ID: 1018747933

View in Genome Browser
Species Human (GRCh38)
Location 6:166776899-166776921
Sequence TACCCAAGATTGTTGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 287}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018747933_1018747937 -8 Left 1018747933 6:166776899-166776921 CCTGTTTTCAACAATCTTGGGTA 0: 1
1: 0
2: 1
3: 38
4: 287
Right 1018747937 6:166776914-166776936 CTTGGGTACATACCTAGGAGGGG No data
1018747933_1018747936 -9 Left 1018747933 6:166776899-166776921 CCTGTTTTCAACAATCTTGGGTA 0: 1
1: 0
2: 1
3: 38
4: 287
Right 1018747936 6:166776913-166776935 TCTTGGGTACATACCTAGGAGGG 0: 3
1: 8
2: 47
3: 116
4: 255
1018747933_1018747935 -10 Left 1018747933 6:166776899-166776921 CCTGTTTTCAACAATCTTGGGTA 0: 1
1: 0
2: 1
3: 38
4: 287
Right 1018747935 6:166776912-166776934 ATCTTGGGTACATACCTAGGAGG No data
1018747933_1018747938 -7 Left 1018747933 6:166776899-166776921 CCTGTTTTCAACAATCTTGGGTA 0: 1
1: 0
2: 1
3: 38
4: 287
Right 1018747938 6:166776915-166776937 TTGGGTACATACCTAGGAGGGGG 0: 1
1: 5
2: 101
3: 642
4: 3797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018747933 Original CRISPR TACCCAAGATTGTTGAAAAC AGG (reversed) Intronic
901410562 1:9080298-9080320 TATCCAAAATAATTGAAAACGGG - Intronic
901480569 1:9522080-9522102 TACCCAAAAGAATTGAAAACAGG + Intergenic
904857868 1:33513184-33513206 TACCCAAAAGAGTTGAAAGCAGG - Intergenic
905160780 1:36032040-36032062 TACCCAGAATAGCTGAAAACAGG - Intronic
905514832 1:38554896-38554918 TACCCAAAATATTTGAAAACAGG + Intergenic
906740310 1:48175602-48175624 TCTCTAAGATTGTTGTAAACTGG - Intergenic
906763044 1:48396385-48396407 TACCCAAAAGAGTTGAAAGCAGG + Intronic
907098859 1:51808617-51808639 TACCCAAAATAATTGAAAACAGG - Intronic
909124749 1:71652889-71652911 AACCCAAGATTATTTAGAACAGG - Intronic
910302851 1:85727088-85727110 TACCCAAAAAAATTGAAAACAGG - Intergenic
911229151 1:95341946-95341968 TATTCAAGATTATAGAAAACTGG + Intergenic
911683432 1:100745743-100745765 TACCCAGGATAGATGAAAAGTGG - Intergenic
914224697 1:145710624-145710646 TACCCAAAAGATTTGAAAACAGG - Intergenic
916592793 1:166209261-166209283 TAACCAAGAGAATTGAAAACAGG - Intergenic
916949095 1:169760767-169760789 TACTCATGATTGTTGAAACTTGG - Intronic
917139502 1:171821018-171821040 TACCCAAAGTAATTGAAAACAGG - Intergenic
917203586 1:172544487-172544509 AACCCCAGATTGTGGAAATCAGG + Intronic
917425712 1:174910788-174910810 TACCCAAAATAACTGAAAACAGG - Intronic
917621492 1:176801230-176801252 TACCCAAGATTGCTGCTAAGTGG - Intronic
918591130 1:186242589-186242611 TACCAAAGTTTCTTGAAAAATGG - Intergenic
918701067 1:187608594-187608616 AACCCAAAATTGTTGAAGAAAGG + Intergenic
924751088 1:246891401-246891423 TAATAAAGATTGTTCAAAACAGG + Intronic
1063862027 10:10321067-10321089 TACCCAAAATAATTGAAAACAGG + Intergenic
1064215496 10:13396934-13396956 TACCCAAAAGAATTGAAAACAGG - Intergenic
1065300991 10:24321169-24321191 TACCCAAAATAATTGAAAGCAGG + Intronic
1066080431 10:31926488-31926510 TAGCCAAAATTGTTAAATACAGG + Intronic
