ID: 1018734790

View in Genome Browser
Species Human (GRCh38)
Location 6:166679722-166679744
Sequence CCAGCAGAGAGAGCCGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1728
Summary {0: 1, 1: 8, 2: 134, 3: 703, 4: 882}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018734790_1018734803 8 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734803 6:166679753-166679775 TGTGGAGGGAGCGGCGCGGGCGG 0: 4
1: 156
2: 699
3: 733
4: 812
1018734790_1018734804 9 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734804 6:166679754-166679776 GTGGAGGGAGCGGCGCGGGCGGG 0: 4
1: 157
2: 704
3: 866
4: 1164
1018734790_1018734808 27 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734808 6:166679772-166679794 GCGGGAGCTGGGGTTGCGAGTGG No data
1018734790_1018734806 16 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734806 6:166679761-166679783 GAGCGGCGCGGGCGGGAGCTGGG 0: 1
1: 1
2: 28
3: 292
4: 1089
1018734790_1018734802 5 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734802 6:166679750-166679772 AGGTGTGGAGGGAGCGGCGCGGG 0: 4
1: 321
2: 500
3: 388
4: 647
1018734790_1018734797 -10 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734797 6:166679735-166679757 TCTCTGCTGGTGGGGAGGTGTGG 0: 1
1: 6
2: 88
3: 268
4: 1100
1018734790_1018734799 -6 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734799 6:166679739-166679761 TGCTGGTGGGGAGGTGTGGAGGG No data
1018734790_1018734805 15 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734805 6:166679760-166679782 GGAGCGGCGCGGGCGGGAGCTGG 0: 1
1: 9
2: 110
3: 603
4: 1599
1018734790_1018734798 -7 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734798 6:166679738-166679760 CTGCTGGTGGGGAGGTGTGGAGG No data
1018734790_1018734800 -1 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734800 6:166679744-166679766 GTGGGGAGGTGTGGAGGGAGCGG 0: 92
1: 394
2: 1177
3: 907
4: 3082
1018734790_1018734801 4 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734801 6:166679749-166679771 GAGGTGTGGAGGGAGCGGCGCGG 0: 4
1: 271
2: 416
3: 331
4: 1508
1018734790_1018734807 17 Left 1018734790 6:166679722-166679744 CCGGAGCCGGCTCTCTCTGCTGG 0: 1
1: 8
2: 134
3: 703
4: 882
Right 1018734807 6:166679762-166679784 AGCGGCGCGGGCGGGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018734790 Original CRISPR CCAGCAGAGAGAGCCGGCTC CGG (reversed) Intronic
900134047 1:1106750-1106772 CAAGCAGAGGGAGCCGGCTCCGG - Intronic
900287804 1:1909850-1909872 CCAGCAGCGAGAGCGGCCCCAGG - Intergenic
900673073 1:3868016-3868038 ACAGCTGTGAGAGCCGGATCCGG + Exonic
901046023 1:6396127-6396149 CAAGCTGAGGGAGCCGGGTCCGG + Intergenic
901601525 1:10426758-10426780 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
901783295 1:11608719-11608741 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
901862140 1:12081219-12081241 CCAGCAGAGTGAGCAGGGCCTGG + Intronic
902032154 1:13430774-13430796 CAAGCAGAGGGAGCGGGCTCTGG + Intergenic
902033396 1:13439246-13439268 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
902148213 1:14420927-14420949 CAAGCAGAGGGAGCCAGCTCCGG + Intergenic
902816699 1:18920608-18920630 CCACCACAGAGAGCCTGCTCAGG + Intronic
902843318 1:19089363-19089385 CCAGCAGCCAGAGCAGGCACTGG + Intronic
903624556 1:24721487-24721509 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
903754360 1:25650531-25650553 CCCGCAGAGAGAGCAGGTCCAGG + Intronic
904238926 1:29131476-29131498 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
904471596 1:30739862-30739884 CCAGCAGGGTGAGCAGGCACAGG + Exonic
905449483 1:38047227-38047249 GCAGCAGGGATTGCCGGCTCCGG + Intergenic
905742840 1:40387816-40387838 CAAGCCGAGGGAGCCAGCTCCGG - Intronic
906083260 1:43107908-43107930 CAAGCCGAGGGTGCCGGCTCTGG + Intergenic
906563560 1:46778904-46778926 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
906666167 1:47623654-47623676 ACAGCAGAGAGAGCCTGGCCTGG + Intergenic
906789902 1:48650093-48650115 CCAGCAGAGTGAGGTGCCTCAGG + Intronic
907865753 1:58397663-58397685 CCAGCAGAAGGAGCAGGCTGGGG - Intronic
907889443 1:58623393-58623415 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
907980010 1:59472090-59472112 CAAGCTGAGGGGGCCGGCTCCGG - Intronic
908138483 1:61157651-61157673 ACAGCAGAGTGAGCTGGCTGTGG + Intronic
908888541 1:68817681-68817703 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
909318081 1:74248306-74248328 CAAGCAGAGGGAGCCGGCTCTGG + Intronic
909782332 1:79561923-79561945 CAAGCAGAGGGAGCCAACTCTGG + Intergenic
909828272 1:80153756-80153778 CCAGCAGAGCTACCAGGCTCCGG + Intergenic
910392344 1:86757946-86757968 TCAGCACAGAGAGCTGGCTGTGG - Intergenic
910478867 1:87636625-87636647 CAAGCAGAGGGAGCTGGCTCTGG + Intergenic
910609803 1:89128443-89128465 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
910622704 1:89273724-89273746 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
910693183 1:89985016-89985038 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
910743787 1:90551067-90551089 GCAGCAGAGAGAGACGGATCTGG - Intergenic
911001407 1:93170230-93170252 CAAGCTGAGGGAGCCGGCTGCGG - Intronic
911205879 1:95091352-95091374 CAAGCTGAAAGAGACGGCTCTGG - Intergenic
911277644 1:95880931-95880953 GCAGGAGAGAGAGCGAGCTCAGG + Intergenic
911305281 1:96224738-96224760 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
911808001 1:102235173-102235195 CAAGCAGAAGGAGCCGGCTCTGG + Intergenic
911839300 1:102660411-102660433 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
911950826 1:104172287-104172309 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
912022039 1:105117537-105117559 CCAGCAGAGCTACCAGGCTCTGG - Intergenic
912069821 1:105795871-105795893 TGAGCAGAGGGAGCCGGCTCCGG - Intergenic
912166100 1:107044717-107044739 CAAGGTGAGGGAGCCGGCTCCGG - Intergenic
912315879 1:108667438-108667460 CACGCTGAGGGAGCCGGCTCTGG - Intergenic
912612374 1:111061665-111061687 CCAGCAGAGCTACCAGGCTCTGG + Intergenic
912819424 1:112854912-112854934 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
913161113 1:116146954-116146976 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
913468964 1:119171509-119171531 CAAGCAGAGGGAGCCAGCTCCGG - Intergenic
914203479 1:145506251-145506273 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
914438489 1:147681165-147681187 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
914482601 1:148079405-148079427 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
914928014 1:151906098-151906120 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
915104078 1:153521748-153521770 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
915242361 1:154532472-154532494 CAAGCCGAGGGAGCCAGCTCTGG + Intronic
915260001 1:154670712-154670734 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
915666159 1:157446679-157446701 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
915764536 1:158349379-158349401 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
915767205 1:158374523-158374545 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
915865602 1:159495004-159495026 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
916960233 1:169882073-169882095 CAAGCTGAGGGAACCGGCTCCGG - Intronic
916991670 1:170251136-170251158 CAAGCAGAGGGAGCCGTCTCCGG + Intergenic
917094033 1:171382083-171382105 CAAGCAGAGGGAGCTGGCTCTGG + Intergenic
917348918 1:174056771-174056793 CAAGCTGAGGGAGCCGGCTCAGG + Intergenic
917933047 1:179837329-179837351 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
918046570 1:180945145-180945167 CCAGCAAAAAGAGCCTGCTAGGG - Intronic
918512058 1:185322080-185322102 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
918542751 1:185649326-185649348 CAAGCAGTGGGAGCCAGCTCCGG + Intergenic
918696420 1:187551295-187551317 CCAGCAGAGGGAGCCAGCTCCGG + Intergenic
918720785 1:187850163-187850185 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
918732346 1:188013699-188013721 CAAGCTGAGGGAGCCGGTTCCGG + Intergenic
918792092 1:188841573-188841595 CAAGCTGAGGGAGCAGGCTCCGG + Intergenic
918853259 1:189718696-189718718 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
918951959 1:191151387-191151409 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
918993843 1:191731776-191731798 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
919049835 1:192499459-192499481 CAAGCTGAGAGAGCCGGCTCTGG + Intergenic
919091851 1:192986873-192986895 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
919174421 1:194001803-194001825 CAAGCTGAGGGCGCCGGCTCTGG - Intergenic
919201400 1:194358668-194358690 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
919207037 1:194431372-194431394 CAAGCAGAGGGAACAGGCTCCGG + Intergenic
919250797 1:195054283-195054305 CAAGCTGAGGCAGCCGGCTCCGG - Intergenic
919297817 1:195723287-195723309 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
919377111 1:196808760-196808782 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
919386817 1:196933660-196933682 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
919630912 1:199959635-199959657 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
920150178 1:203900198-203900220 CAAGCCGAGGGAACCGGCTCCGG - Intergenic
920528731 1:206686131-206686153 CCAGCTGAGGGGGCCAGCTCCGG - Intronic
920604912 1:207371795-207371817 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
920756632 1:208739642-208739664 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
920878508 1:209859049-209859071 CAAGCTGAGCGAGCCAGCTCCGG + Intergenic
920882081 1:209889338-209889360 CAAGCTGAGGGAGCCGGCTCAGG + Intergenic
921096236 1:211889510-211889532 CAAACTGAGGGAGCCGGCTCCGG - Intergenic
921396439 1:214673545-214673567 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
921762814 1:218936905-218936927 CCAGCAGAGCTACCAGGCTCTGG + Intergenic
921897048 1:220412393-220412415 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
921983731 1:221286053-221286075 CAAGCTGAGGGAGCAGGCTCCGG + Intergenic
922056780 1:222049709-222049731 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
922166188 1:223117334-223117356 CAAGCAGAGGGATCCTGCTCCGG + Intronic
922307020 1:224352883-224352905 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
922485375 1:225969731-225969753 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
922541962 1:226426689-226426711 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
922546805 1:226464159-226464181 CAAGCAGAGGGAGCCGGTTCCGG - Intergenic
922855742 1:228773667-228773689 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
922937411 1:229432951-229432973 TCCGCAGAGGGAGCCGGCTCGGG - Intronic
922985828 1:229865420-229865442 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
923161336 1:231317422-231317444 GAAGCAGAGGGAGCCGGCTCCGG - Intergenic
923172645 1:231431172-231431194 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
923193497 1:231642304-231642326 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
923353132 1:233129085-233129107 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
923573761 1:235140248-235140270 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
923810360 1:237308784-237308806 CCAGCAGAGGCAACCTGCTCAGG - Intronic
923930128 1:238685029-238685051 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
924034840 1:239925167-239925189 CAAGCAGAGGGAGCTGGCTGCGG + Intergenic
924117470 1:240762452-240762474 TAAGCTGAGGGAGCCGGCTCCGG - Intergenic
924774209 1:247104322-247104344 CTAACAGGAAGAGCCGGCTCCGG + Exonic
924946705 1:248851345-248851367 CAAGCAGGGAGTGCAGGCTCAGG - Intronic
1063149005 10:3320226-3320248 CAAGCCGAGGGAGCCGGCTCCGG + Intergenic
1063158943 10:3405416-3405438 GCCGCAGAGTGAGCCTGCTCAGG - Intergenic
1063300441 10:4845314-4845336 CAAGCTGAGGGAGCCGACTCCGG + Intronic
1063318782 10:5032916-5032938 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1063759427 10:9056711-9056733 CGAGCAGAGGGAGCCCGCTCTGG - Intergenic
1063769643 10:9183311-9183333 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1064252556 10:13718082-13718104 CCAGCAGGATGGGCCGGCTCTGG - Intronic
1064460978 10:15534931-15534953 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1064694412 10:17950942-17950964 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1064862759 10:19845696-19845718 TCAGCAGAGAGAAGCAGCTCAGG + Intronic
1065462416 10:25982647-25982669 CCAGCAGAGCTACCAGGCTCTGG - Intronic
1065554857 10:26905508-26905530 CAAGCAGAGGGAGCCAGCTCCGG - Intergenic
1065590264 10:27256427-27256449 CAAGCAGAGGGAGCTGGCTCAGG - Intergenic
1065743324 10:28816073-28816095 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1065752215 10:28897175-28897197 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1065895848 10:30162816-30162838 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1065965886 10:30769818-30769840 CAAGCAGAGGGAGCTGGCTCCGG + Intergenic
1065981618 10:30903196-30903218 CAAGCCAAGGGAGCCGGCTCCGG + Intronic
1065983901 10:30930438-30930460 CAAGCAGAGGGAGCCGGCTCTGG + Intronic
1066235518 10:33480863-33480885 CAAGCTGAGGGAGACGGCTCCGG + Intergenic
1066296052 10:34055516-34055538 CAAGCTTAGGGAGCCGGCTCCGG - Intergenic
1066568650 10:36748275-36748297 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
1066648457 10:37634432-37634454 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
1067061867 10:43081790-43081812 ACAGCAGCCAGGGCCGGCTCAGG + Intronic
1067461419 10:46461232-46461254 CCAGCAGACATCTCCGGCTCTGG + Exonic
1067625775 10:47923369-47923391 CCAGCAGACATCTCCGGCTCTGG - Intergenic
1068114767 10:52724622-52724644 CCAGCGGAGCTACCCGGCTCTGG - Intergenic
1068211285 10:53924144-53924166 CAAGCAGAGGGAGCTGGCTCCGG - Intronic
1068373971 10:56155084-56155106 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1068460325 10:57321482-57321504 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1068461657 10:57337105-57337127 CGAGCAGAGGGAGCCGGTTCTGG + Intergenic
1068821016 10:61377269-61377291 CAAGCAGAGGGAGCCAGCTCTGG + Intergenic
1069186574 10:65429815-65429837 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1069526183 10:69174073-69174095 CCAGCAGCGGCAACCGGCTCGGG + Intergenic
1069710725 10:70486863-70486885 CCAGCAGACAGGGCTGCCTCGGG - Intronic
1069988627 10:72300570-72300592 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1070564116 10:77590586-77590608 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1070895703 10:79981880-79981902 CTAGCAGGAAGAGGCGGCTCAGG - Intronic
1070942606 10:80359884-80359906 CCTGCAAGCAGAGCCGGCTCCGG + Intronic
1070968266 10:80543230-80543252 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1070973337 10:80585839-80585861 CAAGCTGAAGGAGCCGGCTCTGG - Intronic
1071055656 10:81505788-81505810 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1071085403 10:81863076-81863098 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1071332137 10:84571162-84571184 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1071387956 10:85141361-85141383 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1072278449 10:93845150-93845172 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1072341894 10:94459896-94459918 CAAGTAGAGGGAGCCAGCTCTGG + Intronic
1072769192 10:98123611-98123633 CCAGCAGAGCTACCAGGCTCTGG + Intergenic
1073179290 10:101574210-101574232 CCGGCAGGGAGAGCCGATTCCGG + Intronic
1073262542 10:102201267-102201289 CAAGCAGAGGGAGCTGGCTTCGG + Intergenic
1073532465 10:104245136-104245158 CAAGCTGAGGGAGCCCGCTCCGG - Intronic
1073789818 10:106928492-106928514 CAAGCTGAGGGAGCCAGCTCTGG + Intronic
1073878267 10:107950541-107950563 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1073970310 10:109040713-109040735 TGAGCAGAAAGAGCTGGCTCTGG - Intergenic
1073971359 10:109047969-109047991 CGAGCAGAGGGAGCTGGCTTTGG - Intergenic
1074098078 10:110331413-110331435 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
1074314541 10:112349706-112349728 CAAGCAGAGGGAGCTGGTTCCGG - Intergenic
1074317094 10:112370273-112370295 CAAGCTGAGGGAGCGGGCTCAGG - Intergenic
1074996399 10:118760546-118760568 CAAGCTGAGGGTGCCGGCTCCGG + Intergenic
1075255571 10:120923786-120923808 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1075307582 10:121382124-121382146 CAAGCTGAGGGAGCCGGCTTTGG - Intergenic
1075376072 10:121978777-121978799 CAGGCTGAGAGAGCCGGCTCTGG + Intergenic
1075537578 10:123283751-123283773 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1076107013 10:127831714-127831736 CCAGAAGCCAGAGCCCGCTCAGG + Intergenic
1076261711 10:129071750-129071772 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1076796585 10:132801335-132801357 CAAGCTGAGGGAGTCGGCTCTGG + Intergenic
1077055927 11:593116-593138 ACAGCTGAGAGCGCCTGCTCTGG + Intronic
1077342197 11:2031126-2031148 CCAGCAGAAAGCGCTGGCTGAGG + Intergenic
