ID: 1018742705

View in Genome Browser
Species Human (GRCh38)
Location 6:166742831-166742853
Sequence CTGGCTTCTCAGTGTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018742705_1018742707 3 Left 1018742705 6:166742831-166742853 CCTGCAAAACACTGAGAAGCCAG 0: 1
1: 0
2: 3
3: 24
4: 254
Right 1018742707 6:166742857-166742879 CACAAACAGACCCCATAGAACGG 0: 1
1: 0
2: 1
3: 24
4: 220
1018742705_1018742713 23 Left 1018742705 6:166742831-166742853 CCTGCAAAACACTGAGAAGCCAG 0: 1
1: 0
2: 3
3: 24
4: 254
Right 1018742713 6:166742877-166742899 CGGGAGCGTTCCCATTATGGAGG 0: 1
1: 0
2: 0
3: 0
4: 34
1018742705_1018742712 20 Left 1018742705 6:166742831-166742853 CCTGCAAAACACTGAGAAGCCAG 0: 1
1: 0
2: 3
3: 24
4: 254
Right 1018742712 6:166742874-166742896 GAACGGGAGCGTTCCCATTATGG 0: 1
1: 0
2: 0
3: 1
4: 16
1018742705_1018742708 4 Left 1018742705 6:166742831-166742853 CCTGCAAAACACTGAGAAGCCAG 0: 1
1: 0
2: 3
3: 24
4: 254
Right 1018742708 6:166742858-166742880 ACAAACAGACCCCATAGAACGGG 0: 1
1: 0
2: 0
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018742705 Original CRISPR CTGGCTTCTCAGTGTTTTGC AGG (reversed) Intronic
900138892 1:1130824-1130846 TTGTCTTCTCAGTGTTTTGGTGG + Intergenic
900489122 1:2937604-2937626 CCGGTTTCCCAGTGTTTGGCCGG + Intergenic
900503522 1:3018037-3018059 CTGGCTGCTCAGTGTCTCACTGG - Intergenic
901032142 1:6313375-6313397 CTGGCTTCTGAGGTTTTTGCTGG - Intronic
901059363 1:6465061-6465083 GGGGCTTCTCAGTGCTTGGCAGG - Intronic
902601848 1:17545270-17545292 CTGGATTCCCAGTGGTGTGCTGG - Intronic
905920332 1:41714989-41715011 CTGGCATCTCACTGGTCTGCTGG + Intronic
907305776 1:53512490-53512512 GTGGCTCCCCAGTGGTTTGCTGG - Intronic
907580895 1:55571780-55571802 CTGCCTTCTCCCTTTTTTGCTGG + Intergenic
908071253 1:60462877-60462899 CTGGCTCCTCTTTGTTTTCCAGG - Intergenic
908257261 1:62313312-62313334 ATGGCTTCTCAGTCTCTTCCTGG + Intronic
908784318 1:67720101-67720123 CAGGCTTCTCAGAGCTGTGCAGG - Intronic
909723976 1:78811512-78811534 CTCTCTTCTAAGTGTTCTGCTGG - Intergenic
909867416 1:80690913-80690935 CTGCCTTTTGAGTCTTTTGCTGG - Intergenic
914865798 1:151427791-151427813 CTGGCTGCTCAGAGTCTTTCAGG + Intronic
915307490 1:154988936-154988958 CTGCCCTCTCAGGGATTTGCAGG - Intronic
915478431 1:156168518-156168540 CTGGCCTCTCAGGTTTTTGTTGG + Intronic
915599466 1:156913414-156913436 CTGGCCGCTCAGGGTTCTGCAGG - Exonic
915728879 1:158038581-158038603 CTGTAATCTCAGTGTTTTGGGGG - Intronic
916214509 1:162383988-162384010 CTGTCTTCTCAGTGAATTGCAGG + Intronic
921179455 1:212620139-212620161 CTGGTTTCTAAGAGTTTTGGGGG + Exonic
