ID: 1018753504

View in Genome Browser
Species Human (GRCh38)
Location 6:166828286-166828308
Sequence GAGGGCAGGTCTTTCAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018753504_1018753517 21 Left 1018753504 6:166828286-166828308 CCTCTTCTGAAAGACCTGCCCTC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 1018753517 6:166828330-166828352 CCACACCCGCCACCTTCCTGTGG 0: 1
1: 0
2: 2
3: 22
4: 268
1018753504_1018753519 23 Left 1018753504 6:166828286-166828308 CCTCTTCTGAAAGACCTGCCCTC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 1018753519 6:166828332-166828354 ACACCCGCCACCTTCCTGTGGGG No data
1018753504_1018753518 22 Left 1018753504 6:166828286-166828308 CCTCTTCTGAAAGACCTGCCCTC 0: 1
1: 0
2: 1
3: 19
4: 268
Right 1018753518 6:166828331-166828353 CACACCCGCCACCTTCCTGTGGG 0: 1
1: 0
2: 1
3: 35
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018753504 Original CRISPR GAGGGCAGGTCTTTCAGAAG AGG (reversed) Intronic
902148878 1:14426266-14426288 CAGGGCAGGCCTTTCTGCAGAGG - Intergenic
902883185 1:19386380-19386402 GATGGCAGCACTTTCAGAAATGG + Intronic
902896499 1:19484061-19484083 GAGGGCAGGTCTATCTGTGGGGG + Intronic
902938856 1:19785176-19785198 CAGGGAAGGTCTCTCAGAGGAGG - Intronic
903182941 1:21614223-21614245 GAGTGCAGGTCTGTCTGATGTGG - Intronic
904317279 1:29673677-29673699 GAGAGCAGGTCTCTCAGGAGGGG - Intergenic
906382426 1:45341235-45341257 GAGGGCAGGTGGTTGTGAAGGGG + Intronic
906663304 1:47597902-47597924 GAGGGCAGTACTCTCAGAGGGGG - Intergenic
907131967 1:52105052-52105074 GAGGGCAAGTCTCCAAGAAGGGG + Intergenic
907221137 1:52907691-52907713 GAGGGCAGTTCTCTCAGAGAGGG - Intronic
908829187 1:68162924-68162946 GTGGCCAGGTCTTTCAGGATGGG + Intronic
911131466 1:94392671-94392693 GAGGGTAGTTCTCTCAGAAGAGG + Intergenic
911441183 1:97927555-97927577 GAGGGCAGAACTTTCATAAATGG - Intergenic
912380371 1:109244537-109244559 CACGGCAGGGTTTTCAGAAGGGG + Intergenic
914747370 1:150510131-150510153 GAGGGCAGCTCTTTTTGGAGGGG - Exonic
915216818 1:154345990-154346012 GAAGGCAGTTCTTTCAGCCGGGG + Intronic
915449684 1:155995967-155995989 AAGGGTAGATCTTTGAGAAGAGG - Intronic
915904208 1:159866125-159866147 GAGGGCAGGGCTTAGAGGAGTGG - Intronic
916212219 1:162368228-162368250 CAGGGCAGGACTTTCAAAACAGG - Exonic
918129281 1:181611023-181611045 GGAGGCATGTCTTTCAGAACTGG - Intronic
921567109 1:216734381-216734403 GAGGGCAGATCTGTCAGGAATGG + Intronic
922031542 1:221805171-221805193 GAGGGTAGATCCTTCATAAGTGG - Intergenic
923644446 1:235802543-235802565 GAGGGAAGTCCTTTCTGAAGAGG - Intronic
1063130585 10:3173496-3173518 GGGGGCAGGGCTGGCAGAAGTGG + Intergenic
1065867899 10:29929446-29929468 GAGGGAAGACCTCTCAGAAGTGG - Intergenic