1066232376 10:33448926-33448948 TACCCAACATGGATGAAATCTGG + Intergenic
1067254008 10:44617392-44617414 TACCCAAAATAATTAAAAACAGG + Intergenic
1067411947 10:46072438-46072460 TACCCAAAAGTATTGAAAGCAGG + Intergenic
1068296706 10:55080450-55080472 TACCCAACATTTTTGGAACCAGG - Intronic
1070639348 10:78155734-78155756 TACCCAAAATAATTGAAAACAGG - Intergenic
1072240495 10:93491087-93491109 TACCTAAGATTCTGTAAAACTGG - Intergenic
1072336083 10:94399689-94399711 TACCCAAAAGAATTGAAAACAGG - Intergenic
1074045633 10:109836095-109836117 TACCCAAGAGAACTGAAAACAGG + Intergenic
1074321177 10:112404143-112404165 AATCCAAGATTGTTCAATACAGG + Intronic
1074693016 10:116024011-116024033 TACCCAACATTAATGAAAACTGG + Intergenic
1075044432 10:119134855-119134877 TACCCAAAATAATTGAAAGCAGG + Intronic
1075262478 10:120975307-120975329 TACCCCAAATAATTGAAAACAGG + Intergenic
1078269848 11:9785124-9785146 CATCCAAGAATGATGAAAACAGG - Exonic
1079153073 11:17919075-17919097 TACCCTAGTTTGTTGCAAAAAGG - Intronic
1080830832 11:35891828-35891850 TTTCCAACAATGTTGAAAACAGG - Intergenic
1081065221 11:38532772-38532794 TACCCAAAATAATTGAAATCAGG + Intergenic
1083069374 11:59961024-59961046 TACCCCAAATAATTGAAAACAGG + Intergenic
1083840365 11:65301079-65301101 TACCCAAGAGAACTGAAAACAGG - Intronic
1085794535 11:79525991-79526013 GACCCAAGAGAATTGAAAACAGG - Intergenic
1087808414 11:102581749-102581771 TTCTCAAGATTGTTGAAAGGTGG + Intronic
1089295695 11:117466099-117466121 TGCCCAAAATAATTGAAAACAGG + Intronic
1089393754 11:118120301-118120323 TACCCAAGAGAATTGAAAGCAGG - Intronic
1090381229 11:126328906-126328928 TACCCCAGATTGTAGAAGTCAGG + Intronic
1090845485 11:130526684-130526706 TACCCAAAAGAATTGAAAACAGG - Intergenic
1091834174 12:3573218-3573240 TAACCAATAAAGTTGAAAACGGG - Intronic
1092959741 12:13584881-13584903 TACACAAGATTGTTACAAAGAGG + Intronic
1093136173 12:15454064-15454086 TATCCAAAATTATTGAAATCAGG - Intronic
1095904554 12:47364385-47364407 TACTCAAGAGTGTGGGAAACAGG + Intergenic
1097513573 12:60573933-60573955 TACCCAAAGAAGTTGAAAACAGG + Intergenic
1098193734 12:67977683-67977705 TAGCAAAGATTGATGAAAATTGG - Intergenic
1098556940 12:71829735-71829757 TACCCAAAATAATTGAAAGCAGG - Intergenic
1102212178 12:111135485-111135507 TACCCAAAAAAATTGAAAACAGG + Intronic
1102785399 12:115600178-115600200 TTCCCACCATTGTGGAAAACAGG - Intergenic
1103356169 12:120322358-120322380 TGCCCCAGATTGTACAAAACAGG - Intronic
1103366445 12:120387451-120387473 TACCCAAAATAATTAAAAACAGG + Intergenic
1103616831 12:122158935-122158957 TACCCAAAATAAATGAAAACAGG + Intergenic
1103676039 12:122656554-122656576 TGCCCAAAAGAGTTGAAAACAGG - Intergenic
1103747173 12:123133038-123133060 TACCCAAGAGACTTGAAAGCAGG - Intronic
1105834338 13:24195439-24195461 TACCCAAGAGAACTGAAAACAGG - Intronic
1106016588 13:25874720-25874742 TACCCAAAAGGATTGAAAACAGG + Intronic
1106731754 13:32548552-32548574 TACCCAAAAGAGTAGAAAACAGG + Intergenic
1107146009 13:37060920-37060942 TACCCAAAAGAATTGAAAACAGG - Intergenic
1107514810 13:41118779-41118801 TGCCCAAAATAATTGAAAACAGG - Intergenic