922060719 1:222088777-222088799 CTTCCTTCTTAATGTTTTGCAGG + Intergenic
922124530 1:222709802-222709824 TTGGCTTCTCAGTGCTTTGAGGG + Intronic
923575078 1:235151020-235151042 CTGAGTTCACAGTGTTTTGTTGG + Intronic
923660626 1:235954324-235954346 CTGGCCTGTGAGTGTTTTGAAGG - Intergenic
924718452 1:246601006-246601028 CTGGCGTCTCATTGTTTGGTGGG - Intronic
1062873478 10:927214-927236 CTGTCTTCTCATAGTTTTTCTGG - Intronic
1064254792 10:13734267-13734289 CTGGTTTCTCAGTCTTGTCCTGG + Intronic
1064310284 10:14206260-14206282 CTGGGTTGTCAGTTTGTTGCTGG - Intronic
1064872923 10:19960098-19960120 CTGACATCTCAGTGCTTTGGGGG + Intronic
1065210804 10:23401035-23401057 CAGACTTCTCAGTGTATTTCTGG - Intergenic
1067006903 10:42672885-42672907 CTGGCTTCTCTGTTCTATGCTGG + Intergenic
1069207035 10:65702602-65702624 CTGGATTATTTGTGTTTTGCTGG - Intergenic
1070527384 10:77306945-77306967 CTGGCTTCTGAGTGGCTTCCAGG - Intronic
1070615227 10:77964516-77964538 CAGGCTTTTCAGTGTTTTTCTGG - Intergenic
1073309215 10:102527817-102527839 CTGGCTTCCCAGAGTTCTGGAGG + Intronic
1075027041 10:118992890-118992912 CTGGGTTCTTAGTGTTCTGGTGG + Intergenic
1075988150 10:126806329-126806351 ATGGCTTCTCATGGTTTTGTGGG - Intergenic
1076090575 10:127682043-127682065 CTGGCTTTTCAGACTCTTGCTGG + Intergenic
1076645721 10:131952869-131952891 CTGTCTTATCAGTGACTTGCGGG + Intronic
1077712782 11:4553029-4553051 CTTGCTTCTCAGTGTTCATCAGG - Intergenic
1078101946 11:8335136-8335158 CTGGCCTCTCTGCGATTTGCAGG - Intergenic
1078129795 11:8604027-8604049 CTGACTGCTCATTGTTGTGCAGG - Intergenic
1078191746 11:9096788-9096810 TTGGCTTCTCAGGGTTTCTCTGG - Intronic
1078192170 11:9100121-9100143 TTGGCTTCTCAGGGTTTCTCTGG - Intronic
1078939623 11:15987392-15987414 TAGGCTTCTCTGTGTTCTGCTGG + Intronic
1080478112 11:32617202-32617224 GTGACTTCTCAGTGTCTTCCTGG - Intronic
1080655306 11:34253337-34253359 CTGGCTTCTCAGAGCTGTGCAGG - Intronic
1081536378 11:43999491-43999513 CTGGGGTCTCAGTTTCTTGCAGG + Intergenic
1082095299 11:48124971-48124993 CCGGCTTCTCTCTGTATTGCTGG - Exonic
1085263644 11:75223731-75223753 CTCTCTTCTCAGTTTTTTCCTGG + Intergenic
1085602054 11:77863770-77863792 CTGTCATCTCAGTGCTTTGAGGG - Intronic
1086625352 11:88944203-88944225 CTGGCTTCTCTCTATTTTTCTGG - Intronic
1089115481 11:116091672-116091694 TTGGCTTCTTTGTGTTTTGGAGG - Intergenic
1090373642 11:126274195-126274217 CTGGCTTGTGAGTGTTCTGTTGG + Intronic
1092615451 12:10212414-10212436 CTGGCGTCACAGTGTTTGGGCGG - Intergenic
1093560218 12:20529643-20529665 CTGGCTTCTGTTTGGTTTGCTGG - Intronic
1094670572 12:32564253-32564275 CTTGCAGCTGAGTGTTTTGCTGG - Exonic