1066672787 10:37857862-37857884 GAGGGCGTCTCTGTCAGAAGGGG - Intronic
1067364727 10:45615130-45615152 GAGGGCAGTACATTCATAAGAGG - Intergenic
1067545187 10:47187838-47187860 GAGGCCAAGGCTCTCAGAAGAGG - Intergenic
1067762309 10:49057584-49057606 GAGGGCAGGCCTGTGAGATGGGG - Intronic
1069941166 10:71956384-71956406 GATGTCAGGCCTTTCACAAGAGG - Intergenic
1071992223 10:91110825-91110847 CAGGGTGGGTCTTACAGAAGTGG + Intergenic
1075278699 10:121119736-121119758 GACAGCAGATCTTTCACAAGGGG - Intergenic
1077945809 11:6896908-6896930 GTGGGCATGTCTTTGAGTAGAGG - Intergenic
1079311858 11:19373531-19373553 CAGAGGAGGTCTTTCAGAGGAGG - Intronic
1080778224 11:35406188-35406210 GAGGGAAGGCTTCTCAGAAGAGG - Intronic
1081781203 11:45714252-45714274 GAGTCGATGTCTTTCAGAAGAGG + Intergenic
1083537155 11:63480048-63480070 GAGGGCAGGGCTCTCAGAGTCGG + Intronic
1085401950 11:76240822-76240844 GAGGGCAGGTCTGTGGGGAGGGG + Intergenic
1085516885 11:77116701-77116723 GAGGGCAGGGCTTCCTGGAGAGG - Intronic
1086877352 11:92112464-92112486 GTGGGCATTTCTTTCAGCAGAGG + Intergenic
1088505462 11:110522731-110522753 GGGGGCAGGGGTGTCAGAAGTGG - Intergenic
1089200717 11:116723185-116723207 CAGGGCAGGTTTTCCAGAGGAGG - Intergenic
1089282723 11:117385677-117385699 GAGGGCAGGATTCTCAGAGGAGG + Intronic
1090728853 11:129552272-129552294 GGGGGCAGATCTTTCATAAATGG + Intergenic
1090831968 11:130426563-130426585 GAGGGTAAGGCTTCCAGAAGAGG - Intronic
1093698314 12:22188753-22188775 GAGGGCAGGTCTTCTAGCAGTGG + Intronic
1095836070 12:46639791-46639813 AAGGGCAGGTCACTTAGAAGGGG + Intergenic
1096348577 12:50873861-50873883 AAAGGCAGGTATTTCAGGAGGGG + Intronic
1096429966 12:51534814-51534836 CAGGGGAGGCCTTTCGGAAGGGG + Intergenic
1097362252 12:58670908-58670930 TAGGGCAGGACTTACAGATGTGG - Intronic
1097550832 12:61066251-61066273 GAGGGCAAGTTTGTGAGAAGTGG + Intergenic
1101633847 12:106521145-106521167 CAGGGCAAGTTTTCCAGAAGAGG + Intronic
1101651671 12:106682715-106682737 CAGGGAAGGTCTTTCAGAGGAGG + Intronic
1102351818 12:112198255-112198277 GAGGGCAGAGCTTTTTGAAGAGG + Intronic
1104336437 12:127900073-127900095 CAGGGAAGGTCTCTCAGAGGAGG + Intergenic
1104656657 12:130578668-130578690 GAGGGGAAGTCTCTGAGAAGGGG - Intronic
1105257954 13:18757285-18757307 GGGGCCAGATCTTTCAGAAATGG - Intergenic
1105263167 13:18795162-18795184 GGGGGCAGATCTTTCACCAGTGG - Intergenic
1105567707 13:21567271-21567293 CAGAGAAGGTCTTTCTGAAGAGG + Intronic
1105712046 13:23020564-23020586 GAGGGCAGAGCCCTCAGAAGGGG - Intergenic
1106133741 13:26959199-26959221 GAGTGCTGGTCTCTCAGAAAGGG + Intergenic
1110236598 13:73223422-73223444 GGTGGCATGTCCTTCAGAAGGGG + Intergenic