1107802545 13:44122706-44122728 TTCCCAAGAATGTTGACATCAGG + Intergenic
1108639381 13:52368552-52368574 TAGCCAAAAGTATTGAAAACAGG + Intergenic
1109644268 13:65232539-65232561 TGGCCAAGATTATAGAAAACAGG - Intergenic
1110178756 13:72590117-72590139 TACCCAAAAGCATTGAAAACAGG + Intergenic
1110777152 13:79421498-79421520 TACAGAAGATTCTTGAAAAATGG + Intergenic
1111560738 13:89942510-89942532 TAACCAAAATTACTGAAAACGGG - Intergenic
1112534781 13:100241870-100241892 TACCCAAAATAATTGAAAACAGG - Intronic
1113124987 13:106967975-106967997 TATCCAAAAGTATTGAAAACAGG - Intergenic
1114160413 14:20159593-20159615 TACCCAAGAGAATTGAAAACAGG + Intergenic
1114374998 14:22135396-22135418 TATCCAAGATAATTGAAATCAGG + Intergenic
1115324602 14:32125470-32125492 TACCCAAAATAATTGAAAACAGG - Intronic
1116131345 14:40858539-40858561 TACACAAGATTGTTGAAATAAGG + Intergenic
1116422642 14:44750917-44750939 TATCCAATATTTCTGAAAACAGG - Intergenic
1117003023 14:51390889-51390911 TACCCAAAAGAGTTGAAAGCAGG + Intergenic
1117598993 14:57354340-57354362 TATGCAAAATAGTTGAAAACAGG + Intergenic
1117743178 14:58839697-58839719 TACCCAAAATAATTGAAAGCAGG - Intergenic
1118069228 14:62227139-62227161 TACCAAAGATTATTCAAAAAAGG - Intergenic
1118792179 14:69105143-69105165 TACCCAAAATAATTGAAAACAGG + Intronic
1119078487 14:71668732-71668754 TACCCAGCATTGTTGAGGACTGG - Intronic
1119369440 14:74126387-74126409 TACCCAAAAGAATTGAAAACAGG + Intronic
1119637010 14:76281560-76281582 TACCCAAAATAATTGAAAGCAGG + Intergenic
1120150572 14:81028562-81028584 GAACTAAGATGGTTGAAAACTGG - Intronic
1121480038 14:94260044-94260066 TACCCAAGAGAAATGAAAACAGG - Intronic
1122161679 14:99789146-99789168 TACTCAAAATTGTTGAAAGCAGG - Intronic
1125013816 15:34910205-34910227 AACCCAACATAGGTGAAAACTGG - Exonic
1125086072 15:35730944-35730966 TACCCAAGAGAATTGATAACTGG - Intergenic
1127241162 15:57116189-57116211 TACACATGATAGTTAAAAACAGG - Intronic
1127677533 15:61256456-61256478 TACACAAGAATGTTCATAACAGG + Intergenic
1127731210 15:61803657-61803679 TACCCAAATCTGTAGAAAACAGG + Intergenic
1130421855 15:83756062-83756084 TACCCAAAAGTATTGAAAGCAGG - Intronic
1130870391 15:87966838-87966860 TACCCAAGACTAGTGAATACTGG + Intronic
1131745537 15:95443322-95443344 TGCCCAAGATTGGTCAAAAGAGG + Intergenic
1132026098 15:98405589-98405611 TCCCCAAGTCTGATGAAAACTGG + Intergenic
1132673281 16:1110974-1110996 TACCCAAATGGGTTGAAAACGGG - Intergenic
1133065184 16:3201306-3201328 TACCCAAAAGAATTGAAAACAGG - Intergenic
1133083119 16:3339346-3339368 TACCCAAAAGAATTGAAAACAGG - Intergenic
1133398643 16:5468556-5468578 TACCCCAAATTGCTGAGAACAGG + Intergenic
1133785904 16:8972959-8972981 TACCCAAGAGAACTGAAAACAGG + Intergenic
1135167595 16:20154234-20154256 TACCCAAGAGAATTGAAAGCAGG - Intergenic
1135281822 16:21159121-21159143 TCCCTAGGATTATTGAAAACGGG + Intronic
1137068103 16:35871952-35871974 TACCCAAAATAATTGAAAATAGG + Intergenic
1140323791 16:73980290-73980312 TACCCAAAATAATTGAAAACAGG + Intergenic
