 CCCAGCTACTCAGGAAGCGGAGG - Intronic
1029973141 7:104809009-104809031 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1030978178 7:116153367-116153389 CCCAGCTACTCAGGAAGCGGAGG - Intronic
1031458962 7:122021623-122021645 CCCAGCTTCCCAGGAGGCTGAGG + Intronic
1032107565 7:129046924-129046946 CCCACCTTGCCACAAATCGGGGG + Intronic
1032604171 7:133330898-133330920 GCCATCTTGCCAGCAATCTGTGG + Intronic
1033324627 7:140367319-140367341 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1034479551 7:151308937-151308959 CCCATCCTGCCTGCAGGCGGTGG + Intergenic
1034485296 7:151357130-151357152 CCCAGCTACCCAGAAGGCGGAGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034927588 7:155134774-155134796 CCCAGCTACTCAGCAAGCTGAGG + Intergenic
1036454074 8:8892981-8893003 CCCTGCGTGCCAGGAAGCTGCGG - Exonic
1037335834 8:17790869-17790891 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1037412644 8:18614742-18614764 CCCAGCTTCTCAGGAAGCTGAGG - Intronic
1037456395 8:19068403-19068425 CCCAGCTTGTCAGGAGGCTGGGG - Intronic
1038500019 8:28035996-28036018 CCCAGCTTCTCAGGAAGCTGAGG - Intronic
1039482290 8:37883312-37883334 CCCAGCTACTCAGCAAGCTGAGG - Intronic
1039518137 8:38150003-38150025 CCCAGCTACCCAGGAGGCGGAGG + Intronic
1040869367 8:52084337-52084359 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1041044964 8:53880329-53880351 CCCAGCTAGCCAGAGCGCGGAGG - Intronic
1041263730 8:56044351-56044373 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1041347511 8:56915668-56915690 CCCAGCTAGTCAGGAAGCTGAGG - Intergenic
1042030285 8:64468028-64468050 CCCAGCTAGTCAGGAAGCTGAGG + Intergenic
1042240753 8:66661877-66661899 CCCAGCTTGTCAGGAGGCTGAGG - Intronic
1042554192 8:70020479-70020501 CCCAGCTTCTCAGGAAGCTGAGG + Intergenic
1043618044 8:82152288-82152310 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1044517034 8:93151637-93151659 CCCAGCTAGTCAGCAGGCTGAGG + Intronic
1045267784 8:100634945-100634967 CCCAGCTTCTCAGGAAGCTGTGG + Intronic
1045293030 8:100850216-100850238 CCCAGCTTCTCAGCAGGCTGAGG - Intergenic
1045303704 8:100938012-100938034 CCCAGCTATCCAGGAAGCTGAGG + Intronic
1045392761 8:101731791-101731813 CCCAGGTTGCCAGCAATTGGAGG + Intronic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1046807928 8:118500688-118500710 CCCAGCTTCTCAGGAAGCTGAGG + Intronic
1047571803 8:126107051-126107073 CCCAGCTACCCAGGAGGCGGAGG - Intergenic
1048146198 8:131846244-131846266 CCCAGCTGGCCAGGAGGCTGAGG + Intergenic
1048685461 8:136900180-136900202 CCCAGCTACCCAGGAAGCAGAGG - Intergenic
1049013511 8:139903924-139903946 CCCAGCTACCCAGGAGGCGGAGG + Intronic
1049598003 8:143493256-143493278 CCCTGCCTGCCAGCAAGGGCTGG + Intronic
1049886674 9:31859-31881 CCCAGCTGGCCAGCAAAGGCAGG - Intergenic
1050028789 9:1363742-1363764 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1050247873 9:3710247-3710269 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1050834283 9:10056203-10056225 CCCAGCTAGTCAGCAGGCTGAGG + Intronic
1051534771 9:18144319-18144341 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1052526628 9:29627322-29627344 CCCAGCTAGCCAGGAGGCTGAGG - Intergenic
1052530246 9:29673791-29673813 CCCAGCTAGTCAGGAAGCTGAGG + Intergenic
1052607778 9:30727215-30727237 ACCATCTTGCCACCAAGCGCTGG + Intergenic
1052867929 9:33477037-33477059 CCCAGCTAGCCAGGAAGCTGGGG - Intergenic