1095691268 12:45091961-45091983 CTGGCTGCTCTGTGGATTGCAGG - Intergenic
1095694824 12:45132586-45132608 ATGGCTTCCCAGTTTTGTGCTGG - Intergenic
1097053538 12:56237458-56237480 CTTGTTTCTCAGACTTTTGCGGG - Intronic
1097087419 12:56478684-56478706 CTCGCTTCTCAGAGATTTCCTGG - Exonic
1099945130 12:89235373-89235395 CTGCCTTCTCATTGTTTTGCAGG - Intergenic
1101332330 12:103767285-103767307 CTGGCTTCTTAATGTTTTCAAGG - Intergenic
1101848127 12:108380009-108380031 CTGGCCTCCAAGTGTTTTACTGG + Intergenic
1102150594 12:110687268-110687290 CTGGCTTCCCAGTGCTTAGCTGG - Intronic
1102582416 12:113898615-113898637 CTTGCTTCTCTGAGTCTTGCCGG - Intronic
1104469265 12:129016353-129016375 CAGGCTCCTCCATGTTTTGCAGG - Intergenic
1106981242 13:35284340-35284362 CTGTCTTTACAGTATTTTGCAGG + Intronic
1107169168 13:37319049-37319071 TTAGCTTGTCAGTGTGTTGCTGG - Intergenic
1107345220 13:39452980-39453002 CTGGCATCTCAGTTTATTCCAGG - Intronic
1107732659 13:43364447-43364469 CTGGCTCCTCTCTGTGTTGCCGG + Intronic
1109790790 13:67244022-67244044 CTTACTTCTCACAGTTTTGCGGG - Intergenic
1110617550 13:77558220-77558242 CTGGCTTCCCTGGGTTTTCCTGG - Intronic
1111823396 13:93240977-93240999 CTGGCTTGTGAGTTTTTTGCTGG + Intronic
1113148915 13:107240306-107240328 CTTACTTCTCAGAGTTTTGGAGG - Intronic
1113482977 13:110635187-110635209 CTGGGTTCTGAGAGCTTTGCAGG - Intronic
1114393872 14:22339048-22339070 CTGGCTTCTGGGTGTTTTGTTGG - Intergenic
1115171143 14:30508173-30508195 CTGGTATCTGAGTGTTTTGTTGG + Intergenic
1120274858 14:82359681-82359703 CTGGCTTCTCAGTTCCTTGAGGG + Intergenic
1121126364 14:91409430-91409452 CTGTCATCCCAGTGTTTTGGGGG - Intronic
1122268008 14:100555641-100555663 CTGGCATCTCAGTGTGAGGCTGG - Intronic
1127289721 15:57559603-57559625 CTGGCTTCCCACTGCTTTTCTGG + Intergenic
1127797830 15:62453842-62453864 CTTTCTCCTCAGTGTTTTGGAGG + Intronic
1129864053 15:78889199-78889221 CTGGCTTCTGAGTCTTTTGAAGG + Intronic
1130339372 15:82986307-82986329 TGGGCTTCTCAGTGTCTCGCCGG + Exonic
1130639227 15:85655317-85655339 ATGGCTTCTCAGTGGATTCCAGG - Intronic
1133393527 16:5428227-5428249 CTGGCTTCTCAAGGTTTGCCTGG - Intergenic
1134591339 16:15456188-15456210 GTATCTTCTCAGTGTTTTGTTGG + Intronic
1135659895 16:24287061-24287083 CTAGCTTCTGAGTTGTTTGCAGG - Intronic
1135736389 16:24934928-24934950 CTGGGTTCTCTGTGCTTTGGTGG - Intronic
1136126480 16:28186186-28186208 GTTGCTTCTCACTCTTTTGCAGG + Intronic
1138266063 16:55660489-55660511 CTGGCTTCTCTGTCTTTTTGTGG + Intronic
1138425586 16:56930133-56930155 CAGGCTTTTCAGTGTTTTTGTGG + Intergenic
1138924638 16:61576334-61576356 GTGACTTCCCAGTGCTTTGCTGG - Intergenic