1140640241 16:76963618-76963640 TAACCAAAATTATTGAAATCAGG - Intergenic
1140689212 16:77465403-77465425 TACCCAAGAAAGTTGGAAATAGG + Intergenic
1140856003 16:78978325-78978347 TACCCAACATAATTAAAAACAGG - Intronic
1143318412 17:6050987-6051009 TACCCAAAATATTTGAAAATAGG - Intronic
1144591194 17:16525297-16525319 TACCCAAGAGAATTGAAAACAGG + Intergenic
1145108657 17:20142322-20142344 TACCCAAAATAATTGAAAGCAGG + Intronic
1145120254 17:20252854-20252876 TATCCAAGAAAATTGAAAACAGG - Intronic
1148586007 17:48780981-48781003 TACCCAAAATAATTGAAAACAGG - Intronic
1150626747 17:66846754-66846776 TACCCAAGAGAATTGAAAGCAGG - Intronic
1150685807 17:67320045-67320067 TACCCAAAATAATTGAAAACAGG + Intergenic
1152449373 17:80367001-80367023 TATGCAAGAATGTTGAATACAGG + Intronic
1152769171 17:82157037-82157059 TACCCTAGACTGTTGGTAACTGG - Intronic
1154001363 18:10484907-10484929 TACCCAAAAGAGTTGAAAGCAGG - Intronic
1154079460 18:11242026-11242048 TATTCATAATTGTTGAAAACTGG + Intergenic
1155417516 18:25615016-25615038 CACATAAGATTGTTAAAAACTGG + Intergenic
1155531684 18:26773529-26773551 TACCCGAGAATGTTAAAAATTGG - Intergenic
1158651156 18:59287406-59287428 TACCCAAAATAATTGAAAGCAGG + Intronic
1163521129 19:17792753-17792775 TACCCAAAGGAGTTGAAAACAGG - Intergenic
1166910325 19:46149865-46149887 CACCCAAGATAACTGAAAACAGG - Intronic
1167813741 19:51859332-51859354 TACCCATGAGAATTGAAAACAGG - Intronic
925217396 2:2109217-2109239 TTCCAAAGACTGTTGCAAACAGG - Intronic
925376045 2:3387032-3387054 TACCCAAAATGATTGAAAGCAGG + Intronic
926948497 2:18215673-18215695 TACCCAAGATAGATTGAAACTGG + Intronic
929476437 2:42254790-42254812 TACTCAAAATAATTGAAAACAGG + Intronic
930060890 2:47287435-47287457 TACCCAAAATAATTGAAAACAGG + Intergenic
931693343 2:64853663-64853685 TACCCAAAAAAATTGAAAACAGG + Intergenic
931957552 2:67444410-67444432 AAGCCTAGATTGTTGTAAACAGG - Intergenic
932164098 2:69490312-69490334 TACCCAAGAGAATTGAAAGCAGG + Intronic
932375331 2:71230398-71230420 TACCCAAAATAATTGAAAGCAGG - Intergenic
934068590 2:88363151-88363173 TACCCAAAATAATTGAAAATAGG + Intergenic
937149518 2:119676352-119676374 TACCCAAAATAATTGAAAACAGG - Intergenic
937703044 2:124885955-124885977 TGCCCAAGATAATTAAAAACAGG - Intronic
938859067 2:135347580-135347602 TACCCAAGAGAACTGAAAACAGG - Intronic
939172315 2:138710396-138710418 TACCCAAAATAATTGAAAACAGG - Intronic
939251578 2:139687564-139687586 TACCCAAGAGAATTTAAAACTGG - Intergenic
940859388 2:158756552-158756574 TACCCAAAATAATTGAAAACCGG + Intergenic
941369659 2:164648530-164648552 TACACAAAAGTATTGAAAACAGG - Intergenic
941562571 2:167066625-167066647 TATCCAAAATTATTGAAATCAGG + Intronic
941790518 2:169547485-169547507 TACCCAACATTGTTAACAAAAGG + Intronic
942235095 2:173896155-173896177 TACCCAAAAGAATTGAAAACAGG + Intergenic
944768443 2:202887981-202888003 TATCCAAGATAAATGAAAACAGG + Intronic
944866912 2:203871297-203871319 TCCCCAACATTGGTGAAAAAAGG - Intronic
945051001 2:205824345-205824367 TAGCCAAAATAATTGAAAACAGG + Intergenic
