ID: 1018735720

View in Genome Browser
Species Human (GRCh38)
Location 6:166685935-166685957
Sequence TCCCCCTCCCTCCTAGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 289}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018735720_1018735725 -6 Left 1018735720 6:166685935-166685957 CCATGCCCTAGGAGGGAGGGGGA 0: 1
1: 0
2: 3
3: 36
4: 289
Right 1018735725 6:166685952-166685974 GGGGGACAGAGGGCGAACGAAGG 0: 1
1: 0
2: 0
3: 15
4: 292
1018735720_1018735728 8 Left 1018735720 6:166685935-166685957 CCATGCCCTAGGAGGGAGGGGGA 0: 1
1: 0
2: 3
3: 36
4: 289
Right 1018735728 6:166685966-166685988 GAACGAAGGGGCTGAGACGAAGG 0: 1
1: 0
2: 2
3: 13
4: 138
1018735720_1018735729 18 Left 1018735720 6:166685935-166685957 CCATGCCCTAGGAGGGAGGGGGA 0: 1
1: 0
2: 3
3: 36
4: 289
Right 1018735729 6:166685976-166685998 GCTGAGACGAAGGAGCTGTGAGG 0: 1
1: 0
2: 1
3: 20
4: 215
1018735720_1018735727 -4 Left 1018735720 6:166685935-166685957 CCATGCCCTAGGAGGGAGGGGGA 0: 1
1: 0
2: 3
3: 36
4: 289
Right 1018735727 6:166685954-166685976 GGGACAGAGGGCGAACGAAGGGG No data
1018735720_1018735726 -5 Left 1018735720 6:166685935-166685957 CCATGCCCTAGGAGGGAGGGGGA 0: 1
1: 0
2: 3
3: 36
4: 289
Right 1018735726 6:166685953-166685975 GGGGACAGAGGGCGAACGAAGGG 0: 1
1: 0
2: 1
3: 14
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018735720 Original CRISPR TCCCCCTCCCTCCTAGGGCA TGG (reversed) Intronic
900589481 1:3453414-3453436 CCACCCTCCCTCCCAGGGGATGG + Intergenic
900864549 1:5258876-5258898 TCCCCTTCCCCCCAAGGCCATGG + Intergenic
901303890 1:8218426-8218448 TCCCTCTCCCTCCAAAGACAAGG - Intergenic
901530383 1:9849148-9849170 ACCACCTCCCTCCCAGGGAAGGG + Exonic
901627059 1:10630432-10630454 TCCCCCTCCCTCCCTGGGCCCGG + Exonic
901627757 1:10633366-10633388 TCCCCTTCCCTCCTGGGGTCTGG - Intergenic
901795466 1:11677018-11677040 TTCTCCTCCTTCCTTGGGCAAGG - Intronic
901872238 1:12144942-12144964 TCCCCCTGCCTCCCAGGGCTTGG - Intergenic
902184775 1:14717033-14717055 TACCTCTCCCTCCATGGGCAAGG - Intronic
902442637 1:16440992-16441014 TCCACCTCCCTGCTCGGGCCTGG - Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
904384773 1:30134100-30134122 TCAGGCTCCCTCCTAAGGCAAGG + Intergenic
904702415 1:32365858-32365880 GCCCCCTCCCTTCTTGGGGAGGG + Intronic
904747895 1:32722200-32722222 TCCCCCATCCTCCAAGGGAATGG - Intergenic
904772390 1:32887421-32887443 ACCCCCACCCACTTAGGGCAAGG - Intronic
905273164 1:36800296-36800318 TGCCCCTCCATCCTTGGCCATGG + Exonic
905610729 1:39348809-39348831 TCCCTCTCTCTCCTTGGGCCTGG + Intronic
905649994 1:39649954-39649976 ACCCCCTCCTTCCTAGGCCTTGG - Intergenic
906645060 1:47468945-47468967 TCACCCTCCCTCCTCCTGCAAGG + Intergenic
907126726 1:52056631-52056653 TCCACCTGCCTCCTGGGACAGGG - Intronic
908175597 1:61552398-61552420 ACCCCCTCCCTCCTTGAGAAAGG - Intergenic
910092907 1:83486657-83486679 CCCTCCTGCCTCCAAGGGCAAGG + Intergenic
910269972 1:85384069-85384091 TTCCCCTCACTGCTAAGGCAAGG + Intronic
912141928 1:106740614-106740636 TCTCCCTTCCTCTTAGAGCATGG - Intergenic