1077778253 11:5294788-5294810 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1077805712 11:5589841-5589863 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1077815565 11:5682909-5682931 CAAGCTGAGGGAGCCAGCTCCGG - Intronic
1078795776 11:14591031-14591053 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1079555474 11:21753516-21753538 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1079708721 11:23653547-23653569 CAAGCTGAGGGAGCCCGCTCCGG + Intergenic
1079756848 11:24274638-24274660 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
1079803122 11:24896250-24896272 CAAGCAGAGGGAGCTGGCTCCGG - Intronic
1080138813 11:28890704-28890726 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1080223482 11:29934175-29934197 CAAGCAGAGGGAGCTGGCTCTGG - Intergenic
1080503133 11:32888567-32888589 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1081046454 11:38278999-38279021 TGAGCAGAGGGAGCTGGCTCCGG + Intergenic
1081106619 11:39078575-39078597 AGAGCAGAGGGAGTCGGCTCTGG - Intergenic
1081115381 11:39192954-39192976 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1081326689 11:41754086-41754108 CCAGCAGAGCTACCAGGCTCTGG + Intergenic
1081329762 11:41788625-41788647 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1081420846 11:42873881-42873903 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1081422021 11:42881345-42881367 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1082106684 11:48228871-48228893 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
1082272067 11:50183234-50183256 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1082734867 11:56845145-56845167 TAAGCAGAGGGAGCTGGCTCTGG - Intergenic
1082889096 11:58119237-58119259 CCAGCAGGGAGAGGTGGCTCAGG + Exonic
1082912374 11:58390970-58390992 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1083074343 11:60020615-60020637 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1084024795 11:66441132-66441154 CAAGCTGAGGGAGCCGGCCCCGG + Intronic
1084095407 11:66907971-66907993 CCAGGAGAGAGAGGCTGCTTGGG + Intronic
1084186601 11:67476054-67476076 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
1084210407 11:67619001-67619023 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1084496744 11:69509646-69509668 CCTGCAGAGAGAGCCAGGCCTGG - Intergenic
1084840718 11:71844011-71844033 CGAGCAGAGGGAGCCAGCTCCGG + Intergenic
1085245555 11:75098169-75098191 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1085375835 11:76060526-76060548 CAAGCTGAAGGAGCCGGCTCCGG - Intronic
1085671127 11:78465301-78465323 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1085687643 11:78638809-78638831 CAAGCAGAGGGAGGCAGCTCCGG - Intergenic
1085692628 11:78676184-78676206 CCAGCGCAAAGAGCAGGCTCGGG - Exonic
1085863076 11:80257524-80257546 CAAGCTGAGGGAGCCGGCTTTGG - Intergenic
1085982850 11:81744925-81744947 CAAGCAGAGGGAGCCAGCTCCGG + Intergenic
1086034856 11:82403863-82403885 GCAACTGAGGGAGCCGGCTCCGG - Intergenic
1086042982 11:82501121-82501143 CAAGCTGAGGGAGCAGGCTCTGG - Intergenic
1086087512 11:82970635-82970657 CAAGCCCAGGGAGCCGGCTCCGG - Intergenic
1086210168 11:84308934-84308956 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1086338955 11:85827483-85827505 CCAGCAGAGAGAACAGCCCCTGG - Intergenic
1086397797 11:86433920-86433942 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
1087318814 11:96635790-96635812 CAAGCAGAGGGAGCTGGCTCCGG - Intergenic
1087400956 11:97667044-97667066 CAAGCAGAGGGAGCCAGCTCCGG - Intergenic
1087404802 11:97717559-97717581 CCAGCAGCGGCAGCCCGCTCAGG - Intergenic
1087404927 11:97718134-97718156 CGAGCAGAGGGAGCCGGCTCCGG + Intergenic
1087407359 11:97746014-97746036 CAAGCCGAGAGAGCCATCTCCGG + Intergenic
1087441231 11:98185617-98185639 GAAGCAGAGGGAGCGGGCTCTGG + Intergenic
1087682391 11:101231734-101231756 CAAGCAGAGGGAGCTGGCTCTGG + Intergenic
1087683846 11:101241648-101241670 CAAGCAGAGGGAGCTGGCTCCGG + Intergenic
1087962288 11:104366607-104366629 CGAGGAGAGGGAGCGGGCTCCGG + Intergenic
1087977312 11:104565333-104565355 CAAGCAGAGGGAGCCGGGTCCGG + Intergenic
1088250550 11:107858136-107858158 CAGGAAGAGAGAGCCGGCTCTGG + Intronic
1088570828 11:111221940-111221962 CAAGCTGAGAGAGCCGGCTCCGG - Intergenic
1088843831 11:113648727-113648749 CCAGCAGAGGCAACCTGCTCAGG - Intergenic
1088844014 11:113649712-113649734 CAAGCAGAGGGAGCTGGTTCTGG + Intergenic
1089244783 11:117110849-117110871 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1089666811 11:120025860-120025882 CAAGCCGAGGGAGCCGGCTTCGG - Intergenic
1089800190 11:121021621-121021643 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1089954419 11:122556771-122556793 CCAGCAGAGGGAGCCGGCTTCGG - Intergenic
1090133605 11:124171096-124171118 CAAGCTGAGGGAGGCGGCTCCGG + Intergenic
1090229175 11:125089459-125089481 CAAGCTGAGGGAGCCTGCTCTGG - Intronic
1090558190 11:127898966-127898988 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
1090588210 11:128237052-128237074 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1090776773 11:129972219-129972241 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
1090782675 11:130021634-130021656 CAAGCTGAGGGAGCGGGCTCCGG - Intergenic
1091201165 11:133782311-133782333 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1091233506 11:134003261-134003283 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1202825183 11_KI270721v1_random:86315-86337 CCAGCAGAAAGCGCTGGCTGAGG + Intergenic
1091402291 12:188473-188495 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1091451596 12:575597-575619 GCAGCAGAAGGAGCCGTCTCAGG - Intronic
1091646076 12:2273474-2273496 CCCACAGAAAGAGCCGGCTCTGG - Intronic
1092101736 12:5889246-5889268 CAAGCTGAGGGAGCCGACTCCGG + Intronic
1092137381 12:6159438-6159460 CAAGCTGAAGGAGCCGGCTCCGG - Intergenic
1092142155 12:6191269-6191291 CAAGCTGAAGGAGCCGGCTCCGG + Intergenic
1092350570 12:7752459-7752481 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1092366498 12:7881242-7881264 CAAGCTGAGGGAGCTGGCTCCGG - Intronic
1092471719 12:8787228-8787250 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1092472912 12:8794685-8794707 GAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1092545905 12:9450783-9450805 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1092572477 12:9739976-9739998 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1092583858 12:9876439-9876461 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1092732421 12:11547254-11547276 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1093034441 12:14320056-14320078 CAAGCTAAGGGAGCCGGCTCCGG - Intergenic
1093189347 12:16057344-16057366 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1093266226 12:17007586-17007608 CAAGCTGAGGGAGCCTGCTCCGG - Intergenic
1093381514 12:18500109-18500131 CAAGCTGAGGGAGCCAGCTCCGG - Intronic
1093524824 12:20093662-20093684 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1093527138 12:20115628-20115650 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1093580200 12:20777810-20777832 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1093583318 12:20807828-20807850 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1093683422 12:22029691-22029713 CCAGCATGGAGATCCGGCTGTGG - Intergenic
1093715465 12:22376866-22376888 CAGGCTGAGGGAGCCGGCTCCGG - Intronic
1093741427 12:22693452-22693474 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
1093793669 12:23285907-23285929 CAAGCTGAGGGGGCCGGCTCCGG - Intergenic
1093970168 12:25369335-25369357 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1094108739 12:26839140-26839162 CAAGCAGAGGGAGCTGGCTCCGG - Intergenic
1094338662 12:29386639-29386661 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1094405407 12:30110847-30110869 CAAGCTGAGGGAGCAGGCTCTGG + Intergenic
1094409785 12:30156833-30156855 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1094507051 12:31071290-31071312 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1094652452 12:32391097-32391119 AGAGCAGAGGGAGCCGGCTCAGG + Intergenic
1094718243 12:33034330-33034352 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
1094722015 12:33075309-33075331 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1095533928 12:43224284-43224306 CAAGCTGAGGGAGCCGGCTGCGG - Intergenic
1095776654 12:46017981-46018003 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1095901492 12:47333346-47333368 CAAGCTGAGAGAGCAGGCTCCGG - Intergenic
1097017976 12:56000542-56000564 CAAGCTGAGGGAGCCGACTCTGG + Intronic
1097490893 12:60269703-60269725 CAAGCAGAGGGAGCTGGCTCCGG - Intergenic
1097981964 12:65744321-65744343 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1098168269 12:67719630-67719652 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1098515941 12:71376819-71376841 GAAGCCGAGGGAGCCGGCTCCGG - Intronic
1098852319 12:75611452-75611474 CCAGCAGAGCTACCAGGCTCTGG - Intergenic
1099190251 12:79554403-79554425 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1099191344 12:79564930-79564952 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
1099192396 12:79573880-79573902 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1099204298 12:79710899-79710921 CAAGCCGAGGGAGCGGGCTCCGG - Intergenic
1099450608 12:82802345-82802367 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1099478622 12:83140081-83140103 CAAGCAGAGGGAGCCAGCTCTGG - Intergenic
1099716276 12:86296791-86296813 CAAGCTGAGGGAGCCGGTTCTGG + Intronic
1100078868 12:90824024-90824046 CGAGCAGAGGGAGCCGGCTCCGG - Intergenic
1100211935 12:92406917-92406939 CAAGCTGAGGGAGCCGGCTGCGG + Intergenic
1100600593 12:96108866-96108888 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1100605987 12:96152497-96152519 CCAGCAGAGAAACCCTTCTCGGG + Intergenic
1100734497 12:97512372-97512394 CCAGCAGTGTTAACCGGCTCGGG - Intergenic
1100734671 12:97513136-97513158 CAAGCTGAGGGGGCCGGCTCTGG + Intergenic
1102136915 12:110583090-110583112 GCTGAGGAGAGAGCCGGCTCCGG - Exonic
1102387286 12:112520288-112520310 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1102903976 12:116660687-116660709 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1103146198 12:118597574-118597596 CAAGCTGAGGGAGCCGGCTGTGG + Intergenic
1103238807 12:119397267-119397289 CCAGTAGAGGCAACCGGCTCAGG - Intronic
1103439081 12:120949852-120949874 CCAGCAGTGGCAGCCCGCTCGGG - Intergenic
1103492222 12:121330654-121330676 CCAGCACATAAAGCCAGCTCTGG + Exonic
1103497511 12:121374426-121374448 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1103668493 12:122591986-122592008 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1103678764 12:122676996-122677018 CAAGCTGAGGGAGCGGGCTCCGG + Intergenic
1103783450 12:123414512-123414534 CAAGCTGAGGGAGCGGGCTCCGG + Exonic
1103853239 12:123946907-123946929 CAAGCTGAGGGAGCGGGCTCCGG - Intronic
1103935038 12:124471109-124471131 CCAGCAGTGAGACCCGGTCCTGG - Intronic
1104803667 12:131571482-131571504 GCAGCTGAGCGAGGCGGCTCCGG + Intergenic
1104911824 12:132243428-132243450 CCACCAGAGAGAGAGAGCTCCGG - Intronic
1105015171 12:132782156-132782178 GCAGCCGAGAGAACAGGCTCAGG - Intronic
1105237207 13:18568113-18568135 AGAGCAGAGGGAGCCGGCTCAGG + Intergenic
1105425595 13:20292378-20292400 CAAGCTGAAGGAGCCGGCTCCGG - Intergenic
1105431854 13:20344100-20344122 CCAGCAGTGACAACCCGCTCAGG + Intergenic
1105477435 13:20740327-20740349 CAAGCGGAGGGAGCCGGCTTCGG + Intronic
1105593840 13:21817909-21817931 CAAGCAGAGGGAGCCGGCTACGG - Intergenic
1105697269 13:22900803-22900825 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
1105701584 13:22939036-22939058 CAAGCAGAGGGAGCTGGCTCTGG + Intergenic
1105723871 13:23142110-23142132 CAAGCAGGGGGAGCCAGCTCCGG - Intergenic
1105763100 13:23531515-23531537 CAAACAGAGGGAGCCGGCTCTGG - Intergenic
1105851269 13:24338860-24338882 CGAGCAGAGGGACCCGGCCCCGG - Intergenic
1105871186 13:24507187-24507209 CAAGCTGAAGGAGCCGGCTCCGG + Intronic
1105876735 13:24561104-24561126 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1106162249 13:27212127-27212149 GGAGCAGAGGGAGCCAGCTCTGG - Intergenic
1106163328 13:27219725-27219747 CAAGCAGAGAGAGCTGGCTCCGG - Intergenic
1106600599 13:31183407-31183429 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1106840596 13:33682070-33682092 CAAGCAGAGGGAGCCGGCTGCGG - Intergenic
1107590515 13:41898978-41899000 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1107652536 13:42559732-42559754 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1107836060 13:44413537-44413559 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1108435290 13:50396556-50396578 CAAGCTGAGGGAGCCAGCTCTGG - Intronic
1108469505 13:50753704-50753726 CAAGCTGAGGGAGCCAGCTCAGG + Intronic
1108685511 13:52815615-52815637 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1108817762 13:54313038-54313060 GGAACAGAGGGAGCCGGCTCTGG - Intergenic
1108845621 13:54676549-54676571 CAAGCAGAGGGAGCCTACTCTGG - Intergenic
1108859010 13:54829899-54829921 CAAGCTGAGGGAGCGGGCTCCGG + Intergenic
1108991186 13:56659508-56659530 CAAACAGAGGGAGCTGGCTCTGG + Intergenic
1108995964 13:56735571-56735593 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1109007698 13:56900664-56900686 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
1109037773 13:57287005-57287027 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1109111067 13:58318934-58318956 CAAACTGAGGGAGCCGGCTCCGG + Intergenic
1109124748 13:58504625-58504647 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1109124971 13:58505819-58505841 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
1109140993 13:58714045-58714067 CCAGCTGAGGGAGTGGGCTCCGG - Intergenic
1109145360 13:58773279-58773301 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1109149286 13:58823964-58823986 CGAGCAGAGGGACCCGGCTCCGG + Intergenic
1109159923 13:58958581-58958603 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1109364581 13:61339128-61339150 CAAGCGGAGGGAGCCGGCTCCGG - Intergenic
1109429414 13:62212458-62212480 CCAGCAGAGGGAGCTGGTTCCGG + Intergenic
1109506102 13:63305709-63305731 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1109563210 13:64077893-64077915 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1109638138 13:65149956-65149978 CAAGCAGAGGGAGCTGGCTCCGG + Intergenic
1109699650 13:66009345-66009367 CAAGCTGAGGGAGCCTGCTCCGG - Intergenic
1109741486 13:66561027-66561049 CAAGCTGAGGCAGCCGGCTCCGG - Intronic
1109829995 13:67773316-67773338 CAAGCAGAGGGAGCCAGCTCCGG + Intergenic
1109854352 13:68108114-68108136 CAAGCCGAGGGAGCCGGCTCTGG + Intergenic
1109858778 13:68170941-68170963 CAAGCTGAGGGAGCCGGCTTTGG - Intergenic
1109884334 13:68523904-68523926 CAAGCAGAGGGAGCAGGCTCTGG - Intergenic
1110024119 13:70512304-70512326 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1110344074 13:74426116-74426138 CAAGCTGAGGGAGCAGGCTCCGG + Intergenic
1110440146 13:75518515-75518537 CAAGCAGAGGGAGCTGGCTCCGG - Intergenic
1110497812 13:76190066-76190088 CAAGCAGAGGGAGCTGGCTCTGG - Intergenic
1110609867 13:77475853-77475875 CAAGCTGAGGGAGCCGCCTCCGG + Intergenic
1110792445 13:79600557-79600579 CAAGCTGAGGGAGCGGGCTCCGG + Intergenic
1110854252 13:80279017-80279039 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1110862084 13:80355508-80355530 CAAGCTGAGAGAGCCGGCTCTGG - Intergenic
1110913981 13:80998826-80998848 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1110940352 13:81341169-81341191 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1111148558 13:84217274-84217296 CCAGCAGAGCTACCAGGCTCTGG - Intergenic
1111160871 13:84393610-84393632 CCAGCAGAGCTAGCAGGCTCTGG + Intergenic
1111197597 13:84894928-84894950 CCAGCAGAGGGAGCCAGCTCTGG + Intergenic
1111220859 13:85204875-85204897 CAAGCAGAGGGAGCCGGTGCCGG - Intergenic
1111333520 13:86792227-86792249 CCAGCAGAGGGAGCCAGCTCTGG - Intergenic
1111441856 13:88291782-88291804 CAAGCTGAGGGAGCCGGCTCAGG - Intergenic
1111445952 13:88345832-88345854 CAAGCGGAGGGAGCCGGCTCTGG + Intergenic
1111590974 13:90348562-90348584 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1111602680 13:90494781-90494803 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1111602867 13:90495714-90495736 CCAGCAGTGGCAACCGGCTCGGG + Intergenic
1111841224 13:93453886-93453908 CCAGCAGTGGCAGCCCGCTCAGG - Intronic
1111841466 13:93455184-93455206 CAATCTGAGGGAGCCGGCTCCGG + Intronic
1112002309 13:95222233-95222255 CTAGCAGAGAGACTGGGCTCTGG + Intronic
1112077809 13:95931835-95931857 CAAGCAGAGGGAGCCGGCTCCGG + Intronic
1112538228 13:100282408-100282430 CAAGCTGAGAGAGCCGGCTCTGG - Intronic
1112613047 13:100975658-100975680 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1112842651 13:103599943-103599965 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1113330228 13:109319459-109319481 CAAGCAGAGGGAGCTGGCTCCGG + Intergenic
1113378181 13:109783138-109783160 CCAGCAGCGACAGCCGGCAGCGG - Exonic