947784129 2:232799625-232799647 TACCCAAAAGGATTGAAAACAGG - Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169200917 20:3709579-3709601 TACCCAAAAGTACTGAAAACAGG + Intergenic
1170228242 20:14015960-14015982 TACCCAAAATAATTGAAAACAGG - Intronic
1170593488 20:17788515-17788537 TACTCAAAAGAGTTGAAAACTGG - Intergenic
1171031942 20:21684779-21684801 TACTAAATATTTTTGAAAACAGG + Intergenic
1171470588 20:25367885-25367907 TACCAAAAATAATTGAAAACAGG - Intronic
1172452546 20:35037419-35037441 TACCCAAAAGAATTGAAAACAGG + Intronic
1174096568 20:48094239-48094261 TACCCAAAATTACTGAAAGCAGG + Intergenic
1175453433 20:59090548-59090570 TAGCCAAAATGGTTGAAAACAGG - Intergenic
1176134205 20:63513416-63513438 GACCCAAAAGAGTTGAAAACAGG + Intergenic
1177176929 21:17709742-17709764 TACCCAAAACAATTGAAAACAGG - Intergenic
1178455940 21:32751249-32751271 TCCTCAAGATTGTTGAAAGATGG - Intronic
1179453438 21:41481087-41481109 TACACAAGAGAATTGAAAACAGG + Intronic
1182061523 22:27401692-27401714 TACCCAAGATAATTGAAAACAGG + Intergenic
1182669303 22:31982541-31982563 TACCCAAAAGAATTGAAAACAGG - Intergenic
1182669307 22:31982598-31982620 TACCCAAAAGAATTGAAAACAGG - Intergenic
1182669311 22:31982655-31982677 TACCCAAAAGAATTGAAAACAGG - Intergenic
1183118509 22:35711371-35711393 TACCCAAGAGAATTGAAAGCAGG - Intergenic
1183900878 22:41005050-41005072 TAACCAAAATAATTGAAAACAGG - Intergenic
1184788877 22:46686974-46686996 TACACAAAATTGTTGACAAAAGG + Exonic
949535256 3:4990404-4990426 TACCCAAAAGAATTGAAAACAGG + Intergenic
950907101 3:16548979-16549001 TACCCAAAAGAATTGAAAACAGG + Intergenic
950999353 3:17539828-17539850 TCCCCAAAATGGTTGAAAACAGG - Intronic
951064270 3:18246233-18246255 TACCCAAAATAACTGAAAACAGG - Intronic
954092545 3:48296589-48296611 AAACCAAGATTTTAGAAAACTGG + Intronic
954591086 3:51782534-51782556 TACCCAAAAGAATTGAAAACAGG - Intergenic
955682534 3:61517325-61517347 TACCCAAAAGAATTGAAAACAGG + Intergenic
955703577 3:61705773-61705795 TCCCCAAGAATGATGAATACGGG - Intronic
955747922 3:62158380-62158402 TAACCAAGACTGTCCAAAACTGG + Intronic
956140648 3:66143324-66143346 TACCCAAAATAATTGGAAACAGG - Intronic
956230480 3:67010333-67010355 TACACAAGATTGTCAAAAAGCGG - Exonic
956243610 3:67156117-67156139 TTCCTAAGAATGTTGAATACTGG - Intergenic
956628639 3:71292012-71292034 TACCCAAGACTTTTAAAAAATGG - Intronic
957329962 3:78749671-78749693 TACTCATGAATTTTGAAAACTGG - Intronic
958683613 3:97363658-97363680 TACCCAAAATAATTGAAAGCAGG + Intronic
960231192 3:115229487-115229509 GGCCCAAGATTGTTGAATGCTGG - Intergenic
960779117 3:121297966-121297988 TATCCAAAATAATTGAAAACAGG - Intronic
960960334 3:123066499-123066521 TACCCAAAAGAATTGAAAACAGG - Intergenic
962451757 3:135524656-135524678 TACCCAAAATAAATGAAAACAGG + Intergenic
963007937 3:140743507-140743529 TACCCAAGAGAATTGAAAGCAGG + Intergenic
963747280 3:149137477-149137499 TACCCAAAATAATTGAAAGCAGG + Intronic
964082762 3:152779846-152779868 TAGGCAAGAATGTTAAAAACTGG - Intergenic
965606370 3:170501398-170501420 CACCCAAGATTGTTGGCCACAGG - Intronic