912414406 1:109498313-109498335 TCCCCCTTCCTCCCAGGGCTGGG - Intronic
912717307 1:111991126-111991148 TCCCCGTCCCTGCTGGGGCACGG - Intergenic
914678053 1:149918731-149918753 TCCCTCTCACTCCTTCGGCAGGG - Intergenic
915093712 1:153444499-153444521 TCCACCACCCTCCCAGAGCATGG + Intergenic
915474707 1:156146886-156146908 TCCCCCTGCCTTCTGGGGCCAGG + Intergenic
916689238 1:167174589-167174611 TCTCCCTCCTTCCTTGGCCATGG + Intergenic
916721288 1:167486312-167486334 TTCCTCTCCCTCCGAGGCCAGGG - Intronic
919481476 1:198095514-198095536 TCCCACTCCCTTCAAGAGCAAGG - Intergenic
924179113 1:241423964-241423986 TCCCCCACCCTCCTGCAGCAGGG + Intergenic
1062904876 10:1173126-1173148 TCCTCCTCCATCAGAGGGCACGG + Intergenic
1063971532 10:11384640-11384662 TCCACCCTCCTCCTAGGACACGG + Intergenic
1064607767 10:17061643-17061665 CCTCCCTCCTTCCCAGGGCAGGG - Intronic
1066546184 10:36503034-36503056 TCCTCCTTCCTCCTAAGTCAAGG + Intergenic
1066617025 10:37305551-37305573 TCCTCCTCACACTTAGGGCAGGG + Intronic
1067163454 10:43846398-43846420 TCCACCTCATTCCTAGAGCAGGG + Intergenic
1069565312 10:69459956-69459978 TCTCCCTCCCTCCGTGGGCAGGG - Intronic
1069794572 10:71043887-71043909 TCCCCTTCTCCCCTGGGGCAGGG + Intergenic
1070664923 10:78336186-78336208 TCCACCTTACTCCCAGGGCATGG - Intergenic
1072983872 10:100122465-100122487 TCCCCGTGCCCCCAAGGGCACGG + Intergenic
1073251310 10:102121520-102121542 GCCCCTCCCCTCCTAGGGCTGGG - Intergenic
1073288682 10:102402828-102402850 TCCCCCTCTGTCCTGGGGCCTGG - Exonic
1074778811 10:116785740-116785762 ACCCCCTCCCTCCCAGGGAATGG + Intergenic
1075480881 10:122780728-122780750 TCCCCCAGCCTCCTAGGCCAAGG + Intergenic
1075486894 10:122829700-122829722 TCTGCTTCCCTCCTAGGACACGG + Intergenic
1076371033 10:129953754-129953776 TCCCCCTCCTTGCTTGGGCTGGG - Intronic
1076882341 10:133245701-133245723 TCCCCCTGCCCCCTAGGGAACGG - Intergenic
1077306132 11:1869432-1869454 TCCCCCTCCCTCCTCCTTCAAGG - Intronic
1077466343 11:2735429-2735451 TTCCCACCCCTCCTAGGCCAGGG + Intronic
1078094655 11:8289405-8289427 TCCCCCTCTCTCCTGGGGCTTGG - Intergenic
1078731947 11:13982987-13983009 AGCCTCTACCTCCTAGGGCAGGG - Intronic
1078914958 11:15770471-15770493 TCACACTCCCTCTTAGGGGATGG + Intergenic
1079058975 11:17231072-17231094 TCCCCCTCCCACCTAGTCCCTGG + Intronic
1079674482 11:23208501-23208523 TCCCCCTACCGCCTAGTACAAGG - Intergenic
1080015979 11:27506964-27506986 TCCCCCGGCCTCCTAGGGTTGGG + Intergenic
1081197018 11:40173699-40173721 TCCCCCTTCTTCCTAGGGGATGG - Intronic
1081875303 11:46404456-46404478 GCCTTGTCCCTCCTAGGGCAAGG - Intronic
1082824294 11:57566950-57566972 CCCCCCCCCCTCCTAGAACAGGG + Intronic
1083176454 11:60952809-60952831 TCCCCCGGGCTCCTAGGTCAGGG - Intergenic
1083652707 11:64212439-64212461 TCCCTCTCACTCCTTGGCCATGG + Intronic
1084083254 11:66842981-66843003 CCCCCCTCACTCCTAGAGGAAGG + Exonic
1084946827 11:72642883-72642905 TCCCCCTGCCTCCTAGGCTGAGG - Intronic
1084965398 11:72741804-72741826 TCCCCTTCCCTCTTGGGGCAGGG - Intronic
1085615442 11:77994669-77994691 CCCGCCTCCCTCCTAGTGTACGG - Exonic
1086894967 11:92301444-92301466 TCCCCCTCCCTCCTAACGGAAGG - Intergenic