1113561731 13:111286893-111286915 CAGGGAGAGAGAGCCAGCTCTGG + Intronic
1113680216 13:112238656-112238678 CAAGCAGAGGGAGCCAGCTCCGG - Intergenic
1114155489 14:20099148-20099170 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
1114270046 14:21095077-21095099 TCAGCAGAGAGAAAAGGCTCTGG + Intronic
1114485247 14:23057924-23057946 ACTGCGGAGAGACCCGGCTCCGG + Intergenic
1114566315 14:23635763-23635785 CGAGCAGAGGGAGCTGGCTTCGG - Intronic
1114608263 14:24015866-24015888 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
1114957706 14:27845321-27845343 CAAGCAGAAGGAGCCGGCTCCGG - Intergenic
1115268682 14:31527484-31527506 CAAGCTGAGGGAGCCGGCTCAGG + Intronic
1115284952 14:31705993-31706015 CAAGCAGAGGGAGTCAGCTCTGG + Intronic
1115285920 14:31712531-31712553 CGAGCAGAGGGAGCCAGCTCCGG + Intronic
1115376447 14:32682150-32682172 ACAGCAGAGAGAGAGGGCTCTGG + Intronic
1115533280 14:34346198-34346220 CAAGCAGAGGGAGCCAGCTCTGG + Intronic
1116114546 14:40630037-40630059 CAAGCTGAGAGAAGCGGCTCTGG + Intergenic
1116152177 14:41154637-41154659 CAAGCAGAGGGAGCCGGCTTCGG + Intergenic
1116223239 14:42113863-42113885 CAAGCCGAGGGAGCCGGCTCCGG + Intergenic
1116297954 14:43136327-43136349 CAAGCAGAGGGAGCTGGCTCCGG + Intergenic
1116310959 14:43326566-43326588 CAAGCAGAGGGAGCCAGCTCTGG - Intergenic
1116325755 14:43532990-43533012 CAAGCAGAGGGAGCCAGTTCCGG - Intergenic
1116426473 14:44798551-44798573 CAAGCTGTGGGAGCCGGCTCCGG - Intergenic
1116437548 14:44912131-44912153 CGAGGAGAGGGAGCCGGCTGCGG - Intergenic
1116452308 14:45080398-45080420 CAAGCTGAGAGAGCCGGCTCCGG - Intergenic
1116594330 14:46820396-46820418 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
1116900915 14:50361917-50361939 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1117297776 14:54394750-54394772 CAAGCAGAGGGAGCCAGCTCTGG + Intergenic
1117302279 14:54441362-54441384 CCAGCGGAGAAAGGCGGCGCAGG + Exonic
1117302459 14:54443013-54443035 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1117449769 14:55839470-55839492 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1117565589 14:56991028-56991050 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1117837295 14:59819942-59819964 CAAGCAGAGGGAGCCGGCTCTGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118306281 14:64658140-64658162 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1118496783 14:66315327-66315349 CCAGCTGAGAGAGCTGCCTGTGG + Intergenic
1118558956 14:67057078-67057100 CAAGCAGAGGGAGCCGGCTCTGG + Intronic
1118932318 14:70254682-70254704 CAAGCTGAGCGAGCCGGCTCCGG - Intergenic
1119027733 14:71167501-71167523 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1119038787 14:71254257-71254279 CAAGCTGAGGGAGCGGGCTCCGG - Intergenic
1119300368 14:73566732-73566754 CAAGCTGAGGGAGACGGCTCCGG + Intergenic
1119695105 14:76707065-76707087 CAAGCAAAGGGTGCCGGCTCCGG + Intergenic
1120209922 14:81624164-81624186 CAAGCCGAGGGAGCCAGCTCCGG + Intergenic
1120215792 14:81679571-81679593 CAGGCTGAGGGAGCCGGCTCTGG + Intergenic
1120229815 14:81829847-81829869 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1120387651 14:83866278-83866300 CCAGCAGTGGCAGCCTGCTCGGG + Intergenic
1120400266 14:84022583-84022605 CCAGCAGAGCTACCAGGCTCTGG + Intergenic
1120439161 14:84513307-84513329 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1120632360 14:86905829-86905851 CAGGCTGAGGGAGCCGGCTCCGG + Exonic
1120704828 14:87735159-87735181 CAAGCCGAGGGAGCTGGCTCCGG + Intergenic
1120953816 14:90064057-90064079 CCAGCAGATAGTGTGGGCTCAGG - Intronic
1121439566 14:93940179-93940201 CCCCCAGAGAGAGCAGGGTCTGG - Intronic
1121743981 14:96273724-96273746 CCAGGAGAGGGAGGCTGCTCTGG - Intergenic
1122434931 14:101689043-101689065 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
1122514480 14:102297623-102297645 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1122829480 14:104388821-104388843 CCAGCATAGTGAGCCAGCGCCGG - Intergenic
1122836671 14:104434044-104434066 TCTGCAGACAGAGCGGGCTCAGG + Intergenic
1122894870 14:104751884-104751906 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1123051831 14:105547792-105547814 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
1123697270 15:22887915-22887937 ACAGCACACAGAGCCGGCTCTGG + Intronic
1123949186 15:25253592-25253614 CAAGCTGAGGGAGCAGGCTCCGG + Intergenic
1124023513 15:25944565-25944587 CCAGCAGAGGGAGCCCACTCGGG + Intergenic
1124036322 15:26056874-26056896 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1124114911 15:26831578-26831600 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1124198627 15:27656802-27656824 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1124818520 15:33019873-33019895 CAAGCGGAGGGAGCCGGCTCCGG + Intronic
1125551133 15:40545672-40545694 CCAGCAGAGAGCACAGGCACTGG + Intronic
1125565804 15:40677326-40677348 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1125631551 15:41151640-41151662 CAAGCTGAGGGAGCCGGCTTCGG - Intergenic
1125885596 15:43226947-43226969 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1126088943 15:45034796-45034818 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1126128025 15:45314054-45314076 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1126165580 15:45651403-45651425 CAAGCAGAGGGAGCTGGCTCTGG + Intronic
1126639623 15:50811930-50811952 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
1126957526 15:53950758-53950780 TCAGCTGAGAGAGCAAGCTCAGG + Intergenic
1127211532 15:56779588-56779610 CAAGCCCAGGGAGCCGGCTCCGG - Intronic
1127766111 15:62186960-62186982 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1127768068 15:62207499-62207521 CGAGCAGAGGGAGAGGGCTCCGG - Intergenic
1127916387 15:63459026-63459048 CAAGCAGAGGGAGCTGGCTCCGG - Intergenic
1127984710 15:64060813-64060835 CAAGCTAAGGGAGCCGGCTCTGG - Intronic
1128141109 15:65301471-65301493 CAGGCTGAGGGAGCCGGCTCCGG + Intergenic
1128670027 15:69567755-69567777 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1128813357 15:70587564-70587586 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1129075800 15:72994969-72994991 CCAGCAGGGAAAGCAGGCCCTGG - Intergenic
1129158314 15:73732544-73732566 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1129208588 15:74052500-74052522 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1129374055 15:75116344-75116366 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1129586898 15:76876211-76876233 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1129670802 15:77606688-77606710 AAAGAGGAGAGAGCCGGCTCGGG - Intergenic
1129724441 15:77894371-77894393 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1129777550 15:78246537-78246559 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1129986852 15:79926075-79926097 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1129997103 15:80016484-80016506 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1130132810 15:81158584-81158606 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1130612282 15:85372278-85372300 CTAGCAGAGAGAGGAGCCTCTGG + Intergenic
1130982228 15:88820715-88820737 GGGGCAGAGAGAGCGGGCTCTGG - Intronic
1131005022 15:88970986-88971008 CAAGCAGAGAGAGCCGGCTCCGG + Intergenic
1131012753 15:89032052-89032074 CAAGCTGAGGGAGCCGGCTGCGG + Intergenic
1131212647 15:90510921-90510943 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1131250213 15:90825483-90825505 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1131472874 15:92711416-92711438 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1131846173 15:96492236-96492258 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1131892237 15:96984558-96984580 CAGGCTGAGGGAGCCGGCTCCGG + Intergenic
1131912538 15:97224209-97224231 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
1131969253 15:97875700-97875722 CCAGCAGAGGGAGCCGGCTCTGG - Intergenic
1131992429 15:98104622-98104644 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1132097660 15:99000011-99000033 CAAGCTGAGAGAGCTGGCGCTGG - Intronic
1132098914 15:99008634-99008656 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1132155877 15:99495007-99495029 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1132510968 16:341228-341250 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1132594269 16:741094-741116 TCAGCAGAGGGCGCCGGCCCCGG - Intronic
1132836876 16:1958599-1958621 CAAGCTGAGGGAGCCCGCTCTGG + Intergenic
1132863788 16:2083981-2084003 CCAGCAGCCAGGGCCGGCCCAGG - Intronic
1132945239 16:2528623-2528645 AGAGCAGAGAGGGCAGGCTCTGG - Exonic
1133171133 16:3983121-3983143 CCAGCAGGGACAGCTGGCTGGGG + Intronic
1133814314 16:9184560-9184582 CAAGCTGAGGGAGCCGGCTGCGG + Intergenic
1135280798 16:21152559-21152581 CAAGCTGAGGGAGCCGGCTTCGG - Intronic
1135338994 16:21630348-21630370 TGAGCAGAGGGAGCCGGCTCTGG + Intronic
1135470251 16:22723340-22723362 CAAGCTCAGGGAGCCGGCTCTGG + Intergenic
1135751120 16:25059309-25059331 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1136277198 16:29186024-29186046 CCCACAGAGAGAGCTGGCTTTGG + Intergenic
1137442462 16:48508664-48508686 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
1137518649 16:49172925-49172947 CCAGCAGAGAGGGCTGAATCAGG - Intergenic
1137617060 16:49854883-49854905 CCAGCACAGAAAGCCGGCCTGGG + Intronic
1137619475 16:49867035-49867057 GCAGCAGACAAAGGCGGCTCTGG + Intergenic
1137945658 16:52731380-52731402 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
1138014000 16:53412786-53412808 CTAGCAGAGGGAGCCGGCTGGGG - Intergenic
1138015201 16:53421445-53421467 CCAGCAGAGGGAGCCGGCTCTGG + Intergenic
1138105290 16:54284596-54284618 CCAGCAGGGAGAGCGGGTGCAGG + Exonic
1138168788 16:54829780-54829802 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1138396050 16:56705554-56705576 CCAGCAGGGAGGGCCTGCCCTGG + Intronic
1138556066 16:57771917-57771939 GCAGCAGGGAGAGCAGGCTCTGG - Intronic
1138688723 16:58748812-58748834 CAGGCTGAGGGAGCCGGCTCCGG - Intergenic
1138693655 16:58791184-58791206 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1138991122 16:62392221-62392243 CCAGGTGAGGGGGCCGGCTCAGG - Intergenic
1139011178 16:62636318-62636340 CGAGCAGAGAGAACCAGATCTGG + Intergenic
1139018971 16:62724833-62724855 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1139051433 16:63129596-63129618 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1139088572 16:63617533-63617555 CGAGCAGAGGGAGCCGGCTCCGG + Intergenic
1139125591 16:64072726-64072748 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1139147688 16:64343857-64343879 CAAGCTGAGGGAGCCGGCTTCGG - Intergenic
1139442261 16:66974242-66974264 CAAGCTGAGGGAGCTGGCTCCGG - Exonic
1139602997 16:67998177-67998199 CAAGCTGAGGGAGCTGGCTCTGG - Intronic
1139649895 16:68356948-68356970 GCAGCAGAGAGAAGCTGCTCAGG - Intronic
1139676376 16:68526710-68526732 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
1139919640 16:70451194-70451216 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1140722574 16:77784776-77784798 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1141435465 16:83997350-83997372 CAAGCAGGGAGAGCGGGGTCAGG - Intronic
1141465789 16:84204980-84205002 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1141523177 16:84594900-84594922 CCAGCAGAGAGGGCAGACGCTGG - Intronic
1142081577 16:88152068-88152090 CCCACAGAGAGAGCTGGCTTTGG + Intergenic
1142828859 17:2532495-2532517 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1142885893 17:2911917-2911939 CCAGCTGACCGAGCCAGCTCAGG - Intronic
1143128032 17:4656907-4656929 CAAGCTGAGGGTGCCGGCTCCGG + Intergenic
1143135312 17:4709439-4709461 CAAGCTGAGGGAACCGGCTCCGG + Intergenic
1143283310 17:5771206-5771228 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1143460549 17:7100926-7100948 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1143664327 17:8347518-8347540 CAAGCTGAGGGAGCCGACTCCGG + Intergenic
1143708709 17:8718466-8718488 CAAGCTGAGGGAGCCGTCTCCGG + Intergenic
1144128034 17:12220864-12220886 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1144804713 17:17956868-17956890 CAAGCTGAGGGAGGCGGCTCCGG + Intronic
1146740520 17:35279312-35279334 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1146902846 17:36599643-36599665 CCAACAGAGAGGGCCTTCTCAGG - Intronic
1146970703 17:37069490-37069512 CCAGCAAAGTGTGCGGGCTCCGG + Intergenic
1147134062 17:38425258-38425280 GCAGGAGAGAGAGCAGGCTCCGG - Intergenic
1147373572 17:40010895-40010917 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1147420253 17:40318898-40318920 CCACCAGAGGGAGCCGGCCGGGG + Intronic
1147805297 17:43126802-43126824 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
1148072682 17:44917183-44917205 CCAGCTCACAGAGCCAGCTCAGG + Intergenic
1148460769 17:47837963-47837985 CCAGCAGAAACAGCAGGATCTGG - Exonic
1148991204 17:51668735-51668757 CAAGCAGAGGGAGCTGGCTCTGG - Intronic
1149753929 17:59172486-59172508 CAAGCTGAGGGAGCTGGCTCCGG - Intronic
1149916338 17:60613576-60613598 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1149994651 17:61400173-61400195 CCCGATGAGAGAGCCGGCGCTGG + Exonic
1150682464 17:67294712-67294734 CAAGCTGAGGAAGCCGGCTCCGG - Intergenic
1150772232 17:68051835-68051857 CCAGCTGAAGGAGCCGGCTCTGG - Intergenic
1150775776 17:68080619-68080641 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1150786792 17:68169755-68169777 CAAGCTGAGAGAGTGGGCTCCGG + Intergenic
1150788213 17:68179810-68179832 CAGGCTGAGGGAGCCGGCTCCGG - Intergenic
1151025702 17:70673854-70673876 TCAGCAGGGAGAGAAGGCTCAGG + Intergenic
1151398180 17:73838836-73838858 CCAGGAGAGACAGCCAGCCCAGG - Intergenic
1151567514 17:74907440-74907462 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1151782728 17:76258047-76258069 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1151822841 17:76506433-76506455 CCAGCAGGGAGAGTCGGCAGCGG + Intergenic
1151840698 17:76615308-76615330 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1152195547 17:78916227-78916249 CCAGCAGAGCGATCCGGGACAGG - Intronic
1152324556 17:79627970-79627992 CCAGCAGAGAGAGGCAGCCCAGG - Intergenic
1152583599 17:81179596-81179618 CAGGCACACAGAGCCGGCTCTGG + Intergenic
1152619100 17:81352440-81352462 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1152663321 17:81552882-81552904 CCAGCGGAGTGAGCCAGCTTAGG + Intronic
1152684627 17:81687999-81688021 CCAGAGGAGCGAACCGGCTCAGG - Intronic
1152931748 17:83113579-83113601 CCGGCAGGGAGAACAGGCTCGGG - Intergenic
1153644111 18:7179064-7179086 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1154057297 18:11024044-11024066 CAAGCTGAGGGAGCTGGCTCCGG + Intronic
1154097647 18:11432689-11432711 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1154128807 18:11717302-11717324 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1154231480 18:12559485-12559507 CAAGCAGAGGGAGCCGGCTCCGG + Intronic
1154251180 18:12746461-12746483 CCAGCAGACACAGGAGGCTCGGG + Intergenic
1154255366 18:12777250-12777272 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1154294156 18:13135066-13135088 CAAGCACAGGGAGCCGGCTCCGG + Intergenic
1154943000 18:21132854-21132876 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1155003264 18:21706477-21706499 CAAGCAGAGGGAGCTGGCTCCGG - Intronic
1155272007 18:24149952-24149974 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1155806354 18:30175516-30175538 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1155976732 18:32139827-32139849 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1156079461 18:33316190-33316212 CAAGCTGAGGGAGCTGGCTCCGG - Intronic
1156119123 18:33820629-33820651 CGAGCAGAGGGAGCCGGCTCCGG + Intergenic
1156324731 18:36064211-36064233 AGAGCAGATGGAGCCGGCTCCGG - Intronic
1156651899 18:39235309-39235331 TGAGCAGAGGGAGCCAGCTCTGG - Intergenic
1156863610 18:41865719-41865741 CAAGCTGAGGGAGCCGGCTGTGG - Intergenic
1156943125 18:42795210-42795232 CAAGCTGAGAGAGTGGGCTCCGG - Intronic
1157661971 18:49453319-49453341 CCAGCAGTGGCAACCGGCTCAGG + Intronic
1157856947 18:51112203-51112225 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1157858422 18:51121316-51121338 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1157935231 18:51864765-51864787 CAAGCAGAGGGAGCTGGCTCCGG + Intergenic
1158282351 18:55841093-55841115 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1158351866 18:56572252-56572274 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1158377268 18:56884994-56885016 CCAGCAGAGCTACCGGGCTCTGG - Intronic
1158460779 18:57644012-57644034 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1158553830 18:58459353-58459375 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
1158597383 18:58828080-58828102 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1159109759 18:64042948-64042970 CAAGCAGAGGAAGCCAGCTCTGG - Intergenic