967768470 3:193308560-193308582 TACCCACAATTGTTGAAAAATGG + Intronic
967780166 3:193429301-193429323 TACCCAAAAGAGTTGAAAACAGG + Intronic
969876408 4:10138766-10138788 TACCCAAGATAATTGCAAACAGG - Intergenic
969986499 4:11217109-11217131 TAACCAACATTGTTGAAAGTAGG - Intergenic
972326207 4:38017557-38017579 TACACAAGCTTGTTGGAAACTGG - Intronic
972857929 4:43130557-43130579 TACCCAAGACTATTGTAAAAGGG - Intergenic
972921271 4:43945203-43945225 GACTCAAGATTGTAGAAACCAGG - Intergenic
974197200 4:58590837-58590859 TAGCTAAGATGGTTAAAAACTGG + Intergenic
976177827 4:82373061-82373083 TGCCCAAGACTGTAGAAAAAGGG + Intronic
977114460 4:93005554-93005576 TACTCAAAATAATTGAAAACAGG + Intronic
979437256 4:120708152-120708174 TACCCCAAATAATTGAAAACAGG + Intronic
979569877 4:122209063-122209085 TTTCCAAGATTGTTGTAGACAGG + Intronic
979689332 4:123543856-123543878 TGCCCAACATTGTTGAAAGCTGG - Intergenic
980081379 4:128348067-128348089 TGCCCAAAATAATTGAAAACAGG - Intergenic
980279274 4:130698329-130698351 TTCTCAAAATTGTTGACAACTGG - Intergenic
981976524 4:150736692-150736714 TGGCCAAGATTTTTCAAAACTGG + Intronic
982230071 4:153200521-153200543 TACCCAAAACAATTGAAAACGGG - Intronic
982476870 4:155863624-155863646 TACACAATATTGTTCAGAACCGG - Exonic
985359464 4:189156027-189156049 TATTCATAATTGTTGAAAACTGG + Intergenic
985486053 5:150904-150926 TACCCATGATTGCCAAAAACTGG + Intronic
985982806 5:3486295-3486317 CACCCAAGAGAGTTGAAAATAGG + Intergenic
986227571 5:5829802-5829824 TACCCAAGAGAATTGAAAACAGG - Intergenic
991232830 5:64356504-64356526 TACCCAAAAGAATTGAAAACAGG + Intronic
991273218 5:64811134-64811156 CAGCCAAGGTTGATGAAAACTGG + Intronic
992032874 5:72740890-72740912 TACCCAAAAGAATTGAAAACAGG - Intergenic
992993962 5:82314513-82314535 TACCCCAAATAATTGAAAACAGG + Intronic
995575518 5:113528199-113528221 TACACATAACTGTTGAAAACAGG - Intronic
996925751 5:128824234-128824256 TACCCAATATTGTCTAAAAAGGG + Intronic
996930047 5:128875327-128875349 TACCCAAAAGAATTGAAAACAGG + Intronic
997219677 5:132150635-132150657 TTCCCAAGATTATCTAAAACAGG + Intergenic
998255868 5:140587385-140587407 TACCCAAAATAATTGAAAAGAGG + Intronic
998937411 5:147244366-147244388 TACCCAAAAGAATTGAAAACAGG - Intronic
999273860 5:150315225-150315247 TACCCAAAAAAGTTGAAAACAGG + Intronic
999878003 5:155829732-155829754 AAACCAAGAATGTTTAAAACAGG - Intergenic
999928144 5:156402252-156402274 TACCCAAAATAATGGAAAACAGG - Intronic
1000673774 5:164094940-164094962 TACTCTAGATTATTGAGAACAGG - Intergenic
1001578628 5:172782714-172782736 TACCCAAGAGAAATGAAAACAGG + Intergenic
1003077560 6:2996717-2996739 TAACCAAAATTATTGAACACAGG + Intronic
1004297811 6:14429988-14430010 TACTCAAAAGTATTGAAAACAGG + Intergenic
1005174619 6:23030554-23030576 TACCCAAAATAATTGAAAATAGG + Intergenic
1007506924 6:42342731-42342753 CAGCCAAGACTGTTGAAGACAGG - Intronic
1008767857 6:54941261-54941283 TCCCCAAGTTTTTTGAAAAAGGG + Exonic
1010944872 6:81961993-81962015 TACCCACAACAGTTGAAAACAGG + Intergenic
1011778131 6:90755121-90755143 TAACCAAAATCTTTGAAAACTGG - Intergenic