1089298419 11:117483283-117483305 TTCCCCTCCCTCCAGAGGCAAGG - Intronic
1089532079 11:119136760-119136782 TCACCCCTCCTCCTAGGGAATGG - Intergenic
1090416839 11:126546355-126546377 TTCTCCTACCTCCCAGGGCAAGG + Intronic
1094090749 12:26646525-26646547 TCCCCAAATCTCCTAGGGCAAGG + Intronic
1094202547 12:27808499-27808521 TCCCCCTCCCTCAATGGGTACGG - Intergenic
1094651145 12:32376916-32376938 TCCCCCTACCTGCTTGGGCTTGG - Intronic
1094682538 12:32679186-32679208 TCCACCTCCCTCGCAGCGCATGG + Intronic
1095261801 12:40106142-40106164 TCCCGCCCCCTCCTTGGGCGGGG + Intergenic
1096557914 12:52415100-52415122 TTCTCCTCCCTCCTAGTACAAGG - Intergenic
1096681630 12:53259310-53259332 CCCCCTCCCCTCCCAGGGCAGGG - Intergenic
1096700482 12:53380096-53380118 TCCCCCTCCCTCATTGGGCGGGG + Intergenic
1099356692 12:81646073-81646095 TACCCCTTCCTCCTAGGCCAAGG + Intronic
1101535541 12:105613031-105613053 TCTCCCTCCCTCCACAGGCAGGG - Intergenic
1102035485 12:109768577-109768599 ACCCCCTGCCTGCCAGGGCATGG + Exonic
1103449495 12:121018450-121018472 CTCCCCTCCCTCCTTGGGCCCGG - Intergenic
1103775719 12:123364974-123364996 CCCGCCTCCCTCCTAGGTGAAGG + Intergenic
1103914262 12:124368415-124368437 TCCCTCTCCCTCCTAGCCCTAGG - Intronic
1109244864 13:59941398-59941420 TCCTCCTCCCTCATGGTGCAAGG + Intronic
1109409404 13:61943585-61943607 TCCTCTTCCCTCCTGGGTCATGG + Intergenic
1112895489 13:104294661-104294683 ACCCCCTCACCCCTAAGGCACGG - Intergenic
1119218122 14:72884788-72884810 TCCCCCTTCCTTTGAGGGCAGGG - Intronic
1122033170 14:98928354-98928376 TGCCCCTAACTCCTAGGGAAGGG - Intergenic
1122064858 14:99165758-99165780 TGCCTCACCCTCCTAGGCCAGGG - Intergenic
1122070944 14:99204987-99205009 TACCCCTCCATCCAAGGACAGGG - Intronic
1122120787 14:99552368-99552390 TCCCCCTCCCTGCAAGGGCCTGG - Intronic
1122651383 14:103228926-103228948 GCCCCCTGCCTGCTAGGGGAGGG - Intergenic
1122975913 14:105170652-105170674 TCCCCCTCCTTCCTAAGGGCAGG - Intergenic
1124611755 15:31214388-31214410 TCCTCCTCCCTCCCAGGCCAGGG + Intergenic
1127366865 15:58299468-58299490 TCCCCAGCCCTCTTAGGTCAGGG + Intronic
1128481707 15:68045696-68045718 TCCCCCTCCCCCCTCAGGCTTGG + Intergenic
1128545621 15:68565855-68565877 TCCCCCTCTCCCCTGGGGCCTGG + Intergenic
1129331654 15:74830974-74830996 CCCACATCCCTCCTTGGGCAGGG + Exonic
1129411819 15:75354560-75354582 CCCCCCGCCCTCTTAGGGTAAGG - Intronic
1129866909 15:78915824-78915846 CGCCTCTGCCTCCTAGGGCAGGG + Intergenic
1132071935 15:98786034-98786056 TCACCCTCCCTTTTAGGGCTTGG + Intronic
1132659350 16:1054532-1054554 TCACCCCACCTCCTCGGGCAGGG - Intergenic
1133060536 16:3171730-3171752 TCAGCCATCCTCCTAGGGCAAGG + Intergenic
1133287153 16:4695907-4695929 TCCCTCCCCCACCTAGGGCAGGG - Intergenic
1133294318 16:4743472-4743494 TCCTCCTCCTTCCTGGGGGAAGG + Intronic
1133489323 16:6251571-6251593 TCCCCCTACCTCCAAGGGGTAGG - Intronic
1134748304 16:16605061-16605083 CTCTCCTCCCTCCAAGGGCAGGG - Intergenic
1134997159 16:18748554-18748576 CTCTCCTCCCTCCAAGGGCAGGG + Intergenic