1139691984 16:68646792-68646814 AAGGGTTCTCAGTGTTTTGAAGG - Intronic
1139889746 16:70242320-70242342 ATGGCGTCTCAGTGTTTCCCAGG - Intergenic
1141448511 16:84080422-84080444 GTGACTTCTCAGTGTCTTGTGGG - Intronic
1141450186 16:84094222-84094244 GTGGTTTGTGAGTGTTTTGCAGG - Intronic
1141781575 16:86165524-86165546 CTGGCTTCTCACTGAATGGCAGG - Intergenic
1142343541 16:89539068-89539090 CTGAGTTCTGAGTGTTTTCCAGG + Intronic
1143102255 17:4510851-4510873 CTGCCTTCTGCGTGGTTTGCTGG - Intronic
1144898899 17:18565249-18565271 CTGGCTTATAAGGTTTTTGCCGG - Intergenic
1146211877 17:30949439-30949461 CTGGCTTCTGAGTGTCTTCGAGG - Intronic
1146297359 17:31660286-31660308 CTCACTTCTCAGTGTTGTCCTGG + Intergenic
1147492381 17:40882081-40882103 CTGGCTTGCCAGTGTTTTACAGG - Intronic
1148857898 17:50588980-50589002 CTTGCTTCTCACTGTCTCGCTGG - Intronic
1151710098 17:75799506-75799528 GTTGCTCCTCTGTGTTTTGCTGG + Intronic
1153713376 18:7821765-7821787 CTGGCTACTAAGTGATTTGTGGG + Intronic
1158042316 18:53110315-53110337 CTCTCTTCTCAGTGTTATGTGGG + Intronic
1159482898 18:69013623-69013645 CTGGCTTTCCAGTGTATTACAGG - Intronic
1159605903 18:70474620-70474642 CAGCCTTCCCAGTGTTGTGCTGG + Intergenic
1159877024 18:73823685-73823707 CTGGCTTTTCTGTTTTTTGTTGG - Intergenic
1160743570 19:699328-699350 CTGGCTCCTCACTGTGTGGCAGG - Intergenic
1161023559 19:2023728-2023750 CTGGCTTCTCTCTGTTTTCATGG - Intronic
1162068272 19:8138527-8138549 CCTGCTTCTCAGTGCTTTTCGGG - Exonic
1162109949 19:8394593-8394615 CTGGGTCCCCAGTGCTTTGCAGG - Intronic
1162280759 19:9695789-9695811 CGGGTTTCTCAGTGTTTGTCAGG - Intronic
1162588475 19:11576075-11576097 CTGGCTTTGGAGTGTTTTCCTGG + Intronic
1162837426 19:13330043-13330065 CTAGCTTCTCATTATTTTGTGGG - Intronic
1163095614 19:15055060-15055082 CTGTATTCCCAGTGTTTTGGGGG - Intronic
1165400477 19:35596531-35596553 CTGGCTTCTGATTGGTTTGATGG - Intergenic
1165640894 19:37385346-37385368 CTGTGTTCTCTGTGTCTTGCAGG + Intronic
1168357558 19:55711889-55711911 CAGGCTCCTCAGTGTTTTGCAGG + Exonic
925529020 2:4838983-4839005 CAGGGCTCTCAGTGTTCTGCTGG + Intergenic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
932123644 2:69124134-69124156 CTGGACTCTCAGTGATTTGATGG - Intronic
932216668 2:69970530-69970552 TTGACTTCTCAGTGTTTGCCAGG - Intergenic
934658070 2:96127108-96127130 CTGGCTTCTTAATGTTTTCAAGG - Intronic
935772000 2:106433748-106433770 CAGTCTTCTGAGTGTTTTGTTGG - Intronic
935817799 2:106863616-106863638 CGGATTTCTCAGTGTTTTGCAGG - Intronic
935908069 2:107862197-107862219 CAGTCTTCTGAGTGTTTTGTTGG + Intronic
936182089 2:110275779-110275801 CTGGCAGCTCAGTGGTGTGCTGG - Intergenic