1110441259 13:75528592-75528614 GAGGTCAGGAGTTTCAGAAGTGG + Intronic
1111671121 13:91331758-91331780 GAGGGCAGGCCTTTTGGCAGGGG + Intergenic
1111866417 13:93774246-93774268 GAGGTTAGGTCTTCAAGAAGAGG + Intronic
1113374832 13:109755513-109755535 GAGGGAAGGGCTTTGGGAAGGGG - Exonic
1113884165 13:113649199-113649221 GCGAGCAGGTCCTTCAGATGTGG + Exonic
1114921450 14:27336259-27336281 GAGGTAAGGTTTTTCAAAAGAGG - Intergenic
1116079553 14:40155505-40155527 GAGGGCAGGTATTTCCCATGCGG - Intergenic
1117502266 14:56364828-56364850 GAAAGCAGGTTTTTCAGCAGAGG - Intergenic
1118336815 14:64860439-64860461 GAGGGCAGGGCTCTGAGAAAAGG + Intronic
1118986010 14:70755305-70755327 GTGGGCTGATCATTCAGAAGAGG + Intronic
1120384570 14:83827901-83827923 CAGGGCAGGTGTTTCAGAAAGGG - Intergenic
1120959386 14:90110641-90110663 CAGGGCATGTCTTTCTAAAGTGG + Intronic
1121571638 14:94950978-94951000 GAAGACAGGTCCTTCAGAACAGG + Intergenic
1121607581 14:95252631-95252653 CAGGGCAGGTCTTTCTGGATTGG - Intronic
1122181704 14:99959808-99959830 GAGGGCATTTCTACCAGAAGTGG + Intergenic
1122410661 14:101524446-101524468 GAGAGCAGGACTGTTAGAAGAGG - Intergenic
1122807280 14:104266251-104266273 GGGGGCAGGTCTCCCAGAACAGG - Intergenic
1123135350 14:106022658-106022680 GAGGGATGCTCTTTCAGAGGAGG - Intergenic
1123164716 14:106315338-106315360 GAGGGATGCTCTTTCAGAGGAGG - Intergenic
1123200564 14:106659680-106659702 AAAGGCAGGACTTTCTGAAGTGG + Intergenic
1123397980 15:19955976-19955998 GAGGGCTGCTCTTTCAGAGGAGG - Intergenic
1123585892 15:21760520-21760542 GAGGGATGCTCTTTCAGAGGAGG - Intergenic
1123622533 15:22203110-22203132 GAGGGATGCTCTTTCAGAGGAGG - Intergenic
1126023178 15:44421968-44421990 CAGGGAAGGCCTTTCTGAAGAGG + Intergenic
1127723430 15:61724959-61724981 GAGGGAAGGCCTTCCAGAAAAGG + Intergenic
1128749618 15:70139740-70139762 CAGGGCAGGGCTTACAGAGGAGG - Intergenic
1128839527 15:70838654-70838676 GAGGGCTAATCTTTCATAAGGGG + Intronic
1128974669 15:72142498-72142520 GAAGGCAGGTTTTTCAAAACTGG + Exonic
1129687184 15:77693430-77693452 CAAGGAAGGTCTTTCTGAAGCGG + Intronic
1131149965 15:90041571-90041593 CAGGGAAGCTCTTTCAGAGGAGG - Intronic
1131695600 15:94874658-94874680 TAGGGAAGGTCTCTCAGAAAAGG - Intergenic
1132750731 16:1456245-1456267 GAGGGCACGGCTCTCAGAAAGGG + Intronic
1132846499 16:2003290-2003312 CAGGGCTGGTCTCTCAGAGGAGG - Intronic
1133275537 16:4636220-4636242 GGAGGCAGGTTGTTCAGAAGGGG - Intronic
1133588787 16:7222196-7222218 GAGGGCAGGTGGTTCACAAAGGG + Intronic
1133595275 16:7285008-7285030 GAGGGAAGGCTTTTCTGAAGAGG - Intronic
1134583297 16:15389805-15389827 GAGGGCAAGTCTCTCAAAATGGG + Intergenic