1136640216 16:31557737-31557759 TGCCCCTCCCTTCCTGGGCAGGG + Intergenic
1137252477 16:46750113-46750135 TCCCCCACCCGACCAGGGCAGGG + Intronic
1139474948 16:67198492-67198514 CACCCTTCCCTCCTAGGGGAAGG - Exonic
1141250825 16:82357537-82357559 TCCCCTTCCCTCCTCTGGGAGGG + Intergenic
1141746889 16:85931918-85931940 TCCCGCTCCCGGCTGGGGCAGGG - Intergenic
1142350639 16:89577731-89577753 TCCTCCTCCCTCCGAGGGGACGG - Intronic
1143513501 17:7408150-7408172 CCCTCCTCCCTCCTGGGGCGAGG + Intronic
1143673876 17:8416190-8416212 TTCCCCTCCCTCCCAGGCCCTGG + Intronic
1143777069 17:9206467-9206489 GCCCCCTCCCCCCGAGGGCAGGG - Intronic
1143916459 17:10296968-10296990 TCCACCTACCTCCTGGGGCCAGG + Intergenic
1145934275 17:28705840-28705862 TCCCCAGCACTCCTAGGGGAGGG + Intronic
1145992327 17:29086571-29086593 GCCCCCTTCCTCCTAGGAGATGG - Exonic
1147316494 17:39623379-39623401 TCTCCCTTCCCCCAAGGGCAGGG + Intergenic
1147318374 17:39631899-39631921 TCTCCCTCCCACCTTGGGCTGGG + Intronic
1147341623 17:39755966-39755988 GCCCCCTCACTCCTGGGGAAGGG + Intergenic
1147782992 17:42957076-42957098 TCCGCCTCCCTCCCAGTGCTGGG + Intronic
1147911809 17:43860495-43860517 TCCGCCCACCTGCTAGGGCAAGG + Intronic
1148052602 17:44776527-44776549 CCTCCCTCCCTCGTAGGGCTGGG - Intronic
1148209378 17:45799028-45799050 TCCCCATCCCGCCTCGGGCCTGG - Intronic
1148211673 17:45812628-45812650 TCCCCTTCCCAGCTAGGGGATGG + Intronic
1148382480 17:47209905-47209927 TCCCACTACCTCCTAGGAAAAGG - Intronic
1148395224 17:47302866-47302888 TCCCTCTCCCTCCTGGGGCAGGG - Intronic
1148683126 17:49486055-49486077 TCCCCATCACTTCTAGGGAAGGG - Intergenic
1149541695 17:57472444-57472466 TCCCCCTGCCTACTATGGCTAGG - Intronic
1149556004 17:57574060-57574082 TACCCCTCCCTCCCTGGGCTAGG + Intronic
1149606579 17:57929244-57929266 TGCCCCTGCCTCATAGGGCAGGG - Intronic
1149611067 17:57957984-57958006 TTCCCCTTCATCCTAGGGGAAGG + Intergenic
1152320791 17:79608085-79608107 TCGCCCTCCCTCCTCTGACACGG - Intergenic
1152640614 17:81447750-81447772 TCCCCCTGCCTCATAGCTCAGGG + Exonic
1152780879 17:82227032-82227054 TCCCCTCCCCTCTGAGGGCAGGG + Intergenic
1153978506 18:10290080-10290102 CCAGCCTCCCTCCTAGGGCAGGG + Intergenic
1157498130 18:48170921-48170943 TCCCCCTGCCCCACAGGGCAGGG + Intronic
1157851403 18:51055569-51055591 CCCCTCTCCCTCCTATGACATGG - Intronic
1161283522 19:3457819-3457841 TCCCCCTCCCTCCCTGTGCTGGG + Intronic
1161327475 19:3670663-3670685 GCCCCCTCCCACCCAGGGCTGGG - Intronic
1161350869 19:3790795-3790817 TCCCCATACTTCCTAGAGCAAGG + Intronic
1161399080 19:4059640-4059662 CCCCCCACCCACCCAGGGCAAGG + Intronic
1161417198 19:4153962-4153984 TCCCCCTGCCTCCTAGGAGCGGG + Intronic
1162315303 19:9935141-9935163 GCCTCCTCCCTACTAGAGCATGG - Intronic
1162440738 19:10690610-10690632 TCCTCCTCCCTCCCCGGGCAGGG - Exonic
1163153451 19:15428018-15428040 GCCCCCTCCCTGCTGGGGCAGGG - Intronic
1163462607 19:17448134-17448156 TCCTCCTACCTCCTGGGGCCAGG + Exonic
1163524795 19:17814182-17814204 TCCTCCTCCCTCCTGTGGGAAGG + Intergenic
1163819472 19:19487734-19487756 TCCCCCGCCCTCCTGGGGCCTGG - Intronic
