ID: 1018742897

View in Genome Browser
Species Human (GRCh38)
Location 6:166744126-166744148
Sequence AGGGAGTGACCACACTAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018742897_1018742902 27 Left 1018742897 6:166744126-166744148 CCACGCTAGTGTGGTCACTCCCT 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1018742902 6:166744176-166744198 TGAAATTCCATCCACCGACCTGG 0: 1
1: 0
2: 0
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018742897 Original CRISPR AGGGAGTGACCACACTAGCG TGG (reversed) Intronic
905922402 1:41728341-41728363 AGGGAGTGCCCAGCCTAGAGGGG + Intronic
906009788 1:42512426-42512448 AGGGAGTGACCTCACTGTGGCGG + Intronic
913656602 1:120966353-120966375 AGGCAGTGACCACAGCAGCATGG + Intergenic
914007196 1:143742743-143742765 AGGGAGTGACCACACACCCAGGG - Intergenic
914007739 1:143747609-143747631 AGGCAGTGACCACAGCAGCATGG + Intergenic
914521154 1:148417601-148417623 AGGCAGTGACCACAGCAGCATGG + Intergenic
914646013 1:149653237-149653259 AGGGAGTGACCACACACCCAGGG - Intergenic
914646565 1:149658090-149658112 AGGCAGTGACCACAGCAGCATGG + Intergenic
919075613 1:192809131-192809153 AGGCAGTGGCCACAAGAGCGAGG + Exonic
919808577 1:201395388-201395410 GGGAAGTGAGCACACTAACGTGG + Intronic
1063929354 10:11013432-11013454 AAGGAGGGACCCCACTAGCGTGG - Intronic
1064886172 10:20114825-20114847 AGGCAGTGACCAGACCAGGGAGG + Intronic
1075716277 10:124557687-124557709 AGGGAGTGAGCCCACCAGCAGGG - Intronic
1089708469 11:120298157-120298179 AAGGAGTGACCAGCCTAGAGAGG - Intronic
1100459799 12:94788076-94788098 GGGCGGTGACCACACTAGGGCGG + Intergenic
1112277706 13:98036444-98036466 AGGGAGTTACCACCCAACCGTGG + Intergenic
1113108766 13:106799490-106799512 AGGTAGTGACCACAGAAGAGTGG - Intergenic
1119990899 14:79196069-79196091 AGGGAGGGAGCACACTAGTCAGG + Intronic
1123129390 14:105973470-105973492 ATGGAGTGACCACATTCGCCAGG - Intergenic
1123409904 15:20049636-20049658 ATGGAGTGACCACATTCGCCAGG - Intergenic
1123519236 15:21056344-21056366 ATGGAGTGACCACATTCGCCAGG - Intergenic
1124818845 15:33022761-33022783 AGGGACTGACAGCACTAACGTGG + Intronic
1130876768 15:88021316-88021338 AGTGAGTGACCACACCTGCTGGG + Intronic
1132352594 15:101149091-101149113 AGGGCCTGACCACCCTAGCTGGG + Intergenic
1134309512 16:13062910-13062932 AGGGAGAGACCACAGTGGCGAGG + Intronic
1136687504 16:32003837-32003859 AGGGAGGGACAACAATGGCGGGG - Intergenic
1136788117 16:32947388-32947410 AGGGAGGGACAACAATGGCGGGG - Intergenic
1142067689 16:88072185-88072207 AGTGAGTGACCACACGGCCGGGG + Exonic
1144070638 17:11668471-11668493 AGGGTGTCACCACACTGGCCAGG - Intronic
1144284460 17:13759691-13759713 ATAGAGTGACCACTCTAGCATGG - Intergenic
1147659346 17:42108959-42108981 AGGCCGTGTCCACACTAGAGAGG + Intronic
1147791102 17:43014800-43014822 AGGGAGTGACCTCCCTACCCAGG + Exonic
1151231915 17:72690977-72690999 AGGAAGTGGCCACACTGGGGAGG + Intronic
1151654749 17:75490608-75490630 AGGGGGGGCCCACACCAGCGGGG - Intronic
1160139670 18:76310373-76310395 AGGGAGTGGACACACTTGAGTGG - Intergenic
1161481545 19:4513287-4513309 AGGGACTGTCCAGACTGGCGTGG - Exonic
926408746 2:12580222-12580244 AGGGAGTGAGCATTCTAGGGAGG + Intergenic
926853851 2:17230739-17230761 AGGGAGTGTGCACACTGGTGTGG - Intergenic