936230479 2:110695894-110695916 CTGGCAGCTCAGTGGTGTGCTGG + Intergenic
937499238 2:122460652-122460674 CTTGCTTCTCAGGGTTTTTATGG + Intergenic
937552783 2:123114967-123114989 CTGGCTTATAAGACTTTTGCTGG - Intergenic
938575279 2:132597638-132597660 ATGGCTTTACAGTGTTTAGCAGG - Intronic
939688493 2:145228373-145228395 CTGGTTTCTCATTGCTCTGCAGG + Intergenic
940173808 2:150856780-150856802 CTGTGTTCTCAGTGCATTGCAGG + Intergenic
940815460 2:158292671-158292693 CTGCCTTCTGAGTTTCTTGCTGG + Intronic
941303488 2:163831269-163831291 CTGTTTTCTCAGAGTTCTGCAGG + Intergenic
941366670 2:164618916-164618938 GAGGCTTCTCTTTGTTTTGCTGG + Intronic
941892388 2:170595732-170595754 CTGGCTTCTGAGTGCTTTAAGGG + Intronic
942301421 2:174566225-174566247 CAGGCTTTCCAGGGTTTTGCTGG - Intronic
946021064 2:216640470-216640492 CTGCCATCTCAGTGAATTGCTGG - Intronic
946090486 2:217218346-217218368 CTGTGTTCTCAGTGGTTTTCAGG - Intergenic
946197554 2:218044120-218044142 CTGGCATCTCTGTGCTTTGGAGG - Intronic
947166007 2:227263185-227263207 CTGGTTTCTCAGTCCTTTGCTGG + Intronic
948147946 2:235722545-235722567 CTGTCATCACAGTGTTTTCCTGG + Intronic
948196596 2:236101456-236101478 GTGGCTTCTCAGGGATTTGCTGG - Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1173223110 20:41145605-41145627 CTTGCTTCCCAGAGCTTTGCTGG + Intronic
1175110334 20:56643615-56643637 GTGGCTTCTCAACGTTTTCCAGG + Intergenic
1175754929 20:61523429-61523451 ATGCCTTCTCTGTGTTGTGCTGG - Intronic
1175756344 20:61532856-61532878 CTGTCTTCTCAGAGTTTGGCAGG + Intronic
1175880334 20:62254349-62254371 CTGGCTCCTCAGTGCTCTGAAGG + Intronic
1175910047 20:62400790-62400812 CTGGCTCCTCCGTGATTTTCTGG + Intronic
1179542688 21:42093835-42093857 GAGTGTTCTCAGTGTTTTGCTGG - Intronic
1181438345 22:22923085-22923107 CTGGGTTCTCAGTGTTGGGTGGG + Intergenic
1181519376 22:23436529-23436551 CTGGCTTCTCACAGTTTGGGAGG - Intergenic
1181797432 22:25320278-25320300 CTGGGTTCTCAGTGTGGCGCTGG + Intergenic
1185129001 22:49026963-49026985 CTGGCTTGCCAGTGGCTTGCGGG + Intergenic
949781504 3:7694018-7694040 CTGGATTCTCAGTTTTTTCTGGG + Intronic
951237753 3:20254776-20254798 ATGGCTGCTCAGTTTTGTGCTGG + Intergenic
951374313 3:21894957-21894979 CTCACCTCTCTGTGTTTTGCTGG - Intronic
951590221 3:24256374-24256396 TTGGCTTCCCAGTCTTTGGCTGG - Intronic
956292862 3:67679659-67679681 CTGGTTTCTCAGTGATGTGTGGG - Intergenic
957568614 3:81917138-81917160 CTGGCTTCTCAAGGTTTGTCAGG + Intergenic
958473188 3:94548498-94548520 GTGTCTTCTCAGTCTTTTGATGG - Intergenic
959510752 3:107208931-107208953 CTGGCTTATCAATGTTTTCAGGG - Intergenic
960396599 3:117145181-117145203 CTGGCTTCACAAGGTTTTGATGG - Intergenic