1163954044 19:20617752-20617774 CCCCCCTCCCTTCCAGAGCAAGG + Intronic
1164651450 19:29893667-29893689 GCCCTCTCCCTCCCAGGGCCTGG + Intergenic
1164888987 19:31806915-31806937 TCCCCCTTCCTCCTGAGGTAGGG - Intergenic
1166140751 19:40803914-40803936 CACCCCTCCCACCTAGGGGAGGG - Intronic
1166329428 19:42069754-42069776 TCCCCCTCCCCCCTGGAGCCTGG + Intronic
1166368664 19:42289981-42290003 TCACACTCCCTCCTAAGCCATGG + Intronic
1166537108 19:43581198-43581220 TCCCCATCCCACAGAGGGCAAGG + Exonic
1166733199 19:45070008-45070030 TCCCGCTCCCTGCGAAGGCATGG - Exonic
1167208021 19:48115626-48115648 GCCCTCGCCCTCCTAGGGCCTGG - Exonic
1167336290 19:48888086-48888108 TCCTCCTCCAGCCCAGGGCAGGG + Exonic
925918549 2:8624186-8624208 CCCCACTCCCTCCCTGGGCACGG + Intergenic
926325816 2:11784571-11784593 TCCCCCTGCGATCTAGGGCAGGG + Intronic
926400753 2:12493467-12493489 TCCCTCTCCCTCTCAGTGCATGG - Intergenic
926793983 2:16603695-16603717 TCTCCCTGTCTTCTAGGGCAGGG + Intronic
929268910 2:39950973-39950995 TCCCCCTCCCTCCCTGGAGATGG - Intergenic
930022083 2:47007673-47007695 TCCCCCTCCCTGCCAGGGCCTGG - Intronic
930073478 2:47388187-47388209 TCCCCCAGCATCCTAGAGCAGGG - Intergenic
933731330 2:85458483-85458505 TACCCCTCCATGCTAGGGCCAGG - Intergenic
935653956 2:105405765-105405787 ACCCCCTGCCTCCTAGAGCCTGG - Intronic
936807652 2:116356181-116356203 TCCCCCTCCTTCATAGTTCACGG - Intergenic
937853799 2:126658094-126658116 ACCCCTTCCATCCAAGGGCAAGG - Intronic
937972371 2:127560570-127560592 TGTCCCTGCCTCCCAGGGCAGGG - Intronic
938071995 2:128313616-128313638 TCCTCCTCCCTCCTGGGCCCTGG + Intronic
939124312 2:138157200-138157222 TCCTCCTTCCTGCCAGGGCAAGG + Intergenic
939490776 2:142874005-142874027 TCCCTCTCCCTCCTACAACAGGG - Intergenic
940722467 2:157297375-157297397 TCCACCTCCCTCCTAGAGTTAGG - Intronic
941003025 2:160221344-160221366 TCCCCCACCCTCTGAGTGCAGGG + Intronic
942656703 2:178221099-178221121 TCCCCCTCCATTCTGGGGCTTGG + Intronic
943320110 2:186434994-186435016 CCCCCCTTCCTGATAGGGCATGG + Intergenic
943943605 2:194029790-194029812 TCCCCCTCACCCCCAGGGAAGGG - Intergenic
944689840 2:202149090-202149112 TCCCGCCCCCTGCTAGGGTAGGG - Intronic
945720018 2:213407571-213407593 TCTCTCTCTCTCCTAGGGTAGGG - Intronic
946015848 2:216603227-216603249 TCCCCCACCCTCCCAGTGTAGGG - Intergenic
946202066 2:218076308-218076330 TCCCCAGCCCTGCCAGGGCATGG + Intronic
946248444 2:218399929-218399951 TCCCCCTCCCCCCTAGAACCTGG + Exonic
947713070 2:232326739-232326761 TCTCCCTCCCTCCTGGGGCTGGG - Intronic
947745211 2:232503660-232503682 GCCCCCTCCCTCCCCGGGCTCGG - Intergenic
947834092 2:233162973-233162995 TCCCCGGCCCTCCTGCGGCATGG - Intronic
947844917 2:233236262-233236284 TCCCGCTCCCACCTAGGACTCGG + Intronic
947872703 2:233448384-233448406 TGCCCCTCCCACCCAGGGCACGG - Intronic
948167306 2:235872997-235873019 TCCTCTGCCCTCCTGGGGCACGG - Intronic
1169212866 20:3777572-3777594 CGCCCCTCCCTCCTCGCGCACGG - Exonic
1170799759 20:19581455-19581477 TGCCTCTCCCTACAAGGGCATGG - Intronic
1172947323 20:38699668-38699690 TCCACCTGCCTCCTTGGGCTTGG - Intergenic