1135870607 16:26146553-26146575 GAAGGCAGGTGTATGAGAAGAGG - Intergenic
1136366213 16:29810415-29810437 GGGGTCAGGTCTGACAGAAGAGG - Exonic
1136595674 16:31248053-31248075 TAGGGCAGGCTTCTCAGAAGAGG + Intergenic
1137251385 16:46743446-46743468 CAGGGCAGGTCTTGCAGGAAGGG - Intronic
1137509971 16:49090555-49090577 AAGGGCCTGCCTTTCAGAAGAGG + Intergenic
1138073874 16:54021325-54021347 GAGGGCAGCTGGTTTAGAAGAGG + Intronic
1138888638 16:61113530-61113552 GAGGGCAGTGTTTCCAGAAGAGG + Intergenic
1139309931 16:66019630-66019652 GGGGGCAGGTCTTTCCCATGTGG + Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1141381673 16:83582614-83582636 GTGGCCAGGTCTCTCAGGAGTGG + Intronic
1143164602 17:4891643-4891665 GGGGCCAGGTCCTTCAGAGGTGG - Exonic
1144038897 17:11391088-11391110 CAGGGCAGGTATTTCAGGTGGGG + Intronic
1145290916 17:21545147-21545169 GAGGGCAGATCCTTCAGGAATGG + Intronic
1146472292 17:33134320-33134342 GAGGGCAGGTATTACAGCAGGGG - Intronic
1146610928 17:34304374-34304396 GAGGGCATGGCTTTAGGAAGTGG + Intergenic
1149355335 17:55833781-55833803 GAGGCAAGGTCTTTCAGCGGGGG - Intronic
1150931005 17:69585232-69585254 CAGGGAAGGTCTTTCTGTAGAGG + Intergenic
1151211275 17:72546262-72546284 GAGAGCATTTATTTCAGAAGTGG - Intergenic
1151214431 17:72568028-72568050 GAGGCCAGGTCCTTCAAAACTGG + Intergenic
1152142167 17:78543018-78543040 GAGGGCAGGCCCATCATAAGAGG + Intronic
1152577584 17:81149603-81149625 GCGGGCAGTGCTTTTAGAAGTGG - Intronic
1154428135 18:14287788-14287810 GGGGGCAGATCTTTCACAAATGG + Intergenic
1154428545 18:14290715-14290737 GAGGGCAGATCCTTCACAAACGG + Intergenic
1157067991 18:44374383-44374405 GGGGATAAGTCTTTCAGAAGAGG + Intergenic
1157122736 18:44926652-44926674 AAGGGCAGGTGTCTGAGAAGGGG + Intronic
1158088511 18:53682754-53682776 GAGGGCAGGGGTTTAAGAAAAGG + Intergenic
1159990770 18:74904438-74904460 GAGGGCAGGGCTTCCAGCAAGGG - Intronic
1161338887 19:3729996-3730018 GAGGGCGGGTCTTACGGAGGAGG - Intronic
1161649484 19:5475541-5475563 CATGGCAGGGCTTTCAGCAGGGG + Intergenic
1162009808 19:7805720-7805742 GAGGTCAGGTCTTTCAGAGCAGG + Intergenic
1162725236 19:12686315-12686337 CAGGGCAGGCCTCTCAGAGGAGG - Intergenic
1163210050 19:15833672-15833694 TAGAGCAGGTTTTTTAGAAGAGG - Intergenic
1164699207 19:30270958-30270980 GATGGCAGATGTTTCAGAAATGG - Intronic
1165139475 19:33690139-33690161 GAGGGGAGGTGTCTCAGCAGTGG + Intronic
1166867914 19:45852215-45852237 GAGGGCAGGCCTCTCAGTGGTGG + Intronic
1167703078 19:51062297-51062319 CAGGGAAGGCCTTTCTGAAGAGG - Intronic
1167972590 19:53197785-53197807 AAGGGCAGGTCTTGGAGAACCGG - Intergenic
925156966 2:1656499-1656521 GAGGGCAGGTCTCTGTCAAGAGG - Intronic
