ID: 1018757509

View in Genome Browser
Species Human (GRCh38)
Location 6:166862786-166862808
Sequence GAGGTGGCGGTGTGGGTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 364}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018757509_1018757526 16 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757526 6:166862825-166862847 GGGACAGGAACACGGACGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 205
1018757509_1018757514 -8 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757514 6:166862801-166862823 GCCACCTCCCGCCGCAGAACGGG 0: 1
1: 1
2: 0
3: 6
4: 120
1018757509_1018757531 30 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757531 6:166862839-166862861 GACGGAGGGACCGGGACGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 163
1018757509_1018757513 -9 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757513 6:166862800-166862822 CGCCACCTCCCGCCGCAGAACGG No data
1018757509_1018757527 21 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757527 6:166862830-166862852 AGGAACACGGACGGAGGGACCGG 0: 1
1: 0
2: 3
3: 20
4: 313
1018757509_1018757521 1 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757521 6:166862810-166862832 CGCCGCAGAACGGGAGGGACAGG No data
1018757509_1018757516 -5 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757509_1018757528 22 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757528 6:166862831-166862853 GGAACACGGACGGAGGGACCGGG 0: 1
1: 0
2: 0
3: 7
4: 129
1018757509_1018757518 -4 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757518 6:166862805-166862827 CCTCCCGCCGCAGAACGGGAGGG No data
1018757509_1018757524 12 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757524 6:166862821-166862843 GGGAGGGACAGGAACACGGACGG No data
1018757509_1018757523 8 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757523 6:166862817-166862839 GAACGGGAGGGACAGGAACACGG No data
1018757509_1018757530 29 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757530 6:166862838-166862860 GGACGGAGGGACCGGGACGAGGG No data
1018757509_1018757529 28 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757529 6:166862837-166862859 CGGACGGAGGGACCGGGACGAGG 0: 1
1: 0
2: 1
3: 10
4: 131
1018757509_1018757525 15 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757525 6:166862824-166862846 AGGGACAGGAACACGGACGGAGG 0: 1
1: 0
2: 0
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018757509 Original CRISPR GAGGTGGCGGTGTGGGTCTC CGG (reversed) Intronic