ID: 1018757502

View in Genome Browser
Species Human (GRCh38)
Location 6:166862768-166862790
Sequence TCCGGGGAGGCGCGGCGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 725
Summary {0: 1, 1: 3, 2: 3, 3: 41, 4: 677}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018757502_1018757514 10 Left 1018757502 6:166862768-166862790 CCAGCCCGCCGCGCCTCCCCGGA 0: 1
1: 3
2: 3
3: 41
4: 677
Right 1018757514 6:166862801-166862823 GCCACCTCCCGCCGCAGAACGGG 0: 1
1: 1
2: 0
3: 6
4: 120
1018757502_1018757513 9 Left 1018757502 6:166862768-166862790 CCAGCCCGCCGCGCCTCCCCGGA 0: 1
1: 3
2: 3
3: 41
4: 677
Right 1018757513 6:166862800-166862822 CGCCACCTCCCGCCGCAGAACGG No data
1018757502_1018757521 19 Left 1018757502 6:166862768-166862790 CCAGCCCGCCGCGCCTCCCCGGA 0: 1
1: 3
2: 3
3: 41
4: 677
Right 1018757521 6:166862810-166862832 CGCCGCAGAACGGGAGGGACAGG No data
1018757502_1018757518 14 Left 1018757502 6:166862768-166862790 CCAGCCCGCCGCGCCTCCCCGGA 0: 1
1: 3
2: 3
3: 41
4: 677
Right 1018757518 6:166862805-166862827 CCTCCCGCCGCAGAACGGGAGGG No data
1018757502_1018757524 30 Left 1018757502 6:166862768-166862790 CCAGCCCGCCGCGCCTCCCCGGA 0: 1
1: 3
2: 3
3: 41
4: 677
Right 1018757524 6:166862821-166862843 GGGAGGGACAGGAACACGGACGG No data
1018757502_1018757523 26 Left 1018757502 6:166862768-166862790 CCAGCCCGCCGCGCCTCCCCGGA 0: 1
1: 3
2: 3
3: 41
4: 677
Right 1018757523 6:166862817-166862839 GAACGGGAGGGACAGGAACACGG No data
1018757502_1018757516 13 Left 1018757502 6:166862768-166862790 CCAGCCCGCCGCGCCTCCCCGGA 0: 1
1: 3
2: 3
3: 41
4: 677
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018757502 Original CRISPR TCCGGGGAGGCGCGGCGGGC TGG (reversed) Intronic