1052967423 9:34351087-34351109 CCCAGCTTCTCAGAAAGCTGAGG + Intergenic
1053119483 9:35535652-35535674 CCCAGCTACTCAGCAAGCTGAGG - Intronic
1053624131 9:39851564-39851586 CCCAGCTACTCAGCAAGCTGAGG - Intergenic
1053822014 9:41977733-41977755 CCCAGCTTCCCAGGAGGCTGAGG - Intronic
1053880737 9:42591664-42591686 CCCAGCTACTCAGCAAGCTGAGG + Intergenic
1054219766 9:62399134-62399156 CCCAGCTACTCAGCAAGCTGAGG + Intergenic
1054230949 9:62510039-62510061 CCCAGCTACTCAGCAAGCTGAGG - Intergenic
1054608559 9:67209676-67209698 CCCAGCTTCCCAGGAGGCTGAGG + Intergenic
1056407052 9:86284282-86284304 CCCAGCTACCCAGGAGGCGGAGG + Intergenic
1057196343 9:93117452-93117474 CCCAGCTACTCAGGAAGCGGAGG - Intergenic
1058464495 9:105214177-105214199 CCCAGCTTGTCAGTAGGCTGAGG + Intergenic
1058491588 9:105506885-105506907 CCCAGCTTGTCAGGAAGCTGAGG - Intronic
1058691966 9:107527724-107527746 CCCAGCTTCTCAGGAAGCTGAGG - Intergenic
1060764533 9:126283808-126283830 CCCAGGTTGCCAGAGAGCAGGGG + Intergenic
1061760514 9:132847998-132848020 CCCAGCTACTCAGGAAGCGGAGG + Intronic
1062021430 9:134321212-134321234 CCCACACTGCCAGCAAGTGGGGG - Intronic
1062348381 9:136126190-136126212 CCCAGCTTCTCAGCATGGGGAGG + Intergenic
1062616302 9:137397825-137397847 TCCAGCTACTCAGCAAGCGGAGG + Intronic
1185671452 X:1813231-1813253 CCCAGCTTCTCAGCAAGGTGAGG + Intergenic
1186338032 X:8613321-8613343 CCCAGCTAGACAGGAAGCTGAGG - Intronic
1186351462 X:8743812-8743834 CCCAGCTATCCAGGAAGCTGAGG + Intergenic
1186530062 X:10286414-10286436 CCCAGCTTCCCAGCCACCAGAGG - Intergenic
1187154840 X:16712772-16712794 CTCGGCTTGCCAGGAAGCCGGGG - Intronic
1187913518 X:24132167-24132189 CCCAGCTAGTCAGGAAGCTGAGG + Intergenic
1188623211 X:32251866-32251888 CCCAGCTACCCAGGAAGCTGAGG + Intronic
1188796432 X:34471915-34471937 CCCAGCTAGTCAGGAAGCTGAGG + Intergenic
1189417922 X:40831486-40831508 CACAGCTTGCCAGAAAGGCGTGG - Intergenic
1190826087 X:54019345-54019367 CCCAGCTACCCAGGAAGCGCAGG + Intronic
1191114238 X:56835371-56835393 CCCAGCTTCTCAGGAAGCTGAGG - Intergenic
1191853820 X:65606536-65606558 CCCAGCTACCCAGGAAGCTGAGG - Intronic
1191945836 X:66534506-66534528 CTCAGCTTGTCTGCAAGCTGAGG - Intergenic
1192181467 X:68918369-68918391 CCCTGCCTGCCAGCAGGGGGTGG - Intergenic
1192759521 X:74081609-74081631 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1193162748 X:78246218-78246240 CCCAGCTACCCAGGAAGCTGAGG - Intergenic
1193434793 X:81459667-81459689 CCCAGCTACTCAGCAAGCTGAGG - Intergenic
1194003850 X:88466107-88466129 CCCAGCTAGTCAGGAAGCTGAGG + Intergenic
1194672966 X:96757031-96757053 CCCAGCTTCTCAGGAAGCTGAGG - Intronic
1194734142 X:97492317-97492339 CCCAGCTTCTCAGGAAGCTGAGG + Intronic
1194824064 X:98540158-98540180 CCCAGCTACCCAGCAGGCTGAGG + Intergenic
1195237072 X:102911212-102911234 TACAGTTTGCCAGCAAGTGGGGG - Intergenic
1196437543 X:115688547-115688569 CCCAGCTTTTCAGGAAGCTGAGG - Intergenic
1196779424 X:119369446-119369468 CCCAGCTAGTCAGGAAGCTGAGG + Intergenic
1196986056 X:121273010-121273032 CCCAGCTAGCCAGGAGGCTGAGG - Intergenic
1199268457 X:145855435-145855457 CCCAGCTACCCAGGAAGCTGAGG + Intergenic
1199707322 X:150439830-150439852 CCCAGCTCCCCAGGAAGCTGAGG + Intronic
1200170222 X:154067449-154067471 CCCAGCTAGCCAGGAGGCTGAGG - Intronic
1200786583 Y:7265950-7265972 CCCAGCTGCTCAGCAAGCTGAGG + Intergenic