ID: 1018757494

View in Genome Browser
Species Human (GRCh38)
Location 6:166862754-166862776
Sequence GCGGGCTGGGGAGGTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2831
Summary {0: 1, 1: 1, 2: 25, 3: 281, 4: 2523}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018757494_1018757518 28 Left 1018757494 6:166862754-166862776 CCTTCCCCACCTCCCCAGCCCGC 0: 1
1: 1
2: 25
3: 281
4: 2523
Right 1018757518 6:166862805-166862827 CCTCCCGCCGCAGAACGGGAGGG No data
1018757494_1018757513 23 Left 1018757494 6:166862754-166862776 CCTTCCCCACCTCCCCAGCCCGC 0: 1
1: 1
2: 25
3: 281
4: 2523
Right 1018757513 6:166862800-166862822 CGCCACCTCCCGCCGCAGAACGG No data
1018757494_1018757514 24 Left 1018757494 6:166862754-166862776 CCTTCCCCACCTCCCCAGCCCGC 0: 1
1: 1
2: 25
3: 281
4: 2523
Right 1018757514 6:166862801-166862823 GCCACCTCCCGCCGCAGAACGGG 0: 1
1: 1
2: 0
3: 6
4: 120
1018757494_1018757501 -10 Left 1018757494 6:166862754-166862776 CCTTCCCCACCTCCCCAGCCCGC 0: 1
1: 1
2: 25
3: 281
4: 2523
Right 1018757501 6:166862767-166862789 CCCAGCCCGCCGCGCCTCCCCGG 0: 1
1: 0
2: 6
3: 71
4: 1023
1018757494_1018757516 27 Left 1018757494 6:166862754-166862776 CCTTCCCCACCTCCCCAGCCCGC 0: 1
1: 1
2: 25
3: 281
4: 2523
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018757494 Original CRISPR GCGGGCTGGGGAGGTGGGGA AGG (reversed) Intronic