1173085205 20:39909469-39909491 TCCTCTTCTCTCCCAGGGCATGG - Intergenic
1173135213 20:40433334-40433356 TCCTCCTCCTCCCCAGGGCAGGG - Intergenic
1173410059 20:42802243-42802265 TCCCCAGCCCTGATAGGGCAGGG + Intronic
1173593314 20:44241994-44242016 GCTCTCTCCCTCCTTGGGCAGGG + Intergenic
1173672164 20:44806193-44806215 TCCCCCTCCCGCCTGGGAGAAGG - Intronic
1174063329 20:47847279-47847301 CCCCCAACCCTCCTTGGGCAAGG - Intergenic
1174072386 20:47908386-47908408 CCCCCAACCCTCCTTGGGCAAGG + Intergenic
1174103086 20:48142137-48142159 TGTCCCTTCCTCCTAGGGGATGG + Intergenic
1174151679 20:48490312-48490334 CCCCCAACCCTCCTTGGGCAAGG - Intergenic
1174281937 20:49445798-49445820 TCCCCCTCCCTGCTCTGGCAGGG + Intronic
1175758904 20:61547975-61547997 TCCCCCTCCCCTCAAGGCCAAGG - Intronic
1175940617 20:62535977-62535999 TCACCCTCCCTTCTAGGCCTGGG - Intergenic
1176169500 20:63690573-63690595 TGCCTCTCCCTCCTAGGGCAGGG + Intronic
1176234163 20:64046511-64046533 TGCACCTCCCTCCTGGGGGAAGG - Intronic
1178512016 21:33213276-33213298 TCCCACTGCCTCCTAGTCCAGGG + Intergenic
1179574585 21:42299786-42299808 TCCCCCTCACCCCCAGGGCCTGG - Intergenic
1179906632 21:44426257-44426279 ACCCCCGCCCTCCTGGTGCAGGG + Intronic
1179997566 21:44981053-44981075 GCCCCCTCCCACCTGCGGCAGGG - Intergenic
1180048421 21:45320402-45320424 TGCCCTGCCCTCCTAGGGCCAGG - Intergenic
1180138896 21:45878905-45878927 TCACCCTTCCTCCTGGAGCACGG - Intronic
1180211069 21:46295765-46295787 GCCTCGTCCCTCTTAGGGCAGGG + Intronic
1180944189 22:19680637-19680659 TCCCCCTCCCTGCTGGGGGTGGG + Intergenic
1181467948 22:23120347-23120369 ACCCCCTCTCTCCAAGGCCAAGG - Intronic
1181635569 22:24172856-24172878 TCCACCTGCCACCCAGGGCAGGG + Intronic
1182120256 22:27781813-27781835 TCCCACTATCTCCTGGGGCAGGG + Intronic
1182742697 22:32580065-32580087 TCCCCTCCCCGCCTAGGCCAGGG - Intronic
1183253071 22:36743995-36744017 TTCCCCTTCCTCTTAGGTCATGG + Intergenic
1184298586 22:43541801-43541823 TCCCCCTCCCTCCCCTGGCCTGG + Intronic
1184450224 22:44578186-44578208 TGCCCCTCCCTCCTGGGTCCCGG + Intergenic
1184453601 22:44597079-44597101 TCCCTCTCCCTCTCTGGGCAGGG - Intergenic
1184698155 22:46150904-46150926 TCGGCCTCCCTCCTAGCGCTGGG + Intronic
949939693 3:9145474-9145496 TCCCCTTTCCTCCTAAGACATGG + Intronic
953454336 3:43029939-43029961 TCCCCTTCCTTCCAACGGCATGG - Intronic
954553725 3:51502657-51502679 TTCCCCTGCCTCCTAGGCCCTGG - Intergenic
954613734 3:51959197-51959219 TCCCCCTGCCTCCTTGTGCAGGG + Intronic
954624507 3:52015278-52015300 CCCCACTCCCTCCTGGGGTAGGG + Intergenic
956282390 3:67571252-67571274 TCCACCTCCACCCTAGGGGATGG + Intronic
961213694 3:125143807-125143829 GCCCCTTCCCTCCCAGGCCAGGG - Intronic
962978044 3:140463413-140463435 TCCCCCTGCCTGCTAGGAAAGGG + Intronic
964445620 3:156754290-156754312 TCTCCCTCCCTTGTTGGGCAAGG - Intergenic
964503080 3:157369831-157369853 TCTGCTTCCCTCCTAGAGCAAGG + Intronic
964542792 3:157798451-157798473 TCCCCATCCCTCCTAGGCCTAGG - Intergenic
964600627 3:158497209-158497231 TCCCCCTCCCCCCTAGCCCCTGG + Intronic
966872297 3:184299057-184299079 TCCACCTGCCTCCGAGGGCGGGG + Exonic