1012223730 6:96681889-96681911 CACCCAAAAGTGATGAAAACTGG + Intergenic
1014430499 6:121364993-121365015 TACCTAATATTCTTCAAAACTGG + Intergenic
1014535935 6:122612778-122612800 TACCCAAGAGAAATGAAAACGGG - Intronic
1016049589 6:139516625-139516647 TAACCAAGTTTGTCCAAAACTGG + Intergenic
1016366084 6:143320361-143320383 TACCCAAAAGAGTTGAAATCAGG + Intronic
1017199603 6:151738350-151738372 TACCCAAAATAATTGAAAGCAGG - Intronic
1018747933 6:166776899-166776921 TACCCAAGATTGTTGAAAACAGG - Intronic
1018970144 6:168522353-168522375 TACCCAAAAGACTTGAAAACAGG + Intronic
1019023319 6:168937433-168937455 TAACCAACATTGTTGCAATCTGG - Intergenic
1021023711 7:15637843-15637865 TCCACAGGATTGTTGAAAATAGG + Intronic
1021599701 7:22353307-22353329 TACTTATGATTGTTGGAAACAGG - Intronic
1023379463 7:39592105-39592127 TACTCATAATTGCTGAAAACTGG - Intronic
1025816341 7:64915747-64915769 GACCCCAGCTTGTTGGAAACAGG - Intronic
1026975777 7:74497228-74497250 TACCCCAAATCATTGAAAACAGG + Intronic
1028541580 7:91948263-91948285 TACCCAAGAGAAATGAAAACAGG - Intronic
1028894014 7:96020660-96020682 TACCCAAAATAATTGAAAGCAGG + Intronic
1029106668 7:98182738-98182760 TCCCCAAAATGGTTGAAAACAGG + Intronic
1030909320 7:115226844-115226866 TACTCAAGATTGTTGCAATAGGG - Intergenic
1031752564 7:125595437-125595459 TACCCAGAATAATTGAAAACAGG - Intergenic
1032041799 7:128569213-128569235 TACCCAAAAGAGTTGAAAGCAGG - Intergenic
1032521566 7:132549527-132549549 CTCCCAAGATTTTTGAAAGCTGG + Intronic
1033381426 7:140823646-140823668 TACCCAAAATAATTGAAAGCAGG - Intronic
1033549058 7:142429119-142429141 TACCCAAAAGAATTGAAAACAGG - Intergenic
1034250014 7:149682035-149682057 TACCCTATATTGTTTAAAAATGG - Intergenic
1034261148 7:149756543-149756565 TACCCAAAAGAGCTGAAAACAGG + Intergenic
1037402963 8:18511895-18511917 TACCCAAAATAATTGAAAACTGG + Intergenic
1039287504 8:36058321-36058343 TACCCTATATGGTTGAAAAAGGG - Intergenic
1040655989 8:49508338-49508360 TACCCAAAATAATTGAAAGCAGG - Intergenic
1040921196 8:52619953-52619975 TACCCAAAAGAATTGAAAACAGG + Intergenic
1041001059 8:53454006-53454028 TACCCAGTATTCTTGAGAACTGG - Intergenic
1041142037 8:54831191-54831213 TACCCAAAAGAATTGAAAACAGG - Intergenic
1041920577 8:63178712-63178734 TACTGTAGAATGTTGAAAACTGG + Intronic
1042204585 8:66316217-66316239 TACCCAAAAGAATTGAAAACAGG + Intergenic
1042574439 8:70202343-70202365 TACCCAAAAGAATTGAAAACAGG + Intronic
1042892219 8:73625218-73625240 TACCCAAGAGAAATGAAAACTGG + Intronic
1044170543 8:89046304-89046326 TACCTAGGATTGTTTAACACTGG - Intergenic
1044638620 8:94354722-94354744 TGCCCAAAATTATTAAAAACAGG + Intergenic
1045485145 8:102625354-102625376 TACCCAAAAGAATTGAAAACAGG - Intergenic
1045537958 8:103051424-103051446 TACCCAAGATTGTGTAGAATAGG + Intronic
1046497994 8:115039085-115039107 TACCCAAAAGGATTGAAAACAGG - Intergenic
1047433887 8:124818229-124818251 TACCCAAGAGAATTGAAAGCAGG - Intergenic
1047613278 8:126541800-126541822 TTCCCAAAATAGTTGAAAACAGG + Intergenic