925839585 2:7979026-7979048 GAGGAAATGTCTTACAGAAGAGG - Intergenic
926206756 2:10839464-10839486 GAGGTGGGGTCTTTGAGAAGTGG - Intergenic
926619541 2:15034797-15034819 AAGGGCTGGTATTACAGAAGTGG - Intergenic
928337958 2:30414279-30414301 ACGGGAAGGTCTTACAGAAGAGG - Intergenic
929548621 2:42874982-42875004 GAGGGCAGGTCTTAGAGACAGGG + Intergenic
929589674 2:43136641-43136663 GAGGGGACTTCTTGCAGAAGTGG + Intergenic
930190245 2:48451449-48451471 GATGGCAGGTCTCTAATAAGTGG + Intronic
930239020 2:48916423-48916445 GTGGTCAGGTCTTTCAGGATGGG + Intergenic
932222188 2:70008456-70008478 GAGGCCAGGTCTGGCAGCAGAGG + Intergenic
932889303 2:75578157-75578179 GAGGGCAGAACTTTCATGAGTGG + Intergenic
934763476 2:96868651-96868673 GAGGGCTGGTGTTTCGGAGGAGG - Intronic
936109284 2:109651734-109651756 GAAGTCAGATCTTTCAGAATGGG + Intergenic
936948234 2:117950579-117950601 AAGGGCAGGTTTTGCTGAAGAGG + Intronic
937795940 2:126020129-126020151 GAGGGCTGGTTTTTCATAGGTGG - Intergenic
941322771 2:164075825-164075847 CAGGGAAGGTCTCTCTGAAGAGG - Intergenic
941823229 2:169863958-169863980 CAGGGAAGGCCTTTCTGAAGAGG - Intronic
942266785 2:174235421-174235443 GAGGGCAGTTCTTGTAGCAGAGG - Intronic
942869110 2:180713568-180713590 GGGGGCAGGTCTTTCCCATGCGG + Intergenic
942883512 2:180893329-180893351 GAGGGCAGATCCTTCAGGAATGG + Intergenic
943907249 2:193515281-193515303 GAGGGCAGGTCCTTCATGAATGG - Intergenic
948895749 2:240926105-240926127 GAGGGCAGGGATCTCAGAATGGG + Intronic
1169512329 20:6277737-6277759 GTGTCCAGGTCTGTCAGAAGAGG - Intergenic
1169650771 20:7865011-7865033 GAGGGCAGGAGTTGCAGATGAGG - Intergenic
1170410327 20:16082320-16082342 GGGGGCATGTCTGTCAGGAGTGG - Intergenic
1171211646 20:23321454-23321476 CAGGGAAGGTCTCTCAGATGAGG + Intergenic
1173560613 20:44002866-44002888 TGGGGCAGATCTTTCAGTAGTGG - Intronic
1173839460 20:46147893-46147915 GATGGCAGGACTTTAAGCAGAGG + Intergenic
1174036598 20:47672388-47672410 CCTGGCATGTCTTTCAGAAGTGG - Exonic
1174221062 20:48956025-48956047 AAGAACAGGTCCTTCAGAAGAGG + Intronic
1175328877 20:58149016-58149038 CAGGGCAGGTCTCTCTGAGGAGG - Intergenic
1175640200 20:60623083-60623105 GATGGCATTTGTTTCAGAAGGGG - Intergenic
1176744663 21:10640716-10640738 GAGGGATGCTCTTTCAGAGGAGG - Intergenic
1178383022 21:32127251-32127273 GAGGTCACTTCTTTCAGAAATGG - Intergenic
1179041240 21:37803884-37803906 GAGGGGAGGGCTCACAGAAGGGG + Intronic
1180633021 22:17242785-17242807 GAGGGAAGTGATTTCAGAAGAGG + Intergenic
1181673439 22:24436824-24436846 GGGGGCAGGTGTGTCAGGAGGGG + Intronic
1185024274 22:48398715-48398737 GTGGGCAGGAGGTTCAGAAGAGG - Intergenic
949112055 3:273009-273031 GAAAGAAGGTCTTTCTGAAGCGG + Intronic
