ID: 1018753632

View in Genome Browser
Species Human (GRCh38)
Location 6:166829484-166829506
Sequence CAGAGGCTAAGGAAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94416
Summary {0: 1, 1: 21, 2: 777, 3: 6738, 4: 86879}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018753625_1018753632 -5 Left 1018753625 6:166829466-166829488 CCGTAGTCCCAGCTACTCCAGAG 0: 35
1: 209
2: 2123
3: 4816
4: 5225
Right 1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG 0: 1
1: 21
2: 777
3: 6738
4: 86879
1018753624_1018753632 -4 Left 1018753624 6:166829465-166829487 CCCGTAGTCCCAGCTACTCCAGA 0: 1302
1: 9603
2: 118577
3: 247901
4: 241623
Right 1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG 0: 1
1: 21
2: 777
3: 6738
4: 86879
1018753623_1018753632 15 Left 1018753623 6:166829446-166829468 CCGGGTATGGTGGCGGGCGCCCG 0: 1
1: 173
2: 7240
3: 36058
4: 78765
Right 1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG 0: 1
1: 21
2: 777
3: 6738
4: 86879

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018753632 Original CRISPR CAGAGGCTAAGGAAGGAGAA TGG Intronic
Too many off-targets to display for this crispr