ID: 1018746954

View in Genome Browser
Species Human (GRCh38)
Location 6:166769747-166769769
Sequence GGGACCACCTAAAACCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018746950_1018746954 -6 Left 1018746950 6:166769730-166769752 CCTCTCTTCCAGGATTTGGGACC 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1018746954 6:166769747-166769769 GGGACCACCTAAAACCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018746954 Original CRISPR GGGACCACCTAAAACCAGGT GGG Intronic
No off target data available for this crispr