960753584 3:120983216-120983238 CTGGCCTCTCAGAGTGGTGCTGG + Intronic
963680338 3:148366959-148366981 CTGTCTTCTCAGTATTTCCCAGG + Intergenic
966997341 3:185296044-185296066 CTGGAGTCTCACTGTGTTGCTGG - Intronic
967184479 3:186932829-186932851 CCGGCTTCTCAGTGTTTTTTTGG - Intronic
970006190 4:11413091-11413113 CTGACTTCTCACAGTTCTGCAGG - Intronic
971859351 4:32085312-32085334 CTGGCATCTCCATGTTTTTCAGG - Intergenic
974446323 4:61987364-61987386 GGGGTTTCTCAGTGTTTTTCAGG + Intronic
974469848 4:62304168-62304190 CTGGCTTGTAAGTTTTTTGCTGG - Intergenic
975716468 4:77210081-77210103 TTGGGTGCTCAGTGTTTGGCAGG - Intronic
978500107 4:109400348-109400370 CTGGGTTCTTATTGTTTTTCTGG - Intergenic
979751735 4:124287854-124287876 CTGGCTTTTAATTGTTGTGCTGG + Intergenic
980717047 4:136640188-136640210 CAGACTCCACAGTGTTTTGCTGG - Intergenic
981228858 4:142329263-142329285 CTGGCTCCTCTGCGTTATGCAGG - Intronic
981306436 4:143251500-143251522 CTGGGTTCTCATTGCTTTTCTGG + Intergenic
981837843 4:149076278-149076300 TTCTCTTCTCAGTGTTCTGCTGG + Intergenic
982077401 4:151751239-151751261 CTGGTTTCTCAGCCTTCTGCTGG - Intronic
982308812 4:153962561-153962583 CTGGTTTCACATTCTTTTGCGGG - Intergenic
982376678 4:154698537-154698559 CTGGCATGTCAGTGTCTTGTAGG - Intronic
983036166 4:162868673-162868695 CTGCCTTTTCAGTATTATGCTGG - Intergenic
986173339 5:5331521-5331543 CTGGCATCTCAGAATTTTGGAGG - Intergenic
986208303 5:5646692-5646714 CTGTTTTCTCAGGGTTTTACAGG + Intergenic
986220044 5:5760590-5760612 CTGGCTCCTCACTGGTTGGCAGG - Intergenic
986415200 5:7521034-7521056 CTGGCTCCTCAGTGTTATAGGGG - Intronic
987281509 5:16418673-16418695 CTGGCTTCTGAGTGCTTAGCAGG - Intergenic
988643906 5:33072759-33072781 ATGGCTACTCAGTGTTTTCTTGG - Intergenic
992086291 5:73281080-73281102 CTGGCTTGTCACTGCTTGGCTGG + Intergenic
993613755 5:90085059-90085081 CTGGCTAGCCAGTGTGTTGCAGG - Intergenic
994254503 5:97577691-97577713 CTTGTTTTTCAGTGTTTTACTGG - Intergenic
994838158 5:104884075-104884097 CTGGCTTTTCACTTTTTTGATGG - Intergenic
995978283 5:118069737-118069759 CTGGCTTCTCATTATTCTGAAGG + Intergenic
996338854 5:122414164-122414186 CTGTCATCTCAGTGCTTTGGGGG - Intronic
997195658 5:131977504-131977526 ATGGCTTGCCAGTGTTATGCTGG - Intronic
998308217 5:141100691-141100713 CTTGCTTCTCTTTGTTTTTCTGG + Exonic
999862878 5:155667409-155667431 ATTGCTTCTCAGGGTGTTGCTGG - Intergenic
1001196116 5:169675028-169675050 CTTGGTGCTAAGTGTTTTGCAGG + Intronic
1001378820 5:171288690-171288712 CTGGGTGCTCAGTGCTCTGCTGG - Intronic
1002358629 5:178651718-178651740 GTGGCATTTCAGTGTTTTGATGG + Intergenic
