ID: 1018743061

View in Genome Browser
Species Human (GRCh38)
Location 6:166744759-166744781
Sequence CCACGTCCCTGGCGGCGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018743053_1018743061 9 Left 1018743053 6:166744727-166744749 CCTGGGCTTGGCTCTGGATTTAA 0: 1
1: 0
2: 1
3: 27
4: 212
Right 1018743061 6:166744759-166744781 CCACGTCCCTGGCGGCGGTGGGG No data
1018743050_1018743061 25 Left 1018743050 6:166744711-166744733 CCTGGGGGCATGCAGGCCTGGGC 0: 1
1: 1
2: 0
3: 57
4: 472
Right 1018743061 6:166744759-166744781 CCACGTCCCTGGCGGCGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018743061 Original CRISPR CCACGTCCCTGGCGGCGGTG GGG Intronic
No off target data available for this crispr