949838955 3:8299821-8299843 GAGATCAGGTCATGCAGAAGTGG - Intergenic
953252644 3:41260686-41260708 GAGGCAGGGTCTTACAGAAGAGG + Intronic
954256916 3:49413454-49413476 GAGCGCATGTTTTGCAGAAGAGG - Intronic
956471546 3:69572165-69572187 AAGGGAAGGTCTCTCAGAAGAGG + Intergenic
956503110 3:69909142-69909164 GAGGGCTGGTCTTTCCCATGTGG + Intronic
956788751 3:72664153-72664175 GATGGCAGGTCTTACCCAAGAGG - Intergenic
957856936 3:85891588-85891610 GAGACGAGGTCTTTAAGAAGGGG + Intronic
958859472 3:99428812-99428834 GAGGGCAGGTTTATAACAAGGGG - Intergenic
959952262 3:112193399-112193421 GGGGGCATATCTTTCAGCAGAGG + Intronic
960348000 3:116558865-116558887 GACCCCAGGTATTTCAGAAGTGG - Intronic
961669622 3:128519399-128519421 TTGGGCAGGTCTCTCTGAAGAGG - Intergenic
961866113 3:129954613-129954635 CAGGGCAGGTCTCACAGAGGAGG - Intergenic
962499858 3:135980300-135980322 CAAGGCAGGTCTCTAAGAAGTGG + Intronic
963077955 3:141365547-141365569 GAGGTGGGGTCTTTCAGAGGTGG - Intronic
963311495 3:143714919-143714941 GGGGGCAGGTCTTTCCTATGCGG + Intronic
964389556 3:156183269-156183291 GAGGTGAGGGCTTTGAGAAGGGG + Intronic
965057966 3:163745935-163745957 GAGGGCAGATCTGTCATAAATGG - Intergenic
966271475 3:178112362-178112384 CAGGGCAGGTCTCTCAGGAGTGG + Intergenic
967425303 3:189319983-189320005 CAGGGCAAGTCTTTCTGAGGAGG - Intronic
970595228 4:17594208-17594230 GAGAGCAGAACTTCCAGAAGAGG + Intronic
972362097 4:38336175-38336197 GAGGTGAGGTCTTTAAGAAGTGG + Intergenic
972789702 4:42359093-42359115 GAGGAAAGGGCTTCCAGAAGGGG + Intergenic
976519505 4:86009570-86009592 CAGGGCAAGCCTCTCAGAAGAGG - Intergenic
976587849 4:86818992-86819014 GAAGGCTGGACATTCAGAAGGGG + Intergenic
976721230 4:88170623-88170645 GAGGGCAGGGGTTTCAGAAGAGG - Intronic
977141921 4:93384093-93384115 GACGGCACATCTTGCAGAAGGGG + Intronic
977816527 4:101419678-101419700 GAGAGCTGGTCTTTCAAAAAAGG - Intronic
979306494 4:119150454-119150476 GAGGGTAGGCATTTCAGTAGGGG + Intronic
981050464 4:140304706-140304728 GAAGGCTGGTCTTTGGGAAGGGG + Intronic
981447228 4:144854204-144854226 GAGGGAAGGCCCTCCAGAAGTGG + Intergenic
983495629 4:168439445-168439467 TAGGGCAGGTCTTAAGGAAGGGG - Intronic
984164670 4:176293097-176293119 GAGGGAAGGTGCTTGAGAAGTGG + Intergenic
988354428 5:30154903-30154925 GAGAGCAGTTCTTTCAGAAAGGG - Intergenic
988522460 5:31958839-31958861 GAGGTCAGGAGTTTGAGAAGAGG - Intronic
990131813 5:52595458-52595480 GAGGGCAGGTCCTTCATGAATGG + Intergenic
991219636 5:64198581-64198603 GAGGGCAGGTATTTCAGGGTTGG + Intronic
992002914 5:72452635-72452657 GAGGGCAGAGCTGTCAGAATAGG - Intronic
995735794 5:115297951-115297973 GAGGGAAGTTTTTGCAGAAGAGG + Intergenic
996282302 5:121745371-121745393 GAAGGCATGTCTTTAAGAATTGG + Intergenic