1003069954 6:2938216-2938238 CTAGCGTCTCAGGGTTTTACAGG + Intergenic
1004409189 6:15364504-15364526 CTGGCCTCTAGGGGTTTTGCAGG - Intronic
1006756888 6:36423804-36423826 CTGGTTTCTAATTGTTTGGCAGG + Intronic
1007877857 6:45126783-45126805 CTGACTTCAAAGTGTTTTGAAGG + Intronic
1007973125 6:46073012-46073034 CTAGCTTGCCAGTGATTTGCAGG + Intronic
1008315327 6:50032087-50032109 CTGGCTTGTAAGGTTTTTGCTGG - Intergenic
1008437639 6:51495200-51495222 CTGGCTTCTCATTGTTTTTCAGG + Intergenic
1008620712 6:53269147-53269169 TTGGCTTCACATTGTTTTCCAGG + Exonic
1009523590 6:64715383-64715405 CAGGCTTCTCAGTGCTTTTGTGG + Intronic
1010031711 6:71278200-71278222 CTGCTTTCTCAGTGTGTTCCTGG - Intergenic
1012238435 6:96844688-96844710 ATGACTTCTCACTGTTCTGCAGG + Intergenic
1015789844 6:136955421-136955443 CTGGGTTCTAAATGTTGTGCTGG - Intergenic
1018722793 6:166586576-166586598 TGGGCTTCTCAGTGTCTCGCCGG - Intronic
1018742705 6:166742831-166742853 CTGGCTTCTCAGTGTTTTGCAGG - Intronic
1018993401 6:168692044-168692066 CTGGCATCTCAGAGGCTTGCAGG + Intergenic
1020149067 7:5667657-5667679 TGGGCTTCCCAGGGTTTTGCTGG + Intronic
1020457663 7:8392652-8392674 GGGGCTTCTCAGTGTATTGGAGG - Intergenic
1020622831 7:10538300-10538322 GTGGCTTCTCAGTGGTTTATGGG - Intergenic
1021301101 7:18974104-18974126 CTGGAGTCTCTGTGTTTTACTGG - Intronic
1023585204 7:41722607-41722629 CTTGCTTCTCAGGGTTTTGTGGG + Intergenic
1024407730 7:49001887-49001909 ATGGCTTCCCAGAGTCTTGCTGG + Intergenic
1024628676 7:51230103-51230125 CTTGCTTCTCAGGGCTGTGCTGG - Intronic
1025636896 7:63328845-63328867 CAGGCTTCTCCGTCTTTGGCAGG - Intergenic
1025645799 7:63419257-63419279 CAGGCTTCTCCGTCTTTGGCAGG + Intergenic
1026202074 7:68223107-68223129 CTGTAATCACAGTGTTTTGCAGG + Intergenic
1027539749 7:79452987-79453009 CGGCTTGCTCAGTGTTTTGCCGG - Intronic
1027645693 7:80795249-80795271 CTGACTTCATGGTGTTTTGCTGG + Intronic
1027908695 7:84219093-84219115 CTGGTTTATCAGTCTTTTGTTGG - Intronic
1029904641 7:104079184-104079206 CTGACTTGTCAGTCTTTTGCTGG + Intergenic
1030106051 7:105988195-105988217 CCGGTTTATAAGTGTTTTGCAGG + Intronic
1030815515 7:114031678-114031700 CTTACTTCTCACTGTTTTGGAGG - Intronic
1032202613 7:129832948-129832970 CTGTCTTCTCATTGCTTTGGGGG - Exonic
1032226341 7:130034746-130034768 CTGTAATCCCAGTGTTTTGCAGG - Intronic
1032256010 7:130297615-130297637 ATGGCTCTTCAGGGTTTTGCTGG - Intronic
1032323695 7:130906931-130906953 CTGTAATCTCAGTGCTTTGCGGG - Intergenic
1033792857 7:144813120-144813142 CTGGCTTCTGAATTTTTGGCAGG - Intronic
1035708873 8:1697383-1697405 CGGGGTTCTCAGTCTTTTGCTGG + Intronic