968230549 3:197002778-197002800 TCGGCCTCCCTCCCAGCGCACGG + Exonic
968808215 4:2788487-2788509 TCCCCATCCCACCCAGGGCAAGG + Intergenic
969401157 4:6956563-6956585 GCCACCTTCCTCCTAGGGCCAGG - Intronic
970859224 4:20682822-20682844 TGCCACTCCCTCCCAGGGCTGGG + Intergenic
971642280 4:29149705-29149727 TGCCCCTTCCTCCTAGTGTAGGG - Intergenic
973123305 4:46551219-46551241 TCCCCCTCCCTCCCAACACATGG - Intergenic
974736061 4:65934460-65934482 TCCCCCTTACTCCTAGGCCCAGG - Intergenic
976605257 4:86976608-86976630 TCCCCCTCCATCCTCTGGTAGGG - Intronic
978073166 4:104495249-104495271 TCGCCCTCCCTCCTCGCGCCCGG + Intergenic
980087691 4:128409048-128409070 TCCCCCTTCCCCCTAGGGATGGG + Intergenic
981583269 4:146272094-146272116 TCCCCCTACAGCCTAGAGCAGGG + Intronic
981594954 4:146409450-146409472 TCCCCCTCCCTCCCAGCCCTTGG - Intronic
986786360 5:11117822-11117844 TCCCCCACCCTCCACGGTCATGG - Intronic
991957308 5:72008000-72008022 GCCCCTTCCCTCCCAGGACAAGG - Intergenic
992688965 5:79224666-79224688 TCTCCCTCCCTCCTTGCTCAGGG - Intronic
997470723 5:134115430-134115452 TCCCCGTCCCACCGAGGCCAGGG - Intronic
997735364 5:136209041-136209063 TCTTTCTCCCTCCTAGTGCAGGG + Intergenic
998583795 5:143404992-143405014 TCCCCCTCAGTCCAAGGGGAAGG + Intronic
999135560 5:149316389-149316411 TCCACCTCACCCCCAGGGCAGGG + Intronic
999191250 5:149749005-149749027 CCCCACTCACTCCTAGGGCCTGG - Intronic
1000197918 5:158977846-158977868 TCCTCCCTCCTCCTAAGGCAGGG - Intronic
1001059309 5:168474997-168475019 TCCCTCTCCCTCCTATCACAAGG - Intergenic
1001099020 5:168798637-168798659 TCCTGCTGCCTCCTGGGGCAGGG - Intronic
1001763689 5:174227852-174227874 TCCCACTCCTTCCTCCGGCAGGG - Intronic
1001940535 5:175736724-175736746 CTCCCCTCCCTCCTGGGGCATGG - Intergenic
1004369558 6:15040323-15040345 ATCCACTCCCTTCTAGGGCATGG + Intergenic
1007687679 6:43676712-43676734 TTCCCCTCCCTGCAAGGGCCTGG + Intronic
1008502276 6:52195528-52195550 TCTCCCTCCCTTCTGGAGCAGGG + Intergenic
1010245137 6:73655185-73655207 TCGCCCTCCCTTCTAGGTAAAGG - Intergenic
1011300506 6:85867723-85867745 ACCCCCTCCCTTCCAGAGCAAGG - Intergenic
1012029476 6:94039339-94039361 TCCTTCTCCCTCCAAGTGCAAGG - Intergenic
1012987509 6:105890675-105890697 TCCTCCTCCCTGCTTGGGGATGG + Intergenic
1013507483 6:110814898-110814920 TCCGCCTCGCCCCTCGGGCACGG + Intronic
1017097431 6:150817125-150817147 CCACCCACTCTCCTAGGGCAGGG - Intronic
1018735720 6:166685935-166685957 TCCCCCTCCCTCCTAGGGCATGG - Intronic
1018847514 6:167565957-167565979 TCCCACACCCTCCTAGCTCAGGG + Intergenic
1019325242 7:434993-435015 TCCCCCACCTTCCTGGGGCAAGG + Intergenic
1022529435 7:31057762-31057784 CTCCTCTCCCTCCTAGGGCCAGG - Intronic
1022898962 7:34782564-34782586 AAACCCTCCCTCATAGGGCATGG + Intronic
1022946639 7:35291911-35291933 TAGCCCTCCCTCCAAGGGCCAGG + Intergenic
1023495355 7:40789266-40789288 TTCCCCTCCCTCTTAGGTCCTGG + Intronic
1023541850 7:41274518-41274540 TCCCCCTCCCTCTCACCGCATGG + Intergenic
1024051090 7:45623905-45623927 TCCCACACCCTCACAGGGCAGGG - Intronic