1159260539 18:66006353-66006375 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1159289268 18:66395784-66395806 CAAGCAGAGGGAGCTGGCTCGGG - Intergenic
1159346746 18:67215887-67215909 CTAGCAGAGGGAGCCGGCTCCGG + Intergenic
1159670258 18:71212876-71212898 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1159743908 18:72209087-72209109 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1160810624 19:1011499-1011521 CCTGCAGGGAGAGGCGGCGCCGG + Exonic
1162106949 19:8375722-8375744 CAAGCTGAGGGAGCCAGCTCCGG - Intronic
1162233167 19:9283853-9283875 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1162544843 19:11322711-11322733 GCAGCCGAGAGAGCTGCCTCAGG - Exonic
1162987058 19:14277598-14277620 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1163218798 19:15899645-15899667 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG + Intronic
1164270641 19:23668925-23668947 CAAGCTGAGGGAGTCGGCTCCGG + Intronic
1164995652 19:32719287-32719309 CCAGCAGAGCGAGGTGGCTCAGG - Intergenic
1165036337 19:33036601-33036623 GAAGCTGAGGGAGCCGGCTCGGG - Intronic
1165415583 19:35691458-35691480 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1165776039 19:38404942-38404964 CCAGCAGAGAGCGGAGGCACAGG - Exonic
1165831836 19:38734349-38734371 CCCCCAGAGAGATCGGGCTCAGG - Exonic
1166422919 19:42652570-42652592 CCTGCAGAGAGAGTGGCCTCAGG - Intronic
1166487064 19:43222329-43222351 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
1166733665 19:45072097-45072119 GCAGCATGGACAGCCGGCTCCGG + Exonic
1167468219 19:49661414-49661436 CCAGTACACAGAGCCTGCTCAGG - Intronic
1167528603 19:50000925-50000947 CCAGCAATGAGAAGCGGCTCTGG + Intronic
1167708098 19:51093778-51093800 AGAGCAGACAGGGCCGGCTCTGG - Intergenic
1168659832 19:58157262-58157284 CAAGCTGAGGGAGCAGGCTCCGG - Intergenic
924977525 2:191741-191763 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
925172658 2:1759709-1759731 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
925537860 2:4935712-4935734 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
925594905 2:5545242-5545264 ACAGCAGAGAGAGCAAGCACAGG - Intergenic
926083424 2:10006581-10006603 GGAGCAGAGGGAGCCGGCTCCGG + Intergenic
926131100 2:10303552-10303574 CCAGCAGGGACAGGGGGCTCTGG - Intronic
926437715 2:12854468-12854490 CAAGCAGAGGGAGCTGGCTGTGG + Intergenic
926474821 2:13308689-13308711 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
926616687 2:15002933-15002955 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
926685875 2:15697128-15697150 CAAGCCGAGGGAGCCGGCTCCGG + Intronic
926850618 2:17193516-17193538 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
927137405 2:20106926-20106948 CCAGCAGAGGGAGCCGTCTCCGG + Intergenic
927357032 2:22186305-22186327 CAAGCTGAGGGGGCCGGCTCCGG - Intergenic
927596541 2:24402822-24402844 CAAGCAGAGGGAGCCCGCTCCGG - Intergenic
927643556 2:24860806-24860828 GCAAGAGAGAGAGCGGGCTCAGG + Intronic
927900379 2:26814433-26814455 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
927942233 2:27111865-27111887 CAAGCTGAAGGAGCCGGCTCCGG + Intronic
928234562 2:29528424-29528446 CCAGCAGAAGCAGCCGGCTAGGG - Intronic
928493034 2:31803681-31803703 CAAGCTGAGGGAACCGGCTCCGG - Intergenic
928617992 2:33057825-33057847 CAAGCCGAGGGAGGCGGCTCCGG + Intronic
928688508 2:33775311-33775333 CAAGCAGAGGGAGCCAGCTTCGG - Intergenic
928723162 2:34142905-34142927 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
928793816 2:34992012-34992034 TGAGCAGAGGGAGCTGGCTCCGG - Intergenic
928880530 2:36092203-36092225 CAAGCTGAGGGAGCCGGCTCGGG - Intergenic
928936844 2:36688223-36688245 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
929070000 2:38020475-38020497 CAGGCTGAGGGAGCCGGCTCCGG - Intronic
929109823 2:38397273-38397295 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
929138066 2:38643459-38643481 CAAGCAGAGGGAGATGGCTCCGG + Intergenic
929379636 2:41335552-41335574 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
929725268 2:44419263-44419285 CCAGCAGAAAGAGCTGGCCAAGG - Intronic
929890927 2:45918072-45918094 CAACCTGAGGGAGCCGGCTCCGG + Intronic
930037963 2:47099694-47099716 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
930039159 2:47107242-47107264 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
930420933 2:51152018-51152040 CAAGCAGAGGGAGCAGGCTCCGG + Intergenic
930485454 2:52006761-52006783 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
930605293 2:53487067-53487089 CCAGCAGCGATAACCTGCTCTGG + Intergenic
931106923 2:59066890-59066912 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
931412126 2:62042621-62042643 CGAGCAGGGGGAGCCGGCTCTGG + Intronic
932178231 2:69622045-69622067 CAAGCTGAGGGAGCCAGCTCTGG - Intronic
932359570 2:71092885-71092907 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
932413886 2:71562441-71562463 TGATCAGAGAGAACCGGCTCTGG + Intronic
933049874 2:77590453-77590475 CAGGCTGAGGGAGCCGGCTCTGG - Intronic
933060889 2:77735153-77735175 CAAGCTGAGGGAGCCGGCTTCGG + Intergenic
933139755 2:78778954-78778976 TAAGCAGAGGGAGCCGGCTCCGG - Intergenic
933415774 2:81985137-81985159 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
933487309 2:82938843-82938865 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
933506278 2:83181005-83181027 CAAGCCGAGGGAGCTGGCTCTGG - Intergenic
933531588 2:83518132-83518154 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
933537847 2:83599619-83599641 CCAGCAGTGGCAACCGGCTCGGG - Intergenic
934479578 2:94622582-94622604 CAAGCAGAGGGAGCAGGCTCCGG + Intergenic
934583277 2:95465243-95465265 TCAGCAGAGGTAGCCAGCTCTGG - Intergenic
934596173 2:95611471-95611493 TCAGCAGAGGTAGCCAGCTCTGG + Intergenic
934786600 2:97014044-97014066 TCAGCAGAGGTAGCCAGCTCTGG - Intronic
934898443 2:98138965-98138987 CAAGCTGAGGGAGCCGACTCCGG - Intronic
935790261 2:106584381-106584403 CAAGCAGAGGGAGCTGACTCCGG - Intergenic
935866389 2:107392242-107392264 CAAGCGGAGGGAGCCAGCTCGGG - Intergenic
935872870 2:107469740-107469762 CAAACAGAGGGAGCTGGCTCCGG + Intergenic
935878409 2:107536487-107536509 CAAGCAGAGGGAGCTGGCTCCGG + Intergenic
935896908 2:107747737-107747759 CAAGCTGAGGGAGCCGGCTCAGG + Intergenic
935922506 2:108031525-108031547 CAAGCAGAGGAAGCCAGCTCTGG - Intergenic
936152377 2:110028802-110028824 CCAGCAGAGAGTGCCAGAGCTGG + Intergenic
936172750 2:110190591-110190613 CAAGCTGAGGGAGCTGGCTCCGG + Intronic
936192302 2:110342610-110342632 CCAGCAGAGAGTGCCAGAGCTGG - Intergenic
936347043 2:111682834-111682856 CCAGCAGTGGCAACCGGCTCGGG + Intergenic
936865459 2:117071971-117071993 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
937181086 2:119996945-119996967 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
937608249 2:123827142-123827164 CAAGCAGAGGGAGCCAGCTCAGG + Intergenic
937751476 2:125479555-125479577 CAAGCAGAGGGAGCCAGCTCCGG + Intergenic
938153184 2:128903917-128903939 CGAGCAGAGGGAGCCGGCTCCGG + Intergenic
938177228 2:129144638-129144660 CTAGCAGAGGGAGCCAACTCCGG + Intergenic
938315891 2:130327838-130327860 CCAGCAGAGGGAGCGGGCTCCGG - Intergenic
938374979 2:130799021-130799043 CCTGAAGTGGGAGCCGGCTCAGG + Intergenic
938512570 2:131966400-131966422 AGAGCAGAGGGAGCCGGCTCAGG - Intergenic
938726084 2:134109747-134109769 CAAGCTGAGGGAGCCGGCTTAGG + Intergenic
938728727 2:134129904-134129926 CAAGCAGAGGGAGCCGGCTGCGG - Intronic
938931253 2:136088421-136088443 CAGGCTGAGGGAGCCGGCTCCGG + Intergenic
939003087 2:136758423-136758445 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
939053270 2:137332005-137332027 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
939229704 2:139410303-139410325 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
939275261 2:139991097-139991119 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
939281705 2:140073758-140073780 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
939465075 2:142546023-142546045 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
939738834 2:145881309-145881331 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
939869006 2:147506883-147506905 CAAGCTGTGGGAGCCGGCTCTGG - Intergenic
940215053 2:151295972-151295994 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
940361989 2:152805214-152805236 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
940666758 2:156618458-156618480 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
941309194 2:163909484-163909506 CAAGCTGAGGGAGCCGGCCCTGG - Intergenic
941309734 2:163913574-163913596 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
941397986 2:164995155-164995177 CAAGCTGAGGGAGCCGGCTCGGG + Intergenic
941476644 2:165957466-165957488 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
942170307 2:173282986-173283008 CAAGCTCAGAGAGCCGGCTTCGG + Intergenic
942299646 2:174548945-174548967 CAAGCTTAGGGAGCCGGCTCCGG + Intergenic
942317651 2:174709966-174709988 CAAGCCGAGGGAGCCGGCTCTGG + Intergenic
942368714 2:175257401-175257423 CAAACAGAGGGAGCCGGCTCCGG + Intergenic
942540135 2:177007810-177007832 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
942867233 2:180691349-180691371 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
942903052 2:181145866-181145888 CGAGCAGAGGGAGCCGGCTCCGG + Intergenic
943024177 2:182608422-182608444 CAAGCTGAGGGAGCCGGCTTGGG - Intergenic
943106205 2:183547044-183547066 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
943166123 2:184328051-184328073 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
943222786 2:185132571-185132593 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
943365241 2:186962230-186962252 CAAGCAGAGGGAGCGGGCTCTGG - Intergenic
943449294 2:188028287-188028309 CCAGCAGAGCTACCAGGCTCTGG + Intergenic
943494806 2:188606792-188606814 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
943571503 2:189580754-189580776 GCGGCGGAGAGAGCTGGCTCAGG - Exonic
943680404 2:190761362-190761384 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
943835109 2:192507930-192507952 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
943942673 2:194020123-194020145 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
943954864 2:194176276-194176298 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
944055142 2:195515641-195515663 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
944055311 2:195516549-195516571 CCAGCAGTGACAACCGGCTGGGG + Intergenic
944058536 2:195547710-195547732 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
944228381 2:197370534-197370556 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
944252537 2:197591955-197591977 CAAGCCGAGGGAGCCGGCTCTGG + Intronic
944843185 2:203643225-203643247 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
944857984 2:203785974-203785996 CAAGCTGAGGGAGCCGGCACCGG + Intergenic
945069596 2:205977192-205977214 CGAGCTGAGGGAGCCGGCTCCGG - Intergenic
945103887 2:206289727-206289749 CCAGCTGAGGGAGCCGTCTGGGG - Intronic
945112957 2:206380895-206380917 CCTGCACAGAGAGAAGGCTCTGG + Intergenic
945302610 2:208228082-208228104 CAAGCAGAGGGAGCTGGCTCTGG + Intergenic
945401349 2:209387341-209387363 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
945451532 2:210000968-210000990 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
945575529 2:211524774-211524796 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
945664271 2:212721461-212721483 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
945744263 2:213701519-213701541 CAAGCAGAGGGAGCTGGCTCTGG - Intronic
945872884 2:215246131-215246153 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
945907942 2:215615284-215615306 CAAGCAGAGGGAGCTGGCTCCGG + Intergenic
945993572 2:216416725-216416747 CCAGCAGTGACAGGCAGCTCAGG + Intronic
946053944 2:216885211-216885233 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
946376454 2:219312782-219312804 CAATCTGAGGGAGCCGGCTCCGG - Intergenic
946929096 2:224655260-224655282 CAAGCAGAGGGTGCCAGCTCCGG - Intergenic
946982222 2:225229847-225229869 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
947026579 2:225744091-225744113 CAAGCTGAGGGAGCCGACTCCGG - Intergenic
947103745 2:226647969-226647991 CAAGCGGAGAGAGCCGGCTCTGG - Intergenic
947171868 2:227320589-227320611 CAAGCTGAGAGAGCCGGCTCTGG - Intergenic
947539409 2:230964648-230964670 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
947592735 2:231394851-231394873 CCAGCAGGGAGAGCCATCGCTGG - Intergenic
947739250 2:232477577-232477599 CCAGCCGAGTGAGGTGGCTCAGG - Intergenic
947938072 2:234024680-234024702 CAAGCCAAGGGAGCCGGCTCCGG + Intergenic
947961995 2:234247638-234247660 CAAGCAGAGGGAGCTGGCTCTGG - Intergenic
948421778 2:237864424-237864446 CCTGCAGAGAGAGCCACCCCGGG - Intronic
948464968 2:238147943-238147965 CCACCAGGTAGAGCCGGCCCCGG - Exonic
948553974 2:238794777-238794799 CCCACAGGGAGAGCCGGCTGTGG + Intergenic
948554003 2:238794907-238794929 CCCACAGGGAGAGCCGGCTGTGG + Intergenic
948649143 2:239428415-239428437 CCATCAGAGATAGCCGTGTCTGG + Intergenic
948762725 2:240202775-240202797 CTTGCAGAGGGAGCTGGCTCTGG + Intergenic
948820046 2:240538243-240538265 CAAGCAGAGGGAGCCGGCTCCGG - Intronic
1169630279 20:7622844-7622866 CAAGCAGAGGGAGCCAGCTCTGG + Intergenic
1169645396 20:7803914-7803936 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1169849143 20:10031643-10031665 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1170230917 20:14045181-14045203 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1170649453 20:18226727-18226749 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
1171010000 20:21504381-21504403 CCAGGAGTGAGAACAGGCTCCGG + Intergenic
1171038611 20:21739229-21739251 CCAGCAGAGCTACCAGGCTCTGG + Intergenic
1171123051 20:22582205-22582227 CCGGGAGAGGGCGCCGGCTCTGG + Exonic
1171217813 20:23364933-23364955 CCAGGAGAGAGAGCCAGCAATGG + Exonic
1172431911 20:34899201-34899223 CAAGCTGAGGGAGCCAGCTCCGG + Intronic
1173778906 20:45736819-45736841 CCAGCAGTGGCAACCGGCTCAGG + Intergenic
1173831454 20:46091813-46091835 AAAGCGGAGGGAGCCGGCTCCGG - Intergenic
1174092230 20:48058736-48058758 CAAGCAGAGGGAGCCAACTCCGG - Intergenic
1174162932 20:48564461-48564483 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1174343123 20:49910349-49910371 GCTGCTCAGAGAGCCGGCTCCGG + Intronic
1174373935 20:50112990-50113012 CCAGCAGACAGAGGCGGCGCGGG + Intronic
1174604442 20:51750743-51750765 CCAGCTAAGAGGGCTGGCTCCGG - Intronic
1175254101 20:57628763-57628785 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1176189331 20:63800525-63800547 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1176205822 20:63887632-63887654 CCACCAGAGACACCCGGCTCTGG - Intronic
1176299057 21:5090069-5090091 GCAGCATAGAGAGCCGGCCCAGG - Intergenic
1176663175 21:9659997-9660019 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1176663760 21:9664452-9664474 ACAGCAGAGGGAGCTGGCTGTGG + Intergenic
1176670995 21:9735501-9735523 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1176781192 21:13196395-13196417 AGAGCAGAGGGAGCCGGCTCAGG + Intergenic
1177182445 21:17757985-17758007 CAAGCTGAGGGAGTCGGCTCCGG + Intergenic
1177318678 21:19493571-19493593 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1177339624 21:19783015-19783037 CAAGCAAAGAGAGCTTGCTCAGG + Intergenic
1177565879 21:22819238-22819260 CAAGCTGAAGGAGCCGGCTCCGG + Intergenic
1177581013 21:23021728-23021750 CTAGCAGAGGGAGCGGGCTCCGG + Intergenic
1177637560 21:23806979-23807001 CAAGCTGAGGGGGCCGGCTCTGG - Intergenic
1177716016 21:24840481-24840503 CCAGCAGAGGGAGCCGGCTCAGG + Intergenic
1177795854 21:25778329-25778351 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1177978884 21:27885545-27885567 AGAGCAGAGGGAGCCGGCTCAGG + Intergenic
1178074128 21:29000138-29000160 CAAGCTGAGGGAGCGGGCTCCGG - Intergenic
1178082263 21:29077516-29077538 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1178259830 21:31088601-31088623 CCAGCAGAGGGAGCCGGCTCTGG + Intergenic
1178326949 21:31654157-31654179 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
1179449852 21:41461029-41461051 CCAGCAGAGTGAACCTGCTGGGG + Intergenic
1179622606 21:42627127-42627149 AGAGCAGAGAGAGCGCGCTCTGG - Intergenic
1179857968 21:44171879-44171901 GCAGCATAGAGAGCCGGCCCAGG + Intergenic
1180105870 21:45617685-45617707 GCAGCAGAGGGAGCTGGCCCGGG - Intergenic
1180741099 22:18053755-18053777 CAAGCTAAGGGAGCCGGCTCCGG + Intergenic
1180750145 22:18118972-18118994 CCAGAAGTGAGAGCAGGCTGGGG + Intronic
1181021860 22:20107738-20107760 CAAGCAGGGAGAGCTGGCCCTGG - Intronic
1181077712 22:20392755-20392777 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1181444530 22:22958776-22958798 CCAGCAGAGAGGGCGGACGCTGG - Intergenic
1181450600 22:23017417-23017439 CAAGCTGAGGGAGCCGGCTTCGG + Intergenic
1181851439 22:25752793-25752815 CAAGCAGAGGGAGCCGGCTCCGG - Intronic
1182145867 22:27996353-27996375 CCAGCAGAAAGAGCAGGGCCTGG + Intronic
1182338071 22:29598420-29598442 CAAGCTGAGGGAGCCGGTTCCGG + Intergenic