1036714600 8:11109039-11109061 CTGAATTCTCAGTGATATGCCGG + Intronic
1039425249 8:37479862-37479884 CTCTCTTCTCTGTGTTTTGGTGG - Intergenic
1039908482 8:41804809-41804831 CTGTTTTCACCGTGTTTTGCCGG - Intronic
1039973223 8:42338241-42338263 CTGTTTTCTCAGTGTTTATCTGG - Intergenic
1042868575 8:73377396-73377418 CTGGCTTCTCACTTCTCTGCAGG + Intergenic
1043050987 8:75385300-75385322 CAGGCTTTTCAGTGTTTTTGTGG - Intergenic
1043871657 8:85439619-85439641 CTAGCCTCTCTGTATTTTGCTGG + Intronic
1044261651 8:90131713-90131735 CTTCCTTCTATGTGTTTTGCAGG + Intergenic
1045941770 8:107747135-107747157 ATGGCTTCTCAGTGGTTTATGGG - Intergenic
1046675109 8:117099296-117099318 CTGGCTTCTCATTGTTATTCAGG + Intronic
1047211077 8:122840991-122841013 CCTGCTTCTCTGTGTTTTCCGGG - Intronic
1048174604 8:132140483-132140505 CTGGCTTCTGTGTCCTTTGCTGG - Intronic
1048382749 8:133882322-133882344 CTGGCTTCTAAGCATTTTGTTGG + Intergenic
1048457890 8:134594391-134594413 CTACCTTCTCAGTGCTTTGTTGG + Intronic
1049212817 8:141394562-141394584 CTGGCCTCCCAGTGTCTTGCTGG + Intronic
1049359049 8:142203235-142203257 CTGGCATCTCAGTGCATGGCAGG + Intergenic
1051746660 9:20301175-20301197 TTGGCTTCTCAGCCTTTGGCAGG + Intergenic
1052104863 9:24500810-24500832 CTGAATTCTCAGGGTCTTGCTGG - Intergenic
1052249439 9:26380185-26380207 CTGGCTACAAACTGTTTTGCAGG - Intergenic
1053146505 9:35715619-35715641 CTGGTGTCTCAGTGTCCTGCTGG + Intronic
1053415056 9:37942192-37942214 CTGGGTACTCAGTCTTTAGCCGG - Intronic
1055600498 9:77912674-77912696 CTGATTTCTCATTGTTTTGTAGG - Intronic
1056656490 9:88513890-88513912 ATGGCTTCTAAGTGTTTTCATGG - Intergenic
1057059664 9:91992268-91992290 CTGGCTTCCCAGTGACTGGCAGG + Intergenic
1058253336 9:102729755-102729777 TTGGCTTCTGAATGTGTTGCAGG - Intergenic
1059248102 9:112865325-112865347 CTGGCCTCGCACTGGTTTGCTGG - Intronic
1062002667 9:134224752-134224774 CTGGGTTCTCAGTGCATTGATGG - Intergenic
1062627074 9:137448188-137448210 CTGTCCTCTCAGTGCTTTCCAGG - Exonic
1186789127 X:12980096-12980118 CTGGCTTCTGAGACTTTTGTAGG + Intergenic
1194195162 X:90883296-90883318 CTGGCTCCTCATTGCTTGGCAGG - Intergenic
1195870932 X:109484850-109484872 CTGGCTTCACAGTTTTGTGGAGG - Intergenic
1197252252 X:124228398-124228420 CTGGCTTCTCAGCTTCTAGCAGG + Intronic
1197429975 X:126349990-126350012 CTGACTACACAGTGTTTTTCTGG + Intergenic
1198891578 X:141403016-141403038 CTGGCTGCTCAGGGTTGTGGAGG + Intergenic
1199375277 X:147100550-147100572 CTGGCTTCTCTCTCTTCTGCTGG + Intergenic
1199980009 X:152915726-152915748 CTGGCTTCTCTCTCTTTTGGGGG + Intronic
1200716730 Y:6555408-6555430 ATGGCTTCTAAGTGTTCTGGTGG - Intergenic