ID: 1018757500

View in Genome Browser
Species Human (GRCh38)
Location 6:166862767-166862789
Sequence CCGGGGAGGCGCGGCGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018757500_1018757523 27 Left 1018757500 6:166862767-166862789 CCCAGCCCGCCGCGCCTCCCCGG No data
Right 1018757523 6:166862817-166862839 GAACGGGAGGGACAGGAACACGG No data
1018757500_1018757516 14 Left 1018757500 6:166862767-166862789 CCCAGCCCGCCGCGCCTCCCCGG No data
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757500_1018757514 11 Left 1018757500 6:166862767-166862789 CCCAGCCCGCCGCGCCTCCCCGG No data
Right 1018757514 6:166862801-166862823 GCCACCTCCCGCCGCAGAACGGG 0: 1
1: 1
2: 0
3: 6
4: 120
1018757500_1018757518 15 Left 1018757500 6:166862767-166862789 CCCAGCCCGCCGCGCCTCCCCGG No data
Right 1018757518 6:166862805-166862827 CCTCCCGCCGCAGAACGGGAGGG No data
1018757500_1018757521 20 Left 1018757500 6:166862767-166862789 CCCAGCCCGCCGCGCCTCCCCGG No data
Right 1018757521 6:166862810-166862832 CGCCGCAGAACGGGAGGGACAGG No data
1018757500_1018757513 10 Left 1018757500 6:166862767-166862789 CCCAGCCCGCCGCGCCTCCCCGG No data
Right 1018757513 6:166862800-166862822 CGCCACCTCCCGCCGCAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018757500 Original CRISPR CCGGGGAGGCGCGGCGGGCT GGG (reversed) Intronic