1182479333 22:30596823-30596845 CAGGCTGAGGGAGCCGGCTCCGG - Intronic
1183422175 22:37718238-37718260 CAAGCTGAGGGAGCCAGCTCCGG + Intronic
1183990307 22:41593488-41593510 CAAGCCGAGGGAGCCGGCGCCGG - Intergenic
1184218818 22:43085874-43085896 GCAGCAGAGTGGGCTGGCTCAGG + Intronic
1184485685 22:44777516-44777538 CCAACAGAGTGACCCTGCTCAGG - Intronic
1184584203 22:45436690-45436712 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1184906305 22:47488705-47488727 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1185229183 22:49670596-49670618 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
949133652 3:536162-536184 CCAGCAGAGGGAGCTGGCTCCGG + Intergenic
949258928 3:2083594-2083616 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
949281441 3:2352356-2352378 CAAGCAGAGGGAGCCGGTTCCGG - Intronic
949769937 3:7568560-7568582 CAAGCTAAGGGAGCCGGCTCCGG - Intronic
950068990 3:10136764-10136786 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
950203551 3:11061344-11061366 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
950418502 3:12882853-12882875 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
950458258 3:13105393-13105415 CCAGCAGACAGATGCCGCTCAGG + Intergenic
950470119 3:13179717-13179739 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
950600424 3:14029893-14029915 CAAGCTGAGGGAGCAGGCTCCGG + Intronic
950601178 3:14037160-14037182 CAAGCAGAGGGAGCCGGCTCTGG - Intronic
950929347 3:16773679-16773701 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
951184921 3:19702532-19702554 CAAGTAGAGGGAGCCGGCTCTGG - Intergenic
951734750 3:25851727-25851749 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
951951141 3:28200812-28200834 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
952011325 3:28903564-28903586 TAAGCAGAGGGAGCCAGCTCTGG + Intergenic
952058141 3:29473900-29473922 CAAGCTGAGGGAGCCAGCTCTGG + Intronic
952275193 3:31870083-31870105 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
952355338 3:32578716-32578738 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
952393662 3:32902756-32902778 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
952398184 3:32939645-32939667 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
952453647 3:33453411-33453433 CAAGCTGAGTGAGCTGGCTCTGG - Intergenic
952593582 3:34988326-34988348 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
952713265 3:36453307-36453329 CAAGCTGAGGGAGCTGGCTCCGG - Intronic
952730587 3:36633869-36633891 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
952795193 3:37232966-37232988 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
953002835 3:38951114-38951136 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
953096230 3:39779712-39779734 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
953381189 3:42474007-42474029 CCAGCAGGGAGAGCCTTCTTTGG + Intergenic
953422988 3:42769675-42769697 CAAGCTGAGGGAGCCAGCTCCGG - Intronic
954040958 3:47887168-47887190 CAAGCTGAGGGAGCTGGCTCTGG - Intronic
954089378 3:48272321-48272343 CCAGCCAAGGGAGCTGGCTCCGG + Intronic
954226242 3:49183014-49183036 CGAGCTGAGGGAGCCGTCTCGGG + Intronic
954620068 3:51990519-51990541 CGAACTGAGGGAGCCGGCTCTGG - Intergenic
955183297 3:56691842-56691864 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
956183992 3:66545052-66545074 CAAGCCGAGGGAGCCGGCTCTGG + Intergenic
956195689 3:66651533-66651555 CAAGCTGAGGGAGCCGGCTTTGG - Intergenic
956392237 3:68785664-68785686 CAAGCTGAGGGAGACGGCTCCGG + Intronic
956438776 3:69260229-69260251 CAAGCAGAGGGAGCCAGCTCTGG - Intronic
956563585 3:70611818-70611840 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
956632555 3:71331096-71331118 CAAGCTGAGGGAGCCGTCTCCGG - Intronic
957002313 3:74900332-74900354 CAAGCTGAGGGAGCCGGCTTCGG + Intergenic
957009236 3:74985524-74985546 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
957277414 3:78108352-78108374 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
957386398 3:79502219-79502241 CAAGCTGAGGGAGCGGGCTCTGG - Intronic
957419723 3:79951769-79951791 CAAGCTGAGCGAGCTGGCTCTGG + Intergenic
957556350 3:81767785-81767807 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
957560210 3:81812381-81812403 CAAGCTGAGGGAGCCGTCTCCGG + Intergenic
957630894 3:82715292-82715314 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
957665237 3:83218009-83218031 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
957804959 3:85134259-85134281 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
957830074 3:85505074-85505096 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
957919911 3:86733476-86733498 CGAGTAGAGGGAGCAGGCTCTGG + Intergenic
957970339 3:87375281-87375303 CAAGCAGAGGGAGCCGGCTTTGG - Intergenic
958022580 3:88015652-88015674 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
958419830 3:93917577-93917599 CAAGCTGAGGGAGCCAGCTCTGG - Intronic
958549698 3:95595879-95595901 CAAGCAGAGGGAGCTGGCTTGGG + Intergenic
958810799 3:98858322-98858344 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
960149856 3:114238688-114238710 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
960199454 3:114813052-114813074 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
960227584 3:115185283-115185305 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
960282083 3:115791524-115791546 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
960479491 3:118171359-118171381 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
960487270 3:118269644-118269666 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
960685452 3:120289678-120289700 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
960995840 3:123339542-123339564 CCAACAGGGAGAGCCTGCCCTGG + Intronic
961268729 3:125671640-125671662 CAAGCAGAGGGAGCTGGCTCTGG - Intergenic
961465094 3:127076639-127076661 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
961632601 3:128312358-128312380 CCAGGAGAGAGAGCTGGCCTAGG - Intronic
961688747 3:128653357-128653379 CAAGCTGAAGGAGCCGGCTCCGG - Intronic
961746770 3:129068667-129068689 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
961932364 3:130547460-130547482 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
961957087 3:130815230-130815252 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
962106584 3:132396384-132396406 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
962671736 3:137714897-137714919 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
962758203 3:138484618-138484640 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
962758400 3:138485671-138485693 CCAGCAGTGGCAACCGGCTCGGG + Intergenic
963440357 3:145333356-145333378 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
963533217 3:146497261-146497283 CAAGCACAGGGAGCCGGCTCCGG - Intergenic
963554610 3:146772308-146772330 CAAGCCGAGGGAGCCAGCTCCGG - Intergenic
963651874 3:147989778-147989800 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
963744110 3:149109348-149109370 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
963760542 3:149283983-149284005 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
963832534 3:150023393-150023415 CCAGCAGAGCTACCAGGCTCTGG - Intronic
963862114 3:150322930-150322952 CAAGCTGAGGGAACCGGCTCTGG - Intergenic
964118021 3:153156118-153156140 CAAGCTGAGGGAGCCGGCCCCGG + Intergenic
964138407 3:153370157-153370179 CAAGCAGAGGGAGCCGGCTGAGG + Intergenic
964265430 3:154889638-154889660 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
964378480 3:156073123-156073145 CAAGCTGAGGGAGCCGACTCTGG - Intronic
964381052 3:156099430-156099452 CAAGCTGAGGGAGCCAGCTCCGG - Intronic
964393833 3:156224323-156224345 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
964443953 3:156740540-156740562 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
964452193 3:156823075-156823097 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
964972609 3:162579759-162579781 CCAGCAGCGACAACCCGCTCGGG + Intergenic
964993549 3:162844997-162845019 CAAGCAGAGGGAGCTGGCTCCGG + Intergenic
965003472 3:162987313-162987335 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
965040246 3:163498986-163499008 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
965044187 3:163552719-163552741 CAAGCTAAGGGAGCCGGCTCTGG + Intergenic
965077948 3:164002933-164002955 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
965092200 3:164179215-164179237 CAAGCAGAGGGAGCCAGCTCCGG - Intergenic
965109477 3:164402310-164402332 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
965220262 3:165918844-165918866 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
965245290 3:166258866-166258888 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
965256896 3:166424594-166424616 CCAGCAGTGGCAACCGGCTCGGG + Intergenic
965287986 3:166842774-166842796 CAAGCTGAGGGAGCGGGCTCCGG - Intergenic
965298076 3:166975796-166975818 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
965446426 3:168780103-168780125 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
965586942 3:170327404-170327426 CAAGCAGAGGGAGCCAGCTCTGG - Intergenic
965837316 3:172866743-172866765 CAAGCTGAGGGAGCAGGCTCCGG - Intergenic
966096846 3:176213824-176213846 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
966108265 3:176362621-176362643 CAAGCAGAGGGAGCTGGCTCCGG + Intergenic
966183079 3:177204296-177204318 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
966191070 3:177272125-177272147 CAAGCTGAGGGAGCAGGCTCCGG + Intergenic
966246128 3:177809294-177809316 CAAGCTGAGGGAGCCGGCTCAGG + Intergenic
966549008 3:181183385-181183407 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
966725487 3:183104144-183104166 CAAGCTGAGGGAGCCAGCTCCGG + Intronic
967233977 3:187367205-187367227 CCAGCACTGACAACCGGCTCGGG - Intergenic
967448451 3:189596086-189596108 CAAGCTGAGGGAGCGGGCTCCGG - Intergenic
967499206 3:190177447-190177469 CAAGCTGAGGGAGCAGGCTCCGG + Intergenic
967594967 3:191317399-191317421 CAAGCAGAGGGAGCTGGCTCCGG + Intronic
968014861 3:195320063-195320085 GCAGCAGAGAGAGAGTGCTCAGG - Intronic
968181651 3:196599435-196599457 CAAGCTGAGGGAGCGGGCTCCGG + Intergenic
968412848 4:404357-404379 CAAGCTGAGGGAGTCGGCTCCGG + Intergenic
968469636 4:773521-773543 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
969230211 4:5825340-5825362 CCACCAGTGAGAGCAGGCTCGGG + Intronic
969303207 4:6309422-6309444 CAAGCCGAGGGATCCGGCTCCGG + Intergenic
969362305 4:6672686-6672708 CAAGCTGAGAGAGCCGGCTCTGG - Intergenic
969362478 4:6673439-6673461 CCAGCAGTGGCAACCGGCTCAGG + Intergenic
969579219 4:8054375-8054397 CCAGCACAGAGAGGATGCTCAGG - Intronic
969781814 4:9410004-9410026 CGAGCAGAGGGAGCCAGCTCCGG + Intergenic
970108269 4:12609596-12609618 GAAGCTGAGGGAGCCGGCTCCGG - Intergenic
970182549 4:13415361-13415383 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
970272076 4:14358628-14358650 CAAGCTGAGGGAGCCGACTCCGG - Intergenic
970408681 4:15787103-15787125 CAAGCAGAGGGAGCCGACTCCGG + Intronic
970574623 4:17414685-17414707 CAAGCATAGGGAGCCGGCTCCGG + Intergenic
970576913 4:17436950-17436972 CAAGCTGAGTGAGCCGGCTCCGG + Intergenic
970673214 4:18418736-18418758 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
970692043 4:18630969-18630991 CAAGCAGAGGGAGCTGGCTGTGG + Intergenic
971209175 4:24599513-24599535 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
971280584 4:25239630-25239652 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
971564241 4:28117539-28117561 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
971639771 4:29117315-29117337 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
971709414 4:30092670-30092692 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
971722528 4:30264652-30264674 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
971852044 4:31996351-31996373 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
971905084 4:32715971-32715993 CCAGCAGAGGCAACCCGCTCGGG - Intergenic
971905247 4:32716623-32716645 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
972034842 4:34506976-34506998 CAAGCTGAGGGAGCCGGTTCTGG + Intergenic
972173329 4:36374892-36374914 CAAGCAGAGGGAGCCAGCTCCGG - Intergenic
972316842 4:37934644-37934666 CCAGCAGAGAGAGTCTGCAGGGG + Intronic
972344590 4:38182541-38182563 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
972392506 4:38626867-38626889 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
972603028 4:40589464-40589486 CCAGCATGGAAAGCAGGCTCTGG - Intronic
972778566 4:42265902-42265924 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
972784676 4:42315455-42315477 CGAGCAGAGGGAGCCGACTCTGG + Intergenic
972790809 4:42369605-42369627 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
972913253 4:43846132-43846154 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
973037049 4:45420125-45420147 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
973041850 4:45477748-45477770 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
973142045 4:46781641-46781663 CAAGCAGAGGGAGCCAGCTCCGG - Intronic
973144307 4:46805188-46805210 CAGGCTGAGGGAGCCGGCTCTGG + Intronic
973146260 4:46831003-46831025 CAGGCTGAGGGAGCCGGCTCTGG - Intronic
973587809 4:52410143-52410165 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
973765146 4:54155521-54155543 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
973854066 4:54993478-54993500 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
973878072 4:55241464-55241486 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
974129011 4:57730176-57730198 CAATCTGAGGGAGCCGGCTCTGG + Intergenic
974484840 4:62492294-62492316 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
974492669 4:62587798-62587820 CCAGGAGAGAGAGCGAGCTGTGG + Intergenic
974590646 4:63943272-63943294 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
974781800 4:66561879-66561901 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
974804333 4:66860131-66860153 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
974807611 4:66899857-66899879 CAAGCAGAGGGAGCCAGCTCCGG + Intergenic
974827706 4:67151843-67151865 CAAGCTGAGGGAGCCTGCTCCGG - Intergenic
974892341 4:67896958-67896980 CAGGCTGAGCGAGCCGGCTCTGG + Intergenic
974992921 4:69115641-69115663 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
975019223 4:69466717-69466739 CCAGCAGTGACAACCTGCTCAGG - Intergenic
975028095 4:69576726-69576748 CAAGCAGAGGGAGCCAGCTCTGG + Intergenic
975033935 4:69658321-69658343 TGAGCAGAGGGAGCCAGCTCTGG + Intergenic
975055355 4:69923854-69923876 CAAGCTGAGGAAGCCGGCTCCGG - Intergenic
975160653 4:71120890-71120912 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
975595234 4:76043684-76043706 CAAGCTGAGCGAGCCAGCTCCGG + Intronic
975596418 4:76051054-76051076 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
975744909 4:77466348-77466370 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
975755826 4:77570627-77570649 CAAACTGAGGGAGCCGGCTCTGG - Intronic
975898380 4:79121895-79121917 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
976406335 4:84664680-84664702 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
976565490 4:86547282-86547304 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
976597035 4:86904306-86904328 CGAGCACAGGGAGCCGGCTCCGG + Intronic
976690655 4:87864062-87864084 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
976741333 4:88360487-88360509 CAAGTGGAGGGAGCCGGCTCCGG - Intergenic
977206467 4:94169803-94169825 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
977641121 4:99359641-99359663 CAAGCAGAGGGAGCCAGCTCCGG - Intergenic
977717402 4:100196918-100196940 CAAGCTGAGGGAGCTGGCTCGGG + Intergenic
977883551 4:102234302-102234324 CAAGCAGAGGGAGCCAGCTCTGG - Intergenic
977885815 4:102250684-102250706 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
977906440 4:102483099-102483121 CAAGCTGAAAAAGCCGGCTCTGG - Intergenic
978030547 4:103936740-103936762 CAAGCAGAGGGAGCCAGCCCCGG - Intergenic
978254935 4:106681852-106681874 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
978463665 4:108984750-108984772 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
978466205 4:109012436-109012458 CAAGCAGAGGGAGCCAGCTCCGG - Intronic
978748520 4:112222407-112222429 CCAGCTGAGGGGGCCGGCTCGGG - Intergenic
978809037 4:112830769-112830791 CAAGCAGAGGGAGCTGGCTTTGG - Intronic
978886501 4:113772298-113772320 CAACCAGAGAGAGCCGGCTCTGG - Intergenic
978918024 4:114148955-114148977 CAAGCTGAGGGAGCCAGCTCAGG + Intergenic
978929835 4:114296498-114296520 CAAACAGAGGGAGCCAGCTCTGG + Intergenic
978944783 4:114482079-114482101 CAAGCAGATGGAGCCAGCTCTGG + Intergenic
978998101 4:115179814-115179836 CGAGCTGAGGGAGCCGGCTCCGG + Intergenic
978999625 4:115200594-115200616 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