997098110 5:130936973-130936995 CAGGGAAGGCCTTTCAGAGGAGG - Intergenic
997370056 5:133353837-133353859 GAGGCCAGTTCTTTGAGCAGCGG + Intronic
997377471 5:133407456-133407478 GTGGTCAAGTCTTTCAGAACTGG - Intronic
997754634 5:136384850-136384872 GAGGGCAGATCTAGCACAAGAGG - Intronic
997849263 5:137316233-137316255 GAGGGCATGTCCTTCATGAGTGG - Intronic
998180203 5:139932111-139932133 GAGTGCAGATCTTTATGAAGTGG - Intronic
998583747 5:143404770-143404792 GAGGTCAGGAGTTTCGGAAGGGG - Intronic
998620539 5:143789657-143789679 CAGGGAGGGTCTTTCTGAAGAGG - Intergenic
1001196499 5:169677859-169677881 GAGGGCAGGGGTTTCAAAAAGGG + Intronic
1001928314 5:175655491-175655513 TATGGCAGGTCTTTAAGCAGGGG - Intergenic
1003503422 6:6721270-6721292 GAGGGCTGGTCCTGGAGAAGTGG + Intergenic
1004859979 6:19793920-19793942 GAAGGCAGGGCTTCCAGCAGAGG + Intergenic
1005496598 6:26393034-26393056 GAGGGCGTGTCTTTCATTAGGGG - Exonic
1006813766 6:36837678-36837700 GAGGCCAGGCTTTTCAGGAGTGG + Intronic
1006967262 6:38000604-38000626 GGGGGCAGGTCTTTCCCAGGCGG - Intronic
1007718859 6:43873481-43873503 CAGGGCAGGCCTTTCTGAAAAGG + Intergenic
1009291650 6:61889977-61889999 TAGGGAAGGTCTCTCTGAAGTGG - Intronic
1010449986 6:75991608-75991630 GAGAGAAGGTTGTTCAGAAGGGG - Intronic
1010902372 6:81442837-81442859 GAGGGCAGGGTTTTCTTAAGTGG + Intergenic
1011980218 6:93365496-93365518 GAGGTCAGTTCTTTGAGCAGTGG - Intronic
1015864723 6:137716569-137716591 GAGAGCAGGTCTTATAGAAGAGG + Intergenic
1018753504 6:166828286-166828308 GAGGGCAGGTCTTTCAGAAGAGG - Intronic
1018767409 6:166945045-166945067 GAGGGCAGGGCTGACAGATGTGG - Intronic
1020051799 7:5086686-5086708 GGGGGCAGGTCTTGTAGAGGGGG - Intergenic
1021148962 7:17125644-17125666 GAAGGCAGGTATATCAGAATTGG - Intergenic
1021586751 7:22216679-22216701 TATGGGAGGACTTTCAGAAGGGG - Intronic
1023107355 7:36775375-36775397 GAGGGCAGATCTCTCATAAATGG + Intergenic
1026109241 7:67445710-67445732 GGAGGCAGGTGTTTCAAAAGAGG - Intergenic
1028637502 7:93005960-93005982 AAGGACAGGTGTTTCAGAGGTGG + Intergenic
1028907522 7:96172116-96172138 CAGGGCTGGTCCCTCAGAAGAGG - Intronic
1029247774 7:99214861-99214883 TAGAGCAGGTATTTCAGAAGTGG - Intergenic
1031118394 7:117692913-117692935 GAGGTCAGGTCTTGCAGCAGAGG - Intronic
1032163741 7:129529783-129529805 GGGGGCAGTTCTTTGTGAAGAGG + Intergenic
1032206464 7:129870155-129870177 GAGGCCTGGTGTTTGAGAAGAGG - Intronic
1033550721 7:142445244-142445266 GAGGGCAGGTGACCCAGAAGAGG + Intergenic
1035393035 7:158517876-158517898 GAGGGAAGGTTTTTCTGCAGTGG - Intronic
1036492819 8:9243682-9243704 CACGGCAGGTGTTTGAGAAGGGG + Intergenic