1027309766 7:76943152-76943174 CCCTCCTGCCTCCAAGGGCAAGG + Intergenic
1032197645 7:129798727-129798749 GACCCCTCCCTCCTGGGGGATGG + Intergenic
1034257537 7:149732859-149732881 TCTCACTGACTCCTAGGGCAGGG + Intronic
1035491233 7:159280573-159280595 TGCTCCTTGCTCCTAGGGCATGG + Intergenic
1036791243 8:11721698-11721720 TCCTCTTCCTTCCCAGGGCAGGG - Intronic
1038544008 8:28411979-28412001 TCCCTCTCCCTCCCAGGCCCGGG - Intronic
1040653066 8:49471993-49472015 TTACCCTGCCTTCTAGGGCAAGG + Intergenic
1041453393 8:58031965-58031987 TCCCCATTCCTGCCAGGGCATGG - Intronic
1042212582 8:66395920-66395942 TCCCCCTCCCTCATAGCCCCTGG - Intergenic
1042696228 8:71557216-71557238 TCCCACTCCCGCCTAGCGCTAGG - Intronic
1044838079 8:96315016-96315038 TCCCCTTCCCTCCTTGTGCCGGG + Intronic
1045497322 8:102719515-102719537 TCTCCCACCCCACTAGGGCAGGG + Intergenic
1048727296 8:137400876-137400898 TCCCCTTCCCTGCTCGAGCAGGG + Intergenic
1049005878 8:139855368-139855390 TACCCCTGCCTGCTAGGGCCTGG - Intronic
1049414200 8:142487960-142487982 CCCCACTCCCTCCTGGGACAGGG - Intronic
1049513059 8:143039474-143039496 TCCCCCAGCCTCCTGGGGCCCGG - Exonic
1049613200 8:143565327-143565349 TCCCCCTCCCTCATGGTGCCCGG - Intergenic
1050107316 9:2178869-2178891 TCCCCCTCCCTCCCAGAGCAAGG - Intronic
1053129615 9:35607568-35607590 GCCCCCTCCCTGCAGGGGCAGGG - Exonic
1053224263 9:36339060-36339082 TCCCCTTCCCTCCCAGTGAATGG - Exonic
1056719010 9:89057706-89057728 TCTCCCTAGATCCTAGGGCAGGG - Intronic
1056754576 9:89373710-89373732 TCCCCCAGCCACCCAGGGCAGGG - Intronic
1057215051 9:93223370-93223392 TCCCCACCCCACCTAAGGCACGG - Intronic
1057480579 9:95442109-95442131 TCCCCCTCCCCTCTAGGAAAGGG + Intergenic
1059348731 9:113649662-113649684 TCCCCAGCCTTCCTAGAGCAAGG + Intergenic
1060863347 9:126974596-126974618 TCCTCCTTCCTCCTAGTCCAGGG - Intronic
1061512596 9:131070044-131070066 TCCCCCATCCACCTAGAGCAGGG - Intronic
1061855591 9:133440406-133440428 TACCCCTCCCTCCTGGAGGATGG + Exonic
1062153233 9:135032207-135032229 TATCCCTCCCTCCCAGGGCAAGG - Intergenic
1062153376 9:135032880-135032902 TATCCTTCCCTCCCAGGGCAAGG + Intergenic
1062728919 9:138097627-138097649 TCCCTCATCCCCCTAGGGCACGG - Intronic
1185678368 X:1867210-1867232 CCCACCTCCCTCCCAGAGCAAGG + Intergenic
1186375946 X:9001451-9001473 TCCTCCTCCCTCCTAGCCCCTGG - Intergenic
1186466419 X:9786942-9786964 TCCCCCTCCCTCCTCCGGGCAGG + Intronic
1187499000 X:19823096-19823118 TCCCCCTCCCCACTAGAGAATGG - Intronic
1188833773 X:34932155-34932177 TCCCCTTCCCTGCCAAGGCAAGG + Intergenic
1190129052 X:47730286-47730308 TCCCCCTCTCCCCTAGGCCATGG - Intergenic
1190218407 X:48495309-48495331 TCCCCCTCCTTCCAGGAGCAGGG - Intergenic
1190301158 X:49058411-49058433 TACCCTTTCCTCCCAGGGCAAGG - Intronic
1190401047 X:50035299-50035321 TTCCCTTCCCTCATAGGGCAAGG + Intronic
1190784765 X:53635067-53635089 TCTCCCTGCCTCATGGGGCAAGG + Intronic
1193427320 X:81355314-81355336 TCCCCCTCCATGCTTGGGAATGG + Intergenic
1199270034 X:145872595-145872617 TCCCCCTTCCCCCTAGAGCCAGG - Intergenic
1200042397 X:153379702-153379724 TCCACCTCCTGCCTTGGGCAAGG - Intergenic