1048050743 8:130813714-130813736 TACCCAAAATAATTGAAAAAAGG - Intronic
1050893535 9:10855777-10855799 TACCAAATATTGTAGAAAATAGG + Intergenic
1052651183 9:31303503-31303525 TATTCAAAAGTGTTGAAAACAGG - Intergenic
1053026911 9:34737525-34737547 TACCCAAGAGAACTGAAAACGGG - Intergenic
1053444217 9:38139218-38139240 TACCCAAAAGAGTTGAAAGCAGG - Intergenic
1055537735 9:77267066-77267088 AACCTAAGAGTGTTGAAAAAAGG - Intronic
1056695705 9:88849262-88849284 TACCTAAGAGAATTGAAAACAGG - Intergenic
1058609463 9:106759386-106759408 TACCCAAAATAATTGAAAGCAGG + Intergenic
1059339563 9:113589893-113589915 TACCCAAAGTTGGTGAAAGCAGG + Intronic
1060585911 9:124785708-124785730 TACCCAAGAGAATTGAAAATGGG - Intronic
1062153850 9:135035088-135035110 TACCCAAGATGATTGAAAGCAGG - Intergenic
1062445862 9:136594305-136594327 TGCCCAAGAAGATTGAAAACAGG + Intergenic
1186209082 X:7231020-7231042 TACCCAAAAGAATTGAAAACAGG + Intronic
1186767404 X:12785115-12785137 TGCTCAAGAGAGTTGAAAACAGG - Intergenic
1186839682 X:13472853-13472875 TACCCAAGAGAATGGAAAACAGG + Intergenic
1187909525 X:24098224-24098246 TACCCAAAAGAATTGAAAACAGG - Intergenic
1188623470 X:32255271-32255293 TACCCAAAATAATTGAAAACAGG - Intronic
1188791325 X:34411590-34411612 TATCCAAAATAATTGAAAACAGG + Intergenic
1189612635 X:42753448-42753470 TAGCCAAGGTTGCTGAACACAGG - Intergenic
1189901104 X:45707209-45707231 TACCCAAAAAAGTTAAAAACAGG + Intergenic
1189904127 X:45740544-45740566 TACCCAAAAGAATTGAAAACAGG - Intergenic
1190023319 X:46899203-46899225 TACACAAATTTTTTGAAAACTGG + Intronic
1190451826 X:50589764-50589786 TACCCAAGAGAATTGGAAACAGG - Intergenic
1190851205 X:54243783-54243805 TGCCCCAGATAATTGAAAACAGG + Intronic
1190861849 X:54352729-54352751 TACCCAAAATAAATGAAAACAGG + Intronic
1192801764 X:74472163-74472185 TACCCAAAATAATTGAAATCAGG - Intronic
1192898365 X:75468554-75468576 TACCCAAAATAATTGAAAACAGG - Intronic
1194609204 X:96019884-96019906 TATCCAAAAGTGTTGAAATCAGG + Intergenic
1195401058 X:104461786-104461808 TAACCTAGAATATTGAAAACAGG - Intergenic
1195646646 X:107238283-107238305 TACCCAAGAGCACTGAAAACAGG - Intronic
1195966026 X:110431214-110431236 GAACCAAGATTGGTGAAAACTGG - Intronic
1196370404 X:114972510-114972532 TACCCAAGAGAATTGAAAATAGG - Intergenic
1196705567 X:118714591-118714613 TACCCAAAATAATTGAAAGCCGG - Intergenic
1196749627 X:119103601-119103623 TACCCAAAAGAATTGAAAACAGG + Intronic
1197403592 X:126024274-126024296 TACCCAAAATTATTGAAAGCAGG - Intergenic
1198111628 X:133507369-133507391 TACCCAACAGTGCTTAAAACAGG + Intergenic
1198869887 X:141166652-141166674 TACCCACTATAATTGAAAACAGG + Intergenic
1199175178 X:144779688-144779710 TACCCAAAATTATTGAAAGCAGG + Intergenic
1199714490 X:150496726-150496748 TACCCAGCATTGCTGACAACAGG + Intronic
1202273423 Y:23092257-23092279 TACCCAAAAGAATTGAAAACAGG + Intergenic
1202292603 Y:23328425-23328447 TACCCAAAAGAATTGAAAACAGG - Intergenic
1202426420 Y:24726001-24726023 TACCCAAAAGAATTGAAAACAGG + Intergenic
1202444369 Y:24944085-24944107 TACCCAAAAGAATTGAAAACAGG - Intergenic