1036507090 8:9365819-9365841 CAGGGTAGCTCTTTCTGAAGGGG + Intergenic
1038859208 8:31367821-31367843 CATGGCTGGTCTTTCTGAAGAGG - Intergenic
1041396467 8:57396689-57396711 GAGGGCAGGGCCTTCAGCACTGG - Intergenic
1042166371 8:65949833-65949855 CAGGGAAGGCCTTTCTGAAGAGG + Intergenic
1042639426 8:70917233-70917255 CAGGGAAAGTCTTTCAGAAAAGG - Intergenic
1044243612 8:89915361-89915383 GAGGGTAGGTCCCTCAGAATGGG - Intronic
1044319038 8:90781527-90781549 GAGGAGAGGTGTTGCAGAAGAGG + Intronic
1045369139 8:101504153-101504175 GAGGGCAGGGATTTCTGCAGGGG - Intronic
1047398366 8:124524688-124524710 AAGGGAAGGTTTTGCAGAAGGGG + Intronic
1049224287 8:141442209-141442231 GAGGGCAGGAGTCTCAGGAGTGG - Intergenic
1049434690 8:142581099-142581121 GGGGTCAGGTCTTCCAGGAGAGG + Intergenic
1049731571 8:144181046-144181068 GAGGGCATTTCTGTTAGAAGGGG + Intronic
1051594118 9:18806926-18806948 GAGGGCAGCTCTTACACAACAGG - Intronic
1052879235 9:33590503-33590525 GGGGGCAGATCTTTCACAAATGG + Intergenic
1053496743 9:38553716-38553738 GGGGGCAGATCTTTCACAAATGG - Intronic
1055007728 9:71527730-71527752 GTGGGCTGGTCTTAGAGAAGAGG - Intergenic
1056274528 9:84980958-84980980 CAGGACAGGTCTGTCTGAAGGGG + Intronic
1056981717 9:91318798-91318820 GAGTGCAGGGGTTTAAGAAGAGG - Intronic
1057507144 9:95644269-95644291 CAGGGAAGGTCTCTCTGAAGAGG + Intergenic
1057676659 9:97141273-97141295 GGGGGCAGATCTTTCACAAATGG - Intergenic
1058175278 9:101728880-101728902 TAGGCCAGGGCTTTCAGAAATGG - Intronic
1059657408 9:116369076-116369098 GAGGAAAGGTATATCAGAAGAGG - Intronic
1059789072 9:117620181-117620203 GAGGACAGATCCTTCAGAAATGG - Intergenic
1060515469 9:124263050-124263072 GAGGGCAGGCATTCGAGAAGGGG - Intronic
1060999772 9:127896605-127896627 GAGGTCAGGTCCTCCAGCAGGGG - Intronic
1061709907 9:132480381-132480403 TGGGGCAGGTCTTCCAGAACAGG - Intronic
1062642336 9:137525754-137525776 GATGTCAGGCCTTTCACAAGAGG + Intronic
1185687191 X:1938942-1938964 GGGGGCAGGTCTTTCTCATGTGG + Intergenic
1186556881 X:10569122-10569144 GAGGGATGCTATTTCAGAAGGGG - Intronic
1188441356 X:30217437-30217459 GAGGGCAGGTTTTTCATGAATGG - Intronic
1189863032 X:45292770-45292792 CAGGACAGGCTTTTCAGAAGAGG + Intergenic
1193995052 X:88355396-88355418 GAGGGCAGGTCTCTCATAAATGG - Intergenic
1195598111 X:106716092-106716114 GAGGGAAGGTATTTCAGTAGAGG - Intronic
1196799609 X:119530968-119530990 GAGGTCAGGAGTTTGAGAAGCGG - Intergenic
1197209075 X:123814772-123814794 TAGGGCAAGCCTTCCAGAAGAGG + Intergenic
1197824803 X:130577509-130577531 CTGGAAAGGTCTTTCAGAAGAGG + Intergenic
1198428773 X:136545627-136545649 GAGGGAAGGCCTTTCTGAAAGGG + Intronic
1199778117 X:151033460-151033482 GAGGGCAGGTCTCTGTGAAGAGG + Intergenic