979033265 4:115678840-115678862 TGAGCCGAGGGAGCCGGCTCCGG + Intergenic
979224136 4:118265511-118265533 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
979445720 4:120808964-120808986 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
979608971 4:122670190-122670212 ACACCTGAGGGAGCCGGCTCTGG - Intergenic
979688533 4:123537880-123537902 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
979755819 4:124339016-124339038 GAAGCTGAGGGAGCCGGCTCCGG - Intergenic
979822506 4:125191913-125191935 CAAGCTGAGGGAGCCGGCTCGGG - Intergenic
979829306 4:125280912-125280934 CAAGCAGAGGGAGCTGGCTCTGG - Intergenic
979857552 4:125652127-125652149 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
979865169 4:125744954-125744976 CAAGCAGAGAGAGCCAGCTCCGG - Intergenic
979899764 4:126201688-126201710 CAAGCCGAGGGAGCCGGCTCCGG + Intergenic
979920411 4:126489982-126490004 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
980051985 4:128047956-128047978 TAAGCTGAGGGAGCCGGCTCTGG + Intergenic
980115171 4:128672625-128672647 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
980234711 4:130090549-130090571 TGAGCAGAGGGAGCCGGCTCCGG - Intergenic
980562889 4:134501632-134501654 CAAGCAGAGGGAGCTGGCTCCGG - Intergenic
980595483 4:134948548-134948570 CAAGCAGAGGGAGCTGGCTCTGG + Intergenic
980698699 4:136395310-136395332 CAGGCTGAGGGAGCCGGCTCGGG - Intergenic
980739392 4:136929923-136929945 CCAGCAGTGACAACCTGCTCAGG + Intergenic
980774441 4:137420983-137421005 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
980827395 4:138089092-138089114 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
980865873 4:138553129-138553151 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
981136146 4:141213496-141213518 CAAGCAGAGGGAGCAGGCTCTGG - Intergenic
981146828 4:141333591-141333613 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
981170266 4:141615472-141615494 CAAGCAGAGGGAGCTGGCTCCGG - Intergenic
981176635 4:141690256-141690278 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
982024302 4:151236209-151236231 CGAGCTGAGGGAGCCGGCTCTGG - Intronic
982291718 4:153788910-153788932 CCAGCGAAGAGAGCGGGCCCGGG - Exonic
982293767 4:153806231-153806253 CGAGCAGAGGGAGCCGGTTGCGG - Intergenic
982692730 4:158566906-158566928 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
982700674 4:158657453-158657475 CGAGCAGAGGGAGCCAGCTCTGG - Intergenic
982701746 4:158664958-158664980 TGAACAGAGGGAGCCGGCTCCGG - Intergenic
982728139 4:158927664-158927686 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
982758290 4:159250885-159250907 CAAGCAGAGGGAGCCGGCTCCGG - Intronic
982768886 4:159378060-159378082 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
982770097 4:159389921-159389943 CAAGCAGAGGGAGCTGGCTCCGG - Intergenic
982863332 4:160481732-160481754 CAAGCTGGGGGAGCCGGCTCTGG - Intergenic
983026045 4:162739503-162739525 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
983060289 4:163152808-163152830 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
983064136 4:163190103-163190125 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
983134898 4:164068358-164068380 CAAGCTGAGGGAGGCGGCTCCGG - Intronic
983553105 4:169036233-169036255 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
983656687 4:170091193-170091215 CAGGCTGAGGGAGCCGGCTCCGG - Intronic
983660686 4:170127999-170128021 CGAGCAGACAGAGCTGGCTCTGG + Intergenic
983734665 4:171043132-171043154 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
983752796 4:171298237-171298259 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
983834289 4:172369868-172369890 CAAGCAGAGGGAGCTGGCTCCGG + Intronic
983835444 4:172377937-172377959 CAAGCAGAGGGAGCTGGCTCTGG + Intronic
983957843 4:173717839-173717861 CAAGCAGAGGGATCTGGCTCTGG + Intergenic
984069242 4:175092074-175092096 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
984192887 4:176625561-176625583 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
984238872 4:177193592-177193614 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
984241875 4:177227924-177227946 CAAGCTGAGAGAGCCAGCTCTGG + Intergenic
984266105 4:177499636-177499658 CAAGCAGAGAGAGCCAGCTCTGG - Intergenic
984413320 4:179425274-179425296 CAGGCAGAGAGAGCAGCCTCTGG + Intergenic
984776160 4:183483061-183483083 CAAGCTGAGGGAGCGGGCTCCGG + Intergenic
985087044 4:186324547-186324569 CAAGCTGAGGGAGCGGGCTCCGG - Intergenic
985130318 4:186732573-186732595 CCTACAGAGAGAGCAAGCTCTGG + Intergenic
985145380 4:186890078-186890100 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
985195223 4:187421346-187421368 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
985366347 4:189236270-189236292 CAAGCTGAGGGAGCCGACTCCGG - Intergenic
985409214 4:189665138-189665160 ACAGCAGAGGGAGCTGGCTGTGG + Intergenic
985481012 5:110952-110974 CCAGGAGAGAGAGCAGACACAGG - Intergenic
985590844 5:764349-764371 CAAGCCGAGGGAGCCGGCTCTGG - Intronic
985673721 5:1219560-1219582 CCAGCAGGGAGAGCCAGTACTGG - Exonic
985762179 5:1754985-1755007 ACAGCAGAGAGAGGAGGCTCTGG - Intergenic
985936350 5:3100987-3101009 CCAGCAGAGGGGACAGGCTCTGG - Intergenic
986139689 5:5017999-5018021 CCAGCAGCGAGAGCTGTCACTGG - Intergenic
986540577 5:8840413-8840435 CCAGCAGAGGGAGCAGGCTCCGG - Intergenic
986626114 5:9725271-9725293 CAAGCTGAGGAAGCCGGCTCCGG - Intergenic
986661688 5:10065442-10065464 CAAGCCGAGGGAGCCAGCTCCGG - Intergenic
986912442 5:12574342-12574364 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
986912582 5:12574872-12574894 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
986963549 5:13244167-13244189 CAAGCAGAGGGAGCTGACTCCGG - Intergenic
986993231 5:13578474-13578496 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
987146118 5:14993381-14993403 CCAGCAGTGGCAGCCCGCTCGGG - Intergenic
987146302 5:14994203-14994225 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
987283680 5:16436146-16436168 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
987308273 5:16658713-16658735 CCAGCAGGGAGAGGCTGCCCAGG + Intergenic
987352333 5:17032790-17032812 CAAGCTGGGGGAGCCGGCTCCGG + Intergenic
987355802 5:17062180-17062202 CTAGCCGAGGGTGCCGGCTCCGG - Intergenic
987358178 5:17083424-17083446 CAACCTGAGGGAGCCGGCTCTGG - Intronic
987384064 5:17312170-17312192 CAAGCTGAGGGAGCCGGTTCTGG + Intergenic
987476749 5:18400069-18400091 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
987532837 5:19143168-19143190 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
987696550 5:21341358-21341380 CCAGCAGAGGGAGCCCGCTCAGG - Intergenic
987896240 5:23951239-23951261 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
988035630 5:25823710-25823732 CAAGCAGAGGGAGCCCACTCTGG + Intergenic
988073438 5:26324384-26324406 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
988143109 5:27267595-27267617 CAAGCAGAGGGAGCCATCTCCGG + Intergenic
988201824 5:28078050-28078072 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
988282451 5:29167617-29167639 GCAGCAGAGAGAGTGAGCTCTGG - Intergenic
988369192 5:30345691-30345713 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
988591435 5:32553167-32553189 CGAGCAGAGGGAGCCGGCTCTGG + Intronic
988605973 5:32678671-32678693 TGAGCAGAGGGAGCTGGCTCTGG + Intergenic
988652314 5:33166367-33166389 CCAGCAGAGCTACCAGGCTCTGG + Intergenic
988684789 5:33515784-33515806 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
988755653 5:34245212-34245234 CCAGCAGAGGGAGCCCGCTCAGG + Intergenic
988883538 5:35531589-35531611 CAAGCTGAGGGAGCCGGCTTCGG - Intergenic
988921215 5:35944700-35944722 GCAGCAGAGAAAGCCAGATCAGG + Intergenic
989559630 5:42836330-42836352 CAAGCAGAGGGAGCCAGCTGTGG - Intronic
989757618 5:44974976-44974998 GAAGCAGAGGGAGCCAGCTCCGG - Intergenic
989956798 5:50369401-50369423 CCAGCTGAGGGAGCCGGCTCCGG - Intergenic
989965779 5:50464977-50464999 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
990323232 5:54649414-54649436 CAGGCTGAGGGAGCCGGCTCCGG + Intergenic
990345211 5:54865040-54865062 AAAGCTGAGGGAGCCGGCTCTGG - Intergenic
990418914 5:55613318-55613340 CAAGCAGAGGGAGCTGGCTCTGG - Intergenic
990490027 5:56295315-56295337 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
990512200 5:56499053-56499075 CAAGCAGAGGGAGCTGGCTGCGG + Intergenic
990869426 5:60415418-60415440 CAAGCTGAGGGCGCCGGCTCCGG - Intronic
991120524 5:63008317-63008339 TGAGCAGAGGCAGCCGGCTCCGG - Intergenic
991330273 5:65485829-65485851 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
991567617 5:68020801-68020823 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
991743904 5:69710983-69711005 CCAGCAGAGGGAGCCCGCTCAGG + Intergenic
991753805 5:69844259-69844281 CCAGCAGAGGGAGCCCGCTCAGG - Intergenic
991795476 5:70290715-70290737 CCAGCAGAGGGAGCCCGCTCAGG + Intergenic
991803422 5:70400986-70401008 CCAGCAGAGGGAGCCCGCTCAGG - Intergenic
991823274 5:70586251-70586273 CCAGCAGAGGGAGCCCGCTCAGG + Intergenic
991833121 5:70719372-70719394 CCAGCAGAGGGAGCCCGCTCAGG - Intergenic
991887843 5:71290234-71290256 CCAGCAGAGGGAGCCCGCTCAGG + Intergenic
992048816 5:72925454-72925476 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
993041803 5:82823186-82823208 CCAGCAGTGGCAACCGGCTCGGG - Intergenic
993328630 5:86569921-86569943 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
993770231 5:91917237-91917259 CAAGATGAGGGAGCCGGCTCCGG - Intergenic
993803587 5:92375281-92375303 CAAGCCGAGGGAGCCAGCTCCGG + Intergenic
993821984 5:92631296-92631318 CAAGCTGAGGGAGCCCGCTCCGG - Intergenic
994096288 5:95851128-95851150 CAAGCTGAGGGAGCCGGCTTCGG - Intergenic
994229917 5:97301111-97301133 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
994239821 5:97407145-97407167 CAAGCTGAGGGAGCCGGGTCCGG - Intergenic
994254841 5:97580390-97580412 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
994411381 5:99410678-99410700 TGAGCAGAGGGAGCTGGCTCCGG + Intergenic
994482446 5:100354569-100354591 TGAGCAGAGGGAGCTGGCTCCGG - Intergenic
994507056 5:100656726-100656748 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
994647799 5:102491744-102491766 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
994754654 5:103779172-103779194 TGAGCAGAGGGAGCCAGCTCTGG + Intergenic
994769835 5:103966722-103966744 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
994841337 5:104928954-104928976 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
994928774 5:106154269-106154291 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
994932479 5:106206442-106206464 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
994935243 5:106246216-106246238 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
995032269 5:107494210-107494232 CAAGCTGAGGGAGCGGGCTCCGG - Intronic
995326452 5:110894384-110894406 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
995388392 5:111612556-111612578 CGAGCTGAGGGAGCCGGCTCTGG + Intergenic
995529095 5:113075019-113075041 CAAGCAGAGGGAGCTGGCTCTGG - Intronic
995582586 5:113617280-113617302 CAAGCAGAGGGAGCCAGTTCCGG - Intergenic
995656459 5:114432644-114432666 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
995678859 5:114695418-114695440 CAAGCAAAGGGAGCTGGCTCTGG - Intergenic
995707356 5:114999299-114999321 TGAGCAGAGGGAGCCTGCTCTGG - Intergenic
995975763 5:118033758-118033780 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
996106998 5:119517067-119517089 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
996234173 5:121107140-121107162 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
996298603 5:121954349-121954371 CAAGCAGAGGAAGCCTGCTCCGG + Intergenic
996435641 5:123430510-123430532 CAAGCTGAGGAAGCCGGCTCCGG - Intergenic
996530346 5:124521586-124521608 CAAGCTGTGGGAGCCGGCTCTGG - Intergenic
996567147 5:124892390-124892412 CAACCAGAGGGAGCTGGCTCCGG - Intergenic
996585948 5:125088666-125088688 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
996815523 5:127569418-127569440 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
997760508 5:136444176-136444198 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
998117487 5:139549306-139549328 CAAGCAGAGGGAGCTGGCTCCGG - Intronic
998161142 5:139813639-139813661 CCATGAGAGACAGGCGGCTCAGG - Exonic
999245683 5:150153335-150153357 CCAGCAGAAAGTGCAGCCTCAGG - Intronic
999348502 5:150845427-150845449 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
999406128 5:151309150-151309172 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
999809530 5:155114805-155114827 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
999855332 5:155587148-155587170 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1000084702 5:157879273-157879295 CAAGCAGAGGGAGCTGGCTCTGG - Intergenic
1000212318 5:159119136-159119158 CAAGCTGATGGAGCCGGCTCCGG - Intergenic
1000902533 5:166927344-166927366 CAAGCTGAGGTAGCCGGCTCTGG + Intergenic
1001522867 5:172407392-172407414 CCAGCAGAGAAGCCAGGCTCTGG - Intronic
1001636394 5:173213408-173213430 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1001841493 5:174880626-174880648 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
1002586613 5:180252729-180252751 CCACCAGACACAGACGGCTCAGG + Intronic
1002612737 5:180432125-180432147 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
1002688266 5:181032441-181032463 GGAGCAGAGGGAACCGGCTCCGG - Intergenic
1002789428 6:426597-426619 TAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1002790779 6:435937-435959 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1002817659 6:694590-694612 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1002907074 6:1457366-1457388 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1002929209 6:1621678-1621700 GCAGCAGAGAGAGCCCGCGACGG + Intergenic
1003048969 6:2763665-2763687 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1003069617 6:2935772-2935794 CAAGCCGAGGGAGCTGGCTCCGG - Intergenic
1003070175 6:2939593-2939615 CAAGCTGAGGAAGCCGGCTCCGG - Intergenic
1003081865 6:3027665-3027687 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1003100144 6:3170729-3170751 CAAGCTGACAGAGCCAGCTCTGG - Intergenic
1003176824 6:3758127-3758149 CAAGCCGAGGGAGCCGGCTCTGG - Intergenic
1003177231 6:3761352-3761374 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1003178437 6:3771601-3771623 CAAGCCGAGGGAGCCGGCTCTGG - Intergenic
1003224516 6:4191686-4191708 CAAGCCGAGGGAGCCGGCTCCGG + Intergenic
1003297412 6:4844114-4844136 CCTGCAGAGATACCGGGCTCTGG + Intronic
1003489271 6:6606823-6606845 CAAGCTGAGGGAGCGGGCTCCGG + Intronic
1003490077 6:6613645-6613667 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1003506724 6:6746071-6746093 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1003531324 6:6940054-6940076 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1003577990 6:7315181-7315203 CAAGCTGAGGGAGCTGGCTCCGG - Intronic
1003581394 6:7344180-7344202 CAAGCTGAGGGAGCCAGCTCTGG - Intronic
1003589560 6:7425745-7425767 CAAGCTGAGGGAGCCGGCTTCGG - Intergenic
1003591575 6:7441237-7441259 CAAGCCAAGGGAGCCGGCTCCGG - Intergenic
1003671489 6:8164300-8164322 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1003679949 6:8243153-8243175 GCAGCACAGAGAGCAGTCTCTGG - Intergenic
1003747959 6:9024241-9024263 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1003770209 6:9290833-9290855 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1003836263 6:10075075-10075097 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1003872144 6:10412114-10412136 ACTGCATTGAGAGCCGGCTCCGG - Intronic
1003882098 6:10488132-10488154 CAAGTTGAGGGAGCCGGCTCCGG + Intergenic
1003897060 6:10617414-10617436 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
1003901544 6:10659849-10659871 CAGGCTGAGGGAGCCGGCTCCGG - Intergenic
1003908023 6:10720290-10720312 CGAGCAGATGGAGCCGGCTCCGG + Intergenic
1003908082 6:10720557-10720579 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
1003947229 6:11087180-11087202 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1003982518 6:11402979-11403001 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1003984021 6:11417392-11417414 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1004045401 6:12018284-12018306 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1004053204 6:12108787-12108809 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1004196633 6:13511427-13511449 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1004196778 6:13512505-13512527 CAAGCAAAGGGAGCCGGATCCGG - Intergenic
1004233750 6:13855114-13855136 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1004234172 6:13859957-13859979 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
1004234210 6:13860097-13860119 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
1004235589 6:13872319-13872341 CAAGCTGAAGGAGCCGGCTCCGG + Intergenic
