ID: 1018757497

View in Genome Browser
Species Human (GRCh38)
Location 6:166862760-166862782
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2582
Summary {0: 1, 1: 3, 2: 18, 3: 239, 4: 2321}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018757497_1018757514 18 Left 1018757497 6:166862760-166862782 CCACCTCCCCAGCCCGCCGCGCC 0: 1
1: 3
2: 18
3: 239
4: 2321
Right 1018757514 6:166862801-166862823 GCCACCTCCCGCCGCAGAACGGG 0: 1
1: 1
2: 0
3: 6
4: 120
1018757497_1018757513 17 Left 1018757497 6:166862760-166862782 CCACCTCCCCAGCCCGCCGCGCC 0: 1
1: 3
2: 18
3: 239
4: 2321
Right 1018757513 6:166862800-166862822 CGCCACCTCCCGCCGCAGAACGG No data
1018757497_1018757516 21 Left 1018757497 6:166862760-166862782 CCACCTCCCCAGCCCGCCGCGCC 0: 1
1: 3
2: 18
3: 239
4: 2321
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757497_1018757521 27 Left 1018757497 6:166862760-166862782 CCACCTCCCCAGCCCGCCGCGCC 0: 1
1: 3
2: 18
3: 239
4: 2321
Right 1018757521 6:166862810-166862832 CGCCGCAGAACGGGAGGGACAGG No data
1018757497_1018757518 22 Left 1018757497 6:166862760-166862782 CCACCTCCCCAGCCCGCCGCGCC 0: 1
1: 3
2: 18
3: 239
4: 2321
Right 1018757518 6:166862805-166862827 CCTCCCGCCGCAGAACGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018757497 Original CRISPR GGCGCGGCGGGCTGGGGAGG TGG (reversed) Intronic