ID: 1018747123

View in Genome Browser
Species Human (GRCh38)
Location 6:166771244-166771266
Sequence CTCGTCACTGATGCGTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018747123_1018747127 18 Left 1018747123 6:166771244-166771266 CCAAGCCACGCATCAGTGACGAG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1018747127 6:166771285-166771307 TGACTCTAAACTCTAGTCTATGG 0: 1
1: 0
2: 0
3: 13
4: 192
1018747123_1018747128 24 Left 1018747123 6:166771244-166771266 CCAAGCCACGCATCAGTGACGAG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1018747128 6:166771291-166771313 TAAACTCTAGTCTATGGAAGAGG 0: 1
1: 0
2: 1
3: 4
4: 122
1018747123_1018747126 -5 Left 1018747123 6:166771244-166771266 CCAAGCCACGCATCAGTGACGAG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1018747126 6:166771262-166771284 ACGAGCAGGCAAATGCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018747123 Original CRISPR CTCGTCACTGATGCGTGGCT TGG (reversed) Intronic
900530888 1:3152702-3152724 CTGGTTTCTGATGCGTGGCTGGG + Intronic
906027711 1:42688075-42688097 CAAGTCACTGATACGTGACTTGG + Intronic
924457231 1:244228468-244228490 CTCTTCACTGAGGCCTGCCTGGG + Intergenic
1087217322 11:95507940-95507962 CTCTTCACTTATGTGTGGGTGGG - Intergenic
1089787426 11:120918057-120918079 CTCATCTCTGCTGTGTGGCTGGG - Intronic
1102259435 12:111435326-111435348 ATCGTCACAGATGCGGGGCCTGG + Intronic
1110224076 13:73101538-73101560 CTGGACTCTGATGTGTGGCTGGG + Intergenic
1123063585 14:105605395-105605417 CTCTTGACGCATGCGTGGCTTGG + Intergenic
1129005599 15:72370581-72370603 CGCCTCACTGATGAGTAGCTAGG - Intronic
1129714008 15:77836512-77836534 CTCCTCACTGCTGAGGGGCTTGG - Intergenic
1137368847 16:47886278-47886300 CTCATCGCTGACGCGGGGCTGGG - Intergenic
1142210440 16:88805960-88805982 CTGGTCACGGGTGGGTGGCTGGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145788391 17:27609004-27609026 TTCTTCACTGCTGTGTGGCTTGG + Intronic
1155157936 18:23173150-23173172 CGCGGCTCTGATGGGTGGCTGGG + Intronic
1158525916 18:58213624-58213646 CTCATCACTGGTGAGTGACTTGG - Intronic
1161035454 19:2082054-2082076 CTGGTCACTGCAGCGTGGGTGGG - Intronic
927274818 2:21253843-21253865 TTACTCACTGATGCATGGCTGGG - Intergenic
931817031 2:65914478-65914500 CTTGTCTCTGAGGTGTGGCTTGG + Intergenic
938746717 2:134286076-134286098 TTGTTCACTGATGTGTGGCTTGG - Intronic
947070733 2:226285283-226285305 CCTGTCACTGATGAGTGGCAAGG + Intergenic
1174879326 20:54261191-54261213 CTCAGCACTCATGCGGGGCTGGG - Intergenic
1175834361 20:61984142-61984164 CTCATCACTGAGGAGCGGCTCGG + Intronic
1178897985 21:36576508-36576530 CTCGTGACTTCTGCCTGGCTGGG + Intronic
1179952653 21:44718825-44718847 CTCATCATGGATGCGTGCCTGGG - Intergenic
1180825329 22:18857339-18857361 CTCGTCAGTGAAGAGGGGCTCGG + Intronic
1181187400 22:21117208-21117230 CTCGTCAGTGAAGAGGGGCTCGG - Intergenic
1181211798 22:21293285-21293307 CTCGTCAGTGAAGAGGGGCTCGG + Intergenic
1181500452 22:23312971-23312993 CTCGTCAGTGAAGAGGGGCTCGG - Exonic
1181705673 22:24648282-24648304 CTCGTCAGTGAAGAGGGGCTCGG - Intergenic
1182510596 22:30817344-30817366 CTCATCACTAATGAGGGGCTGGG - Intronic
1184899395 22:47434905-47434927 CTCATCGCCGATGCCTGGCTGGG + Intergenic
1203215155 22_KI270731v1_random:2147-2169 CTCGTCAGTGAAGAGGGGCTCGG - Intergenic
1203275478 22_KI270734v1_random:83242-83264 CTCGTCAGTGAAGAGGGGCTCGG + Intergenic
952843215 3:37665801-37665823 TTCATCCTTGATGCGTGGCTGGG - Intronic
962272290 3:133986741-133986763 TATGTCACTGAAGCGTGGCTTGG - Intronic
968820095 4:2843793-2843815 CTCGGCAGTGCTGCGCGGCTTGG + Intergenic
977645240 4:99404518-99404540 CTCGGCATTAATGTGTGGCTTGG + Intergenic
979340451 4:119516659-119516681 CTCGCCACTGATGCCAGCCTGGG - Intronic
991630076 5:68647859-68647881 CTCGTAACTGCTGCTTGGCTGGG - Intergenic
997660973 5:135589394-135589416 CTGGTCCCTGATAGGTGGCTGGG + Intergenic
1002476413 5:179468955-179468977 CTGGTCAGAGATGCATGGCTTGG - Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1016868277 6:148790984-148791006 CTGGTCACTGATGTGTTGCGAGG - Intronic
1018719917 6:166564771-166564793 CTCGACCTTGATCCGTGGCTCGG - Intronic
1018747123 6:166771244-166771266 CTCGTCACTGATGCGTGGCTTGG - Intronic
1019297587 7:286465-286487 CTCGTGCCTGATGCGTGGACGGG - Intergenic
1019357848 7:590289-590311 CTCCTCACCGGTGCGTGCCTTGG - Intronic
1025777241 7:64570124-64570146 CTCGTCACCGAGGTGGGGCTCGG - Intergenic
1037734874 8:21557703-21557725 CTCATCTCTGAGGCATGGCTGGG + Intergenic
1041144791 8:54862606-54862628 CTGGTCCCTGATGGCTGGCTGGG - Intergenic
1041349580 8:56935162-56935184 CAGGACACTGATGCATGGCTTGG - Intergenic
1053156918 9:35787598-35787620 CTGTGCACTGCTGCGTGGCTGGG + Intergenic
1059384070 9:113950531-113950553 CTCGTCACATAAGCCTGGCTGGG - Intronic
1062601256 9:137319581-137319603 GTCATCACGGATGTGTGGCTTGG + Intronic