ID: 1018757506

View in Genome Browser
Species Human (GRCh38)
Location 6:166862781-166862803
Sequence GGCGGTGTGGGTCTCCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018757506_1018757528 27 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757528 6:166862831-166862853 GGAACACGGACGGAGGGACCGGG 0: 1
1: 0
2: 0
3: 7
4: 129
1018757506_1018757527 26 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757527 6:166862830-166862852 AGGAACACGGACGGAGGGACCGG 0: 1
1: 0
2: 3
3: 20
4: 313
1018757506_1018757523 13 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757523 6:166862817-166862839 GAACGGGAGGGACAGGAACACGG No data
1018757506_1018757516 0 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757506_1018757525 20 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757525 6:166862824-166862846 AGGGACAGGAACACGGACGGAGG 0: 1
1: 0
2: 0
3: 15
4: 204
1018757506_1018757526 21 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757526 6:166862825-166862847 GGGACAGGAACACGGACGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 205
1018757506_1018757513 -4 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757513 6:166862800-166862822 CGCCACCTCCCGCCGCAGAACGG No data
1018757506_1018757524 17 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757524 6:166862821-166862843 GGGAGGGACAGGAACACGGACGG No data
1018757506_1018757521 6 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757521 6:166862810-166862832 CGCCGCAGAACGGGAGGGACAGG No data
1018757506_1018757514 -3 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757514 6:166862801-166862823 GCCACCTCCCGCCGCAGAACGGG 0: 1
1: 1
2: 0
3: 6
4: 120
1018757506_1018757518 1 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757518 6:166862805-166862827 CCTCCCGCCGCAGAACGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018757506 Original CRISPR GGCGGTGTGGGTCTCCGGGG AGG (reversed) Intronic