1004248413 6:14002389-14002411 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1004250264 6:14017998-14018020 CAAGCTGACGGAGCCGGCTCTGG - Intergenic
1004486320 6:16069584-16069606 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1004499726 6:16198487-16198509 CAGGCTGAGGGAGCCGGCTCTGG + Intergenic
1004503254 6:16227292-16227314 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1004511600 6:16288217-16288239 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1004519267 6:16346844-16346866 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1004550169 6:16639182-16639204 CCAGCAGAGACAACCCGCTCGGG + Intronic
1004600409 6:17144713-17144735 CCAGCAGAGTTACCAGGCTCCGG + Intergenic
1004606560 6:17200573-17200595 CCAGTAGAGGGAGCCGGCTTTGG - Intergenic
1004689143 6:17976585-17976607 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1004811776 6:19270748-19270770 TGAGCAGAGGGAGCCGGTTCTGG - Intergenic
1004861425 6:19807365-19807387 CCAGCTGAGGGAGCCGTCTCCGG + Intergenic
1004866103 6:19854823-19854845 CCAGCTGAGGGAGCCGGCTCCGG + Intergenic
1004883657 6:20032309-20032331 CAAACTGAGGGAGCCGGCTCAGG - Intergenic
1004905392 6:20233181-20233203 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1004908473 6:20259531-20259553 TAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1004912587 6:20301225-20301247 CAAACTGAGGGAGCCGGCTCTGG - Intergenic
1004914399 6:20318882-20318904 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1005059235 6:21761122-21761144 CGAGCTGAGAGGGCCGGCTCTGG - Intergenic
1005114321 6:22318801-22318823 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1005360711 6:25028391-25028413 CCAGCAGTGAAAACCCGCTCTGG + Intronic
1005554292 6:26956987-26957009 CCGGCAGAGGGAGCCCGCTCAGG + Intergenic
1005561394 6:27045249-27045271 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1005596260 6:27381455-27381477 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1005600925 6:27425225-27425247 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1005725105 6:28640139-28640161 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1005749110 6:28866838-28866860 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1005935496 6:30517931-30517953 CAAGCAGAGGGAGACGGCTCCGG - Intergenic
1005978289 6:30816694-30816716 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1006008257 6:31020684-31020706 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1006127916 6:31852020-31852042 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
1006351145 6:33521883-33521905 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
1006444009 6:34068820-34068842 CCACCAGAGCGAGCTGGCTCAGG - Intronic
1006511874 6:34525946-34525968 CCAGGAGAGAGAGCCAGCTCTGG + Intronic
1006695959 6:35931230-35931252 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1006748947 6:36364629-36364651 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1006978413 6:38124716-38124738 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
1007274954 6:40666467-40666489 CCAGGAGAGAGAGACCCCTCTGG + Intergenic
1007329080 6:41089678-41089700 CCAGCAGTGACAGCCGTCTGGGG - Exonic
1007532347 6:42554192-42554214 TGAGCAGAGGGAGCCGGCTCCGG - Intergenic
1007718285 6:43869960-43869982 CCACCACAGGGAGCCGGCTGGGG - Intergenic
1007738685 6:43998061-43998083 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1008005641 6:46406163-46406185 CAAGCTGAGGGAGCTGGCTCTGG + Intronic
1008270236 6:49482220-49482242 CAAGCTGAGGGAGCCAGCTCCGG + Intronic
1008572592 6:52829583-52829605 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1008631177 6:53363849-53363871 CAAGCAGAGGGAGTCAGCTCCGG + Intergenic
1009402732 6:63275327-63275349 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1009407147 6:63326851-63326873 CAAGCTGAGGGAGCGGGCTCTGG + Intergenic
1009408087 6:63333123-63333145 CCAGCAGGGGGAACCCGCTCGGG - Intergenic
1009470232 6:64023739-64023761 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1009471372 6:64031120-64031142 CAAGCTGAGGGAGCCAGCTCCGG - Intronic
1009664365 6:66655759-66655781 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
1009667682 6:66704953-66704975 CAAGCTGAGGGAGCCGGCTCAGG + Intergenic
1009685284 6:66949179-66949201 CAAGCTGTGGGAGCCGGCTCGGG - Intergenic
1009690892 6:67031043-67031065 TGAGCAGAGGGAGCCAGCTCCGG - Intergenic
1009746639 6:67825365-67825387 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
1009971322 6:70628091-70628113 CTAGCAGAGGGAGCCGGCTCCGG + Intergenic
1010199364 6:73269270-73269292 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1010235702 6:73572933-73572955 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1010500572 6:76594344-76594366 CCAGCAGAGCTACCAGGCTCTGG - Intergenic
1010617328 6:78029762-78029784 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1010768982 6:79806954-79806976 CCAGCAGAGGTAACCCGCTCCGG + Intergenic
1011178082 6:84587395-84587417 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1011246473 6:85325942-85325964 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1011338395 6:86285173-86285195 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1011410371 6:87060154-87060176 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1011620135 6:89234843-89234865 CAAGCTGAGGGAGCCTGCTCCGG + Intergenic
1011825777 6:91303526-91303548 CCAGCAGAGAGAGCCAGCTCTGG + Intergenic
1011923893 6:92617862-92617884 CCAGCAGAGCTACCAGGCTCTGG + Intergenic
1012131244 6:95496906-95496928 CAAGCAGTGGGAGCAGGCTCTGG - Intergenic
1012144978 6:95670005-95670027 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1012189389 6:96261342-96261364 CAAGCTGAGGGAGCCTGCTCCGG + Intergenic
1012578264 6:100829589-100829611 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1012598811 6:101070226-101070248 CAAGCAGAGGGAGCTGGCTCCGG - Intergenic
1012733583 6:102911037-102911059 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1012760552 6:103294800-103294822 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1012850946 6:104446299-104446321 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1013080184 6:106805728-106805750 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1013694672 6:112688911-112688933 CCAGCAGTGGCAGCCGGCTCGGG - Intergenic
1013694866 6:112689788-112689810 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1013957197 6:115855160-115855182 CAAACAGAGGGAGCCAGCTCCGG - Intergenic
1013960046 6:115889068-115889090 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
1013963494 6:115928436-115928458 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1014055839 6:117014724-117014746 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1014240694 6:119015287-119015309 CAAGTTGAGGGAGCCGGCTCTGG - Intronic
1014280760 6:119440963-119440985 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1014299649 6:119665643-119665665 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
1014420221 6:121234995-121235017 CCAGCAGAGCTACCGGGCTCTGG + Intronic
1014460304 6:121686809-121686831 CAAGCTGAGGGAGCCGGCCCCGG + Intergenic
1014499308 6:122165454-122165476 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1014507711 6:122280544-122280566 CAAGCTGAGGGAGCGGGCTCCGG - Intergenic
1014921124 6:127214987-127215009 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1015572304 6:134633942-134633964 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1016067422 6:139698312-139698334 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1016104779 6:140148517-140148539 CAGGCTGAGGGAGCCGGCTCCGG + Intergenic
1016182890 6:141168823-141168845 CCAGCAGCGACAGCCCACTCAGG + Intergenic
1016217140 6:141618175-141618197 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1016521856 6:144954862-144954884 CCAGCAGAGAGAGCCTACATGGG + Intergenic
1016874102 6:148847778-148847800 CCAACACAGAGAGCCTGTTCTGG + Intronic
1016915615 6:149241897-149241919 GCAGCAGAGAGAGGAGGCACGGG - Intronic
1017310094 6:152966326-152966348 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1017325034 6:153133585-153133607 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1017581274 6:155867152-155867174 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1017839557 6:158210185-158210207 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1018064288 6:160114898-160114920 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1018545624 6:164933263-164933285 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1018551377 6:165001972-165001994 CAAGCAGAGGGAGCCGGCTTCGG + Intergenic
1018696243 6:166393743-166393765 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1018734790 6:166679722-166679744 CCAGCAGAGAGAGCCGGCTCCGG - Intronic
1018858595 6:167693690-167693712 CCAGCAGCGGCAACCGGCTCTGG + Intergenic
1019086179 6:169479999-169480021 CAAGCAGAGGGAGCCGGCTCTGG - Intronic
1019357816 7:590109-590131 CCAGAAGACAGAGGGGGCTCTGG + Intronic
1019618400 7:1977515-1977537 CAAGCAGAGGGAGCCGGCTCCGG + Intronic
1020008235 7:4793492-4793514 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1020552321 7:9621843-9621865 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1020784492 7:12556555-12556577 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1021006211 7:15397402-15397424 CAAGCAGAGGGAGTCGGCTCCGG + Intronic
1021359454 7:19692631-19692653 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1021520742 7:21536932-21536954 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1021573824 7:22090295-22090317 CAAGCAGAGGGAGCTGGCTTCGG - Intergenic
1021686810 7:23194124-23194146 CAAGCTGAGGGAGCCAGCTCAGG + Intronic
1021761330 7:23905110-23905132 CAAGCCGAGGGAGCCGGCTCCGG + Intergenic
1022578041 7:31517708-31517730 TTAGCAGAGGGAGCCGGCTCCGG + Intronic
1022750383 7:33218937-33218959 CAAGCTGAGGGAGCCAGCTCTGG - Intronic
1023049165 7:36236254-36236276 CGAGCAGAGGGAGCCGGCTCCGG - Intronic
1023232459 7:38049739-38049761 CAAGCAGAGAGAGCCGGCTCCGG - Intergenic
1023396256 7:39754336-39754358 CAAGCCGAGGGAGTCGGCTCCGG + Intergenic
1023816559 7:43954956-43954978 CCAACAGAGAGAGCAGGCTTGGG - Exonic
1023882523 7:44328341-44328363 CCACCAGGGAGAGCAGGCTGTGG + Intronic
1023961292 7:44928436-44928458 CCAGCAGAAGGAGCAGACTCTGG + Intergenic
1023987790 7:45107312-45107334 CCAGCAGAGAGGACGGGCTGTGG - Intronic
1024465852 7:49711217-49711239 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
1024691221 7:51805798-51805820 CAAGCTGAGGGGGCCGGCTCTGG - Intergenic
1024700684 7:51901292-51901314 CAAGCTGAGAGAGCCGGCTCCGG + Intergenic
1024735872 7:52303314-52303336 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1026596609 7:71738476-71738498 CAAGCTGAGGGAGTCGGCTCTGG + Intergenic
1027238061 7:76309834-76309856 CAAGCTGAGGGAGCCGTCTCCGG + Intergenic
1027561618 7:79739263-79739285 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1027564094 7:79768361-79768383 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1027579767 7:79978006-79978028 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1027659779 7:80975157-80975179 CGAGCAGACAGAGCCAGCTCTGG + Intergenic
1027674419 7:81141710-81141732 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1027778913 7:82499576-82499598 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
1027781000 7:82520348-82520370 CCAACAGATAGAGCAGGCTGTGG + Intergenic
1027955996 7:84880532-84880554 CAAGGTGAGGGAGCCGGCTCCGG - Intergenic
1028058786 7:86282551-86282573 CAAGCAGAAGGAGCCGGCTCCGG + Intergenic
1028142454 7:87288687-87288709 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
1028511274 7:91627790-91627812 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1028558079 7:92143722-92143744 CAAGCTGAGGGAGCCGGTTCCGG + Intronic
1028719472 7:94012264-94012286 CAAGCTGAGGGAGCCGGCTTTGG + Intergenic
1028727128 7:94100856-94100878 CAAACAGAGGGAGCCGGCCCCGG - Intergenic
1028778273 7:94705458-94705480 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1028912941 7:96228669-96228691 CAAGCAGAGGGAGCTGGCTCTGG - Intronic
1028989675 7:97035593-97035615 CCAACAGTGACAGCCGGCTGGGG + Intergenic
1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG + Intergenic
1029407040 7:100381691-100381713 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1029809674 7:103034600-103034622 CAAGCTGAGGGAGCCGGTTCCGG + Intronic
1029903911 7:104071752-104071774 CAAGCTGAGGGAGCGGGCTCCGG - Intergenic
1030102167 7:105956154-105956176 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1030215771 7:107042715-107042737 CAAGCTGAGGGAGCTGGCTCAGG + Intergenic
1030733430 7:113017304-113017326 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1030772267 7:113488523-113488545 CAAGCAGAGGGAGCTGGCTTCGG + Intergenic
1030819366 7:114077239-114077261 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1030980731 7:116182318-116182340 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1031056582 7:116998395-116998417 CAAGCCGAGGGAGCTGGCTCCGG + Intronic
1031109920 7:117596111-117596133 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1031213392 7:118859045-118859067 CAAGCAGAGGGAGCCGGCTCCGG + Intergenic
1031253184 7:119413725-119413747 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1031378745 7:121059933-121059955 CAAGCTGAGGGAGACGGCTCCGG - Intronic
1031409163 7:121421672-121421694 CAAGCTGAGTGAGCCAGCTCTGG - Intergenic
1031513362 7:122674227-122674249 CAAGCAGAGGGAGCCAGCTCCGG + Intronic
1031605571 7:123763568-123763590 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1031846067 7:126806897-126806919 CGAGCAGAGGGAGCCGGCTCTGG + Intronic
1032089574 7:128904487-128904509 CCTGCAGAGTAAGCCAGCTCTGG - Intronic
1032162397 7:129520861-129520883 TTAGAAGAGAGAGACGGCTCTGG + Intergenic
1032339599 7:131058726-131058748 CAAGCAGAGGGAGCCAGCTCCGG - Intergenic
1032437064 7:131909290-131909312 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
1032455975 7:132073848-132073870 ACAGCACAGAGAGCAGGCCCCGG - Intergenic
1032561660 7:132899004-132899026 CAAGCTGAGGGAGCGGGCTCTGG + Intronic
1033065034 7:138146127-138146149 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1033394134 7:140957341-140957363 CAAGCTGAGGGAGCCGGCTCGGG + Intergenic
1033664156 7:143424794-143424816 CAAGCTAAGGGAGCCGGCTCTGG + Intergenic
1033758647 7:144418295-144418317 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1033779275 7:144650383-144650405 CAAGCTGAGGGAGCCAGCTCTGG - Intronic
1033839973 7:145361032-145361054 CAAGTGGAGGGAGCCGGCTCCGG + Intergenic
1033866691 7:145697766-145697788 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1033951223 7:146787664-146787686 CCAGCAGTGACAACCTGCTCGGG - Intronic
1033982869 7:147187602-147187624 ACAGCAGAGAGAGACGGATTGGG + Intronic
1034097862 7:148426372-148426394 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1034632188 7:152539257-152539279 CAAGCTGAGGGAACCGGCTCCGG + Intergenic
1034656093 7:152730673-152730695 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1034680782 7:152925807-152925829 CCAGCAGGGAGTGGGGGCTCGGG + Intergenic
1034843653 7:154422856-154422878 CCAGCTGGGAGACCCTGCTCTGG - Intronic
1034860618 7:154591932-154591954 CCAGCAGAGAGCACAGGCCCTGG - Intronic
1034900800 7:154906887-154906909 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
1034967162 7:155398546-155398568 CAAGCTGAGGGGGCCGGCTCCGG + Intergenic
1035325369 7:158062534-158062556 CAAGCAGAGGGAGCCGGCTCAGG - Intronic
1035337361 7:158138465-158138487 CCTGCAGAGGCAGCCGGCTGAGG - Exonic
1035356636 7:158279731-158279753 CAAGCAGAGGGAGCCGGCTCCGG + Intronic
1035394385 7:158525784-158525806 ACAGCAGAGAGAGGTGGCTGTGG - Intronic
1035463952 7:159063528-159063550 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1035676319 8:1458833-1458855 CCAGGACAGAGAGCAGGGTCGGG + Intergenic
1035683618 8:1507523-1507545 CAAGCAGAGGGAGCCGGCTCCGG + Intronic
1035833861 8:2727798-2727820 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
1036441087 8:8781789-8781811 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1036554703 8:9848153-9848175 CAAGCTGAGGGAGGCGGCTCCGG + Intergenic
1036801321 8:11794768-11794790 CAAGCCGAGGGAGCCGGCTCCGG - Intergenic
1036837609 8:12088726-12088748 CGAGCAGAGGGAGCCGGCTCCGG - Intergenic
1036859402 8:12334974-12334996 CGAGCAGAGGGAGCCGGCTCTGG - Intergenic
1036914928 8:12796258-12796280 CAAGCTGAGGGAGCCCGCTCCGG - Intergenic
1036952567 8:13154596-13154618 CAAGCAGAGGGAGCTGGCTCTGG + Intronic
1037064963 8:14566785-14566807 CAAGCTGAGGGAGCCAGCTCCGG - Intronic
1037239553 8:16760903-16760925 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1037417627 8:18668081-18668103 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1037558909 8:20054754-20054776 CAAGCTGAGGGAACCGGCTCCGG - Intergenic
1037810920 8:22086517-22086539 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1038639353 8:29311428-29311450 CAAGCTGAGGGAGCCAGCTCCGG - Intergenic