935083925 2:99826507-99826529 AGGGAGTGACATCTCTAGTGAGG + Intronic
935728759 2:106047314-106047336 AGGGGGTGACCAACCTAGCAGGG - Intergenic
937251908 2:120529254-120529276 AGGGAGTGAGCACATTAAAGAGG - Intergenic
941209981 2:162625465-162625487 AGGGGGTGAACAGACTAGCAGGG + Intronic
945718565 2:213388465-213388487 AGAAAGTGACCACACAAGCCTGG + Intronic
948056889 2:235015421-235015443 AGGGAGGGACAACAGCAGCGAGG - Intronic
948731059 2:239963966-239963988 GGGAAAAGACCACACTAGCGGGG + Intronic
1169877666 20:10315470-10315492 AGGGAGAGACCACACAAGCAGGG + Intergenic
1170824487 20:19782144-19782166 ATGGATTGACCACACTAGATTGG + Intergenic
1171848851 20:30293969-30293991 AGGGAGTGCCCCTTCTAGCGTGG - Intergenic
1173864433 20:46305375-46305397 AGGGTGTGCCCACTCTTGCGGGG + Intronic
1181094485 22:20496036-20496058 AGTGAGTCCCCGCACTAGCGCGG + Intronic
1184825466 22:46947664-46947686 AGGGAGAGATCACACTTGCAAGG - Intronic
949227797 3:1714617-1714639 AGGGATTCACCACATTGGCGAGG - Intergenic
951673889 3:25215486-25215508 AGAGAGTGAGCACTCTGGCGGGG + Intronic
953929659 3:46999581-46999603 AGGGACTGACCAGACTAGAAAGG - Intronic
963775085 3:149430707-149430729 AGAGAATGACCACAATAACGAGG - Intergenic
968607398 4:1542023-1542045 GGGGAGTGTCCACACTGGGGAGG - Intergenic
974535920 4:63174898-63174920 AGGGAATGACCACATTAATGAGG + Intergenic
979131997 4:117058850-117058872 AGGGCTTCACCACATTAGCGAGG + Intergenic
989169007 5:38456924-38456946 AGTGAGTGACTACTCTAGCCCGG - Intronic
998461599 5:142314084-142314106 AGGGAGTGGGCAGACTAGCAAGG + Exonic
1002639212 5:180622709-180622731 AGTGAGTGACCAGACCAGGGCGG - Exonic
1006438149 6:34037308-34037330 AGGGTGTGACAACACTCGTGTGG - Intronic
1014493476 6:122090924-122090946 AGGGAGTCAACACAGTAGAGTGG - Intergenic
1017658109 6:156649160-156649182 AGGAAGTGACCACAGGAGCCAGG + Intergenic
1018742897 6:166744126-166744148 AGGGAGTGACCACACTAGCGTGG - Intronic
1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG + Intronic
1020024476 7:4889137-4889159 AAGGAGAGACCACACCAGCTAGG + Intergenic
1029727357 7:102415895-102415917 AGGGAGTGAACAGACCAGCATGG - Intronic
1033415824 7:141160493-141160515 AGAGAATGACGACACTAGCAAGG - Intronic
1035619341 8:1025749-1025771 AGGGAGGGACCAGCCTAACGGGG + Intergenic
1048992142 8:139766710-139766732 AGTGAGTGACCTCAGGAGCGGGG - Intronic
1052460481 9:28756621-28756643 AGGGAGGGACCACATGAGAGAGG + Intergenic
1053786562 9:41656689-41656711 AGGGAGTGCCCCTTCTAGCGTGG - Intergenic
1054158499 9:61657506-61657528 AGGGAGTGTCCCTTCTAGCGTGG + Intergenic
1054175287 9:61870704-61870726 AGGGAGTGCCCCTTCTAGCGTGG - Intergenic
1054450249 9:65399910-65399932 AGGGAGTGCCCCTTCTAGCGTGG - Intergenic
1054478273 9:65588511-65588533 AGGGAGTGCCCCTTCTAGCGTGG + Intergenic
1054662250 9:67710106-67710128 AGGGAGTGCCCCTTCTAGCGTGG + Intergenic
1056585384 9:87924471-87924493 AGGGAGTGACCACATCACCCAGG - Intergenic
1056611496 9:88128469-88128491 AGGGAGTGACCACATCACCCAGG + Intergenic
1060734767 9:126059848-126059870 AGGGAGTGACCTCACCTGCCTGG + Intergenic
1185627323 X:1492068-1492090 AGGGAGTGACCCCAGGGGCGAGG - Intronic
1187235116 X:17459809-17459831 AGGGAATGATCACACTATTGAGG - Intronic