ID: 1018757498

View in Genome Browser
Species Human (GRCh38)
Location 6:166862763-166862785
Sequence GGAGGCGCGGCGGGCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018757498_1018757514 15 Left 1018757498 6:166862763-166862785 CCTCCCCAGCCCGCCGCGCCTCC No data
Right 1018757514 6:166862801-166862823 GCCACCTCCCGCCGCAGAACGGG 0: 1
1: 1
2: 0
3: 6
4: 120
1018757498_1018757521 24 Left 1018757498 6:166862763-166862785 CCTCCCCAGCCCGCCGCGCCTCC No data
Right 1018757521 6:166862810-166862832 CGCCGCAGAACGGGAGGGACAGG No data
1018757498_1018757516 18 Left 1018757498 6:166862763-166862785 CCTCCCCAGCCCGCCGCGCCTCC No data
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757498_1018757513 14 Left 1018757498 6:166862763-166862785 CCTCCCCAGCCCGCCGCGCCTCC No data
Right 1018757513 6:166862800-166862822 CGCCACCTCCCGCCGCAGAACGG No data
1018757498_1018757518 19 Left 1018757498 6:166862763-166862785 CCTCCCCAGCCCGCCGCGCCTCC No data
Right 1018757518 6:166862805-166862827 CCTCCCGCCGCAGAACGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018757498 Original CRISPR GGAGGCGCGGCGGGCTGGGG AGG (reversed) Intronic