1038847650 8:31244503-31244525 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1039068686 8:33631641-33631663 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1039069164 8:33634230-33634252 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
1039579471 8:38652033-38652055 TCAGCTGAGAGAAACGGCTCCGG - Intergenic
1039587565 8:38719828-38719850 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1039637249 8:39180077-39180099 CAAGCTGAGGGAGCCAGCTCTGG - Intronic
1039693515 8:39885271-39885293 CCAGCAGCGACAACCTGCTCAGG - Intergenic
1039797100 8:40924965-40924987 CCACCAAGAAGAGCCGGCTCAGG + Intergenic
1039811209 8:41049857-41049879 CCAGCAGAGCTACCGGGCTCTGG - Intergenic
1040000823 8:42575178-42575200 GAAGCAGAGGGAGCCGGCTCTGG - Intergenic
1040014400 8:42689456-42689478 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1040026502 8:42786738-42786760 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1040323914 8:46331696-46331718 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1040583465 8:48716383-48716405 CAAGCAGAGGGAGCCGGCTCTGG + Intronic
1040622290 8:49103416-49103438 CAGGCTGAGGGAGCCGGCTCTGG + Intergenic
1040701731 8:50074821-50074843 CAAGCAGAGGGAGTTGGCTCTGG - Intronic
1040804295 8:51377480-51377502 CAAGCTGAGGGAGCCGGCTCCGG - Intronic
1041068492 8:54104227-54104249 CAAGCAGAGGGAGCTGGCTCTGG - Intergenic
1041145832 8:54875191-54875213 CGAGCAGAGGGAGCCGGCTCCGG - Intergenic
1041630370 8:60081266-60081288 CCAGAAGAGAGTGGGGGCTCTGG - Intergenic
1041897211 8:62938604-62938626 CCAGCAGAGCTACCGGGCTCTGG - Intronic
1041914474 8:63126072-63126094 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1042169524 8:65978177-65978199 CAAGCAGAGGGAGCTGGCTCTGG + Intergenic
1042335982 8:67630687-67630709 CAAGCAGAGGGAGCCAGCTCCGG - Intronic
1042512619 8:69626869-69626891 CAAGCTGAGGGAGCCGGCACTGG + Intronic
1042742729 8:72068946-72068968 CAAGCAGAGAGAGCTGGATCTGG + Intronic
1042758480 8:72244772-72244794 CAGGCAGAGAGAGCTGGATCTGG + Intergenic
1042948804 8:74179914-74179936 CAAGCAGAGGGAGTCGGCTCCGG + Intergenic
1043002131 8:74771991-74772013 GGAGCAGAGGGAGCCGGCTCCGG + Intronic
1043034462 8:75178797-75178819 TGAGCAGAGGGAGCTGGCTCTGG + Intergenic
1043073399 8:75665862-75665884 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1043129992 8:76448011-76448033 CAAGCTGAGGGAGCCGGCTGTGG + Intergenic
1043435271 8:80231771-80231793 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1043640117 8:82441385-82441407 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1043670589 8:82880652-82880674 CAAGCTGAGGGAGCAGGCTCTGG - Intergenic
1043701074 8:83290314-83290336 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1043731987 8:83694353-83694375 CAAGCTGAGGGAGCCGGCTTCGG + Intergenic
1043857108 8:85276025-85276047 CAACCTGAGGGAGCCGGCTCCGG - Intronic
1044088436 8:87971111-87971133 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1044302932 8:90606501-90606523 GGAGCAGAGGGAGCCGGCTCCGG + Intergenic
1044441593 8:92230752-92230774 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1044459698 8:92429627-92429649 CAAGCAGAGGGAGCTGGCTCTGG + Intergenic
1044788629 8:95823601-95823623 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1044853523 8:96452283-96452305 CAAGCTGAGGGAGTCGGCTCCGG - Intergenic
1044862023 8:96533237-96533259 CCAGCAGTGGGAACCTGCTCGGG - Intronic
1044963868 8:97556877-97556899 CAAGCAGAGGGAGCTGGCTCCGG - Intergenic
1044998153 8:97856705-97856727 CCAGCAGAAAGTGCAGGCTAAGG + Intergenic
1045096171 8:98800550-98800572 CAAGCAGAGGGAGCCGGCTCCGG - Intronic
1045306070 8:100957505-100957527 CAAGCTGAGGGAGCCGACTCCGG + Intergenic
1045407440 8:101880405-101880427 CAAGCAGAGGGAGCTGGCTCTGG + Intronic
1045560477 8:103257221-103257243 TCAGCAGAGAGAGCCGTGTTTGG - Intergenic
1045671118 8:104553984-104554006 CCAGCAGAGCTACCAGGCTCTGG - Intronic
1045678464 8:104633282-104633304 CAAGCATAGGGAGCTGGCTCCGG + Intronic
1045743384 8:105387688-105387710 CAAGCTGAGGGAGCCGGCTCCGG + Intronic
1045987726 8:108268407-108268429 CCTCCAGACAGAGCCAGCTCTGG - Intronic
1046149399 8:110202968-110202990 CAAGCTGAAGGAGCCGGCTCCGG + Intergenic
1046251835 8:111642814-111642836 CAAGCTGAGGGAGCTGGCTCTGG - Intergenic
1046260365 8:111759153-111759175 CAAGCAGAAGGAGCCAGCTCTGG + Intergenic
1046288850 8:112132655-112132677 CAAGCTGAGGGAGCCGGTTCCGG - Intergenic
1046445283 8:114311314-114311336 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1046521443 8:115330961-115330983 CAAGCAGAGGGAGTCGGCTCCGG + Intergenic
1046621168 8:116531050-116531072 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1048576075 8:135690793-135690815 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1048655463 8:136530807-136530829 CAAGCTGAGGGAGCCGGCTGCGG + Intergenic
1048757554 8:137755518-137755540 CAAGCTGAGGGAGCGGGCTCTGG + Intergenic
1048789120 8:138084098-138084120 CAAGCTGAGGGAGCGGGCTCCGG - Intergenic
1049025347 8:139984505-139984527 CCAGGAGAGAGGTTCGGCTCAGG + Intronic
1049157657 8:141076650-141076672 CAAGCTGAGGGAGGCGGCTCTGG - Intergenic
1049381575 8:142319049-142319071 CAGGCAGAGAGAGACGGCGCAGG + Intronic
1049660862 8:143819171-143819193 CCAGCCGAGAGAGCGGGCCCAGG + Intronic
1049746223 8:144264437-144264459 CCTGCATAGACAGCCGGGTCAGG + Exonic
1049774231 8:144397206-144397228 CCAGCAGGTAGGGCCTGCTCTGG + Exonic
1049827201 8:144676767-144676789 CGAGCAGAGGGAGCCGGCTCTGG + Intergenic
1049944561 9:581172-581194 CAAGCAGAGGGAGCCGGCTCCGG + Intronic
1050249907 9:3733775-3733797 CAAGCTGAGGGAGCAGGCTCCGG - Intergenic
1050295061 9:4196376-4196398 CCAGCAGTGGCAACCGGCTCAGG + Intronic
1050891961 9:10835930-10835952 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1050898229 9:10910912-10910934 AGAGCAGAGGGAGCGGGCTCTGG - Intergenic
1050975295 9:11929252-11929274 CAAGCTGAGGGAGCCAGCTCTGG + Intergenic
1051383248 9:16480471-16480493 CAAGCCGAGGGAGCCGGCTCTGG - Intronic
1051459481 9:17295227-17295249 CAAGCTGAGGGAGCCGGCTCTGG + Intronic
1051549824 9:18315727-18315749 CAAGCAGAGGGAGCTAGCTCCGG + Intergenic
1052056711 9:23914811-23914833 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1052075403 9:24135049-24135071 CAAGCTGAGGGAGCCGGCTTCGG - Intergenic
1052122744 9:24738490-24738512 CAAGCAGAGGGAGCTGACTCTGG - Intergenic
1052223222 9:26052973-26052995 CCAGGAGAGAGAGAAGGCTATGG - Intergenic
1052313385 9:27092617-27092639 CAAGCTGAGGGAGCCGGCTGCGG - Intergenic
1052375736 9:27715916-27715938 GCAGAAGAGAGAGCAGCCTCTGG + Intergenic
1052576521 9:30299230-30299252 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1052979493 9:34437887-34437909 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1053153286 9:35756544-35756566 CCAGCCCAGAGAGCAGGCCCAGG - Exonic
1053393348 9:37751840-37751862 CAGGCTGAGGGAGCCGGCTCCGG - Intronic
1053475196 9:38377539-38377561 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1053678251 9:40460998-40461020 CAAGCAGAGGGAGCATGCTCCGG - Intergenic
1053928232 9:43089341-43089363 CAAGCAGAGGGAGCATGCTCCGG - Intergenic
1054285475 9:63163948-63163970 CAAGCAGAGGGAGCATGCTCCGG + Intergenic
1054291327 9:63296535-63296557 CAAGCAGAGGGAGCATGCTCCGG - Intergenic
1054389347 9:64601075-64601097 CAAGCAGAGGGAGCATGCTCCGG - Intergenic
1054506370 9:65915297-65915319 CAAGCAGAGGGAGCATGCTCCGG + Intergenic
1054713789 9:68537413-68537435 CCTGCAGAGAGAGAGGCCTCTGG - Exonic
1054722392 9:68616986-68617008 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1055102621 9:72480599-72480621 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1055461504 9:76524087-76524109 CAAGTTGAGGGAGCCGGCTCTGG + Intergenic
1055557631 9:77490780-77490802 CAAGCTGAGGGAGCCAGCTCTGG + Intronic
1055912118 9:81364631-81364653 CCAGCAGAGATACTGGGCTCTGG - Intergenic
1055925574 9:81507337-81507359 CAAGCAGAGGGAGCCAGATCTGG - Intergenic
1056216222 9:84408442-84408464 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1056305710 9:85289010-85289032 CAGGCTGAGGGAGCCGGCTCTGG - Intergenic
1056735889 9:89209366-89209388 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1056743694 9:89282394-89282416 CAAGCTGAGGGAGCGGGCTCCGG - Intergenic
1056746950 9:89311371-89311393 CCGGCTGAGGGAGCCGGCTCGGG - Intronic
1056799388 9:89681059-89681081 CAAGCGGAGGGAGCCGGCTCCGG - Intergenic
1056913973 9:90729436-90729458 CAAGCGGAGGGAGCCGGCTCCGG - Intergenic
1057357057 9:94340630-94340652 CCAGCAGAGAGAAGCGGGTGAGG + Intergenic
1057511085 9:95680294-95680316 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1057650695 9:96916997-96917019 CCAGCAGAGAGAAGCGGGTGAGG - Intronic
1057726865 9:97574181-97574203 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1058065159 9:100540523-100540545 CTAGCAGAGGGAGCTGGCTCCGG + Intronic
1058174920 9:101724506-101724528 CAAGCTGAGGGAGCAGGCTCCGG + Intronic
1058235736 9:102487336-102487358 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1058365134 9:104200557-104200579 CAAGCAGAGGGAGCTGGATCCGG - Intergenic
1058585415 9:106501689-106501711 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1058609114 9:106755838-106755860 CTGGCAGAGAGAGCTGGGTCAGG + Intergenic
1058727470 9:107817756-107817778 CAAGCTGACGGAGCCGGCTCCGG - Intergenic
1059325441 9:113501505-113501527 CCAGCAGCGGGAGCCCGCACTGG - Intronic
1059443300 9:114323160-114323182 CCAGCAGAGGTAGGAGGCTCAGG - Exonic
1059444492 9:114329931-114329953 CCAGCAGAGGTAGGAGGCTCAGG - Exonic
1059791026 9:117642301-117642323 CCAGCAGTGGTAACCGGCTCAGG - Intergenic
1059891496 9:118809613-118809635 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1060155084 9:121313943-121313965 CCTGCAGGCAGAGCCGGCTTGGG - Exonic
1060305426 9:122406552-122406574 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1060594285 9:124839120-124839142 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1061376225 9:130226363-130226385 TGAGCAGAGAGAGGCGGCTGAGG - Intronic
1061500075 9:130997082-130997104 CCGGCAGAGAGAGCTGATTCGGG - Intergenic
1061585851 9:131567971-131567993 CCAGCCCAGTGAGCCAGCTCTGG - Intergenic
1061948500 9:133922095-133922117 AAAGCAGAGGGAGCCGGGTCCGG - Intronic
1061987652 9:134139160-134139182 CCAGCAGGCAGAGCTGCCTCTGG + Intronic
1062358602 9:136176926-136176948 CCACCTGAGAGAGCTGGCCCGGG - Intergenic
1062364554 9:136202655-136202677 CCAGCCCAGGGAGCTGGCTCCGG + Intronic
1062573928 9:137197883-137197905 CCGGCAGATAGAGCCGGCAGGGG + Intronic
1203662339 Un_KI270753v1:57310-57332 ACAGCAGAGGGAGCTGGCTGTGG - Intergenic
1203662924 Un_KI270753v1:61768-61790 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1185712625 X:2316258-2316280 CCAGCAAAAAGGGCCGGCTGCGG + Intronic
1186293137 X:8121551-8121573 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1188111959 X:26204765-26204787 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
1188167004 X:26874058-26874080 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1188189474 X:27156967-27156989 TAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1188242515 X:27809101-27809123 CAAGCTGAGAGAGCCGGCTCCGG - Intronic
1188881757 X:35499238-35499260 CAAGCTGAGGGAGCCGGCTCCGG - Intergenic
1189187946 X:39070235-39070257 CCAGCAGAGGGAGCCGGCTCTGG + Intergenic
1190045925 X:47111402-47111424 CAAGCTGAGCGAGCCGGCTCTGG + Intergenic
1191618688 X:63192968-63192990 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1192022421 X:67408623-67408645 CAAGCAGAGTGAGCTGGCTCCGG - Intergenic
1192609722 X:72555103-72555125 CCAGCAGAGCTACCCAGCTCTGG - Intronic
1193040245 X:76997040-76997062 CAAGCTGAGGGAGCTGGCTCTGG + Intergenic
1193709017 X:84857000-84857022 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1193719933 X:84974857-84974879 CAAGCAGAGGGAGCTGGCTCTGG - Intergenic
1193804098 X:85972756-85972778 CAAGCTGAGGGAGCCAGCTCTGG + Intronic
1193951826 X:87809077-87809099 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1194025634 X:88746724-88746746 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1194035295 X:88863837-88863859 CGAGCAGAGGGAGCTGGCTCCGG - Intergenic
1194077671 X:89417090-89417112 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
1194118084 X:89926933-89926955 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1194173530 X:90618155-90618177 CAAGCAGAGGGAGCCTGTTCTGG + Intergenic
1194451103 X:94045832-94045854 CAAGCAGAGGGAGCCAGCTCCGG - Intergenic
1194602625 X:95940941-95940963 CCAGCAGAGCTACCAGGCTCTGG - Intergenic
1194890533 X:99372434-99372456 CAAGCTGAGGGAGTCGGCTCCGG + Intergenic
1195256268 X:103094076-103094098 CAAGCTGAGGGAGCCAGCTCTGG - Intergenic
1195258084 X:103107748-103107770 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1195259406 X:103117457-103117479 CAAGCTGAGGGAGCCAGCTCCGG + Intergenic
1195850570 X:109277911-109277933 CCAGCAGCGGCAACCGGCTCGGG - Intergenic
1195896418 X:109749717-109749739 CAAGCTGAGGGAGCCAGCTCAGG + Intergenic
1195909654 X:109876256-109876278 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1196197974 X:112855253-112855275 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1196319590 X:114270958-114270980 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1196616096 X:117769030-117769052 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1196705971 X:118717338-118717360 CAAGCTGAGGGAGCGGGCTCTGG + Intergenic
1196741336 X:119028617-119028639 CAAGCAGAGGGAGCCAGCTCCGG + Intergenic
1197000342 X:121431927-121431949 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1197079007 X:122389258-122389280 AGAGCAGAGGGAGCCAGCTCTGG + Intergenic
1197120153 X:122881088-122881110 CCAGCAGAGCTACCGGGCTCTGG - Intergenic
1197331232 X:125155858-125155880 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1197339993 X:125255609-125255631 CAAGCTGAGGGAGCCGGCTCTGG - Intergenic
1197376858 X:125690978-125691000 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1197533826 X:127663368-127663390 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1197607865 X:128606567-128606589 CAGGCTGAGGGAGCCGGCTCCGG - Intergenic
1198060864 X:133044339-133044361 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1198128613 X:133672376-133672398 CCATCAGAGAGACACTGCTCTGG - Intronic
1198256085 X:134925630-134925652 CAAGCAGAGGGAGCCGGCTCCGG - Intergenic
1198299930 X:135325418-135325440 CAAGCTGAGGGAGCCGGCTCTGG - Intronic
1198604476 X:138322037-138322059 CCAGCAGAGCTATCTGGCTCTGG + Intergenic
1198872352 X:141188897-141188919 CAAGCTGAGGGAGCGGGCTCCGG + Intergenic
1198972647 X:142298644-142298666 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1199094891 X:143726615-143726637 CAAGCAGAGGGAGCCGGCTCTGG + Intergenic
1199097230 X:143757602-143757624 CCAGCAGAGGGAGCCAGCTCCGG + Intergenic
1199134217 X:144231608-144231630 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1199175701 X:144784721-144784743 CCAGCAGTGACAACCCGCTCGGG + Intergenic
1199285146 X:146046554-146046576 CAAGCTGAGGGAGCCAGCTCGGG + Intergenic
1199356300 X:146867277-146867299 CAAGCTGAGGGAGCCGGCTCTGG + Intergenic
1199437491 X:147828876-147828898 TGAGCAGAGAGAGCCAGCTCCGG + Intergenic
1199831831 X:151555549-151555571 CAAGCCAAGGGAGCCGGCTCCGG + Intergenic
1199833077 X:151563178-151563200 CAAGCTGAGGGAACCGGCTCTGG + Intergenic
1200120708 X:153789019-153789041 CCAGCAGAGAGGACTGTCTCAGG + Intronic
1200256170 X:154584551-154584573 CCAGGAGTGAGATCCGGCCCCGG + Intergenic
1200261599 X:154619852-154619874 CCAGGAGTGAGATCCGGCCCCGG - Intergenic
1200267581 X:154654149-154654171 CCAGGAGTGAGATCCGGCCCCGG - Intergenic
1200383504 X:155865338-155865360 TGAGCAGAGGGAGCCGGCTCCGG - Intergenic
1200430322 Y:3072636-3072658 CAAGCAGAGGGAGCCGGCTCTGG - Intergenic
1200439058 Y:3189183-3189205 CCAGCAGTGGCAACCGGCTCGGG + Intergenic
1200470963 Y:3584502-3584524 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1200748438 Y:6922967-6922989 GGAGCAGAGGTAGCCGGCTCCGG + Intronic
1201285530 Y:12375383-12375405 CAGGCTGAGGGAGCCGGCTCCGG + Intergenic
1201429140 Y:13887823-13887845 CAATCTGAGGGAGCCGGCTCTGG - Intergenic
1201712948 Y:17012384-17012406 CTAGCACAGGGAGCCGGCTTCGG + Intergenic
1202109787 Y:21407163-21407185 CAAGCTGAGGGAGCCGGCTACGG - Intergenic
1202136960 Y:21676241-21676263 CCAGCAGTGGCAACCGGCTCGGG - Intergenic
1202137154 Y:21677061-21677083 CAAGCTGAGGGAGCCGGCTCCGG + Intergenic
1202202474 Y:22367558-22367580 CAAGCTGAGGGAGCCAGCTCCGG + Intronic
1202243761 Y:22795352-22795374 CCAGCAGTGGAAGCCTGCTCGGG + Intergenic
1202271544 Y:23078738-23078760 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1202294482 Y:23341944-23341966 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1202396748 Y:24429102-24429124 CCAGCAGTGGAAGCCTGCTCGGG + Intergenic
1202424539 Y:24712482-24712504 CAAGCTGAGGGAGCTGGCTCCGG + Intergenic
1202446250 Y:24957603-24957625 CAAGCTGAGGGAGCTGGCTCCGG - Intergenic
1202474035 Y:25240990-25241012 CCAGCAGTGGAAGCCTGCTCGGG - Intergenic