ID: 1018757516

View in Genome Browser
Species Human (GRCh38)
Location 6:166862804-166862826
Sequence ACCTCCCGCCGCAGAACGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018757499_1018757516 15 Left 1018757499 6:166862766-166862788 CCCCAGCCCGCCGCGCCTCCCCG 0: 1
1: 0
2: 7
3: 81
4: 947
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757503_1018757516 9 Left 1018757503 6:166862772-166862794 CCCGCCGCGCCTCCCCGGAGACC 0: 1
1: 0
2: 2
3: 35
4: 257
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757495_1018757516 23 Left 1018757495 6:166862758-166862780 CCCCACCTCCCCAGCCCGCCGCG 0: 1
1: 0
2: 0
3: 73
4: 667
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757508_1018757516 -4 Left 1018757508 6:166862785-166862807 CCCGGAGACCCACACCGCCACCT 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757505_1018757516 5 Left 1018757505 6:166862776-166862798 CCGCGCCTCCCCGGAGACCCACA 0: 1
1: 0
2: 0
3: 23
4: 241
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757502_1018757516 13 Left 1018757502 6:166862768-166862790 CCAGCCCGCCGCGCCTCCCCGGA 0: 1
1: 3
2: 3
3: 41
4: 677
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757504_1018757516 8 Left 1018757504 6:166862773-166862795 CCGCCGCGCCTCCCCGGAGACCC 0: 1
1: 0
2: 6
3: 31
4: 378
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757493_1018757516 28 Left 1018757493 6:166862753-166862775 CCCTTCCCCACCTCCCCAGCCCG 0: 1
1: 2
2: 18
3: 201
4: 2032
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757509_1018757516 -5 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757496_1018757516 22 Left 1018757496 6:166862759-166862781 CCCACCTCCCCAGCCCGCCGCGC 0: 1
1: 0
2: 1
3: 59
4: 563
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757498_1018757516 18 Left 1018757498 6:166862763-166862785 CCTCCCCAGCCCGCCGCGCCTCC 0: 1
1: 1
2: 13
3: 173
4: 1241
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757494_1018757516 27 Left 1018757494 6:166862754-166862776 CCTTCCCCACCTCCCCAGCCCGC 0: 1
1: 1
2: 25
3: 281
4: 2523
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757507_1018757516 -3 Left 1018757507 6:166862784-166862806 CCCCGGAGACCCACACCGCCACC 0: 1
1: 0
2: 2
3: 28
4: 173
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757500_1018757516 14 Left 1018757500 6:166862767-166862789 CCCAGCCCGCCGCGCCTCCCCGG 0: 1
1: 0
2: 3
3: 59
4: 483
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757506_1018757516 0 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC 0: 1
1: 0
2: 1
3: 21
4: 262
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757497_1018757516 21 Left 1018757497 6:166862760-166862782 CCACCTCCCCAGCCCGCCGCGCC 0: 1
1: 3
2: 18
3: 239
4: 2321
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018757516 Original CRISPR ACCTCCCGCCGCAGAACGGG AGG Intronic
902911024 1:19597248-19597270 ACCTCCCGCCGGGGCCCGGGCGG - Intronic
906344082 1:45004419-45004441 ACCTCCCGCCTCACACTGGGGGG + Intronic
922787019 1:228287883-228287905 ACCTCCGGCCGCAGGACAGCGGG + Exonic
1066406562 10:35124818-35124840 TCCTCCCGACCCAGAAAGGGAGG + Intergenic
1067334882 10:45352844-45352866 GCCTCCCGCAGCATAAAGGGAGG + Intergenic
1069676899 10:70255035-70255057 GCCTCCCGCTGCGGAATGGGCGG - Exonic
1075997524 10:126890623-126890645 ACTTCCCGCAACAGAACGGCAGG - Intergenic
1108411131 13:50148253-50148275 ACCTCCTGCTGCAGAGCAGGAGG - Intronic
1111230599 13:85340766-85340788 ACCTCCCTCCCCAGACAGGGCGG + Intergenic
1119223407 14:72926732-72926754 CCCACGCGCCCCAGAACGGGCGG - Intronic
1123684860 15:22789597-22789619 ACCTCCCGCCGAAGAAGGCGAGG + Intronic
1131204000 15:90426140-90426162 GCCTCCCACCACAGAACTGGAGG + Exonic
1132838356 16:1965946-1965968 ACCTGCCGCCCCAGAGCAGGGGG - Intergenic
1144650522 17:17004267-17004289 ACCTCCCTCCGCAGACTGGCCGG + Intergenic
1148564842 17:48626679-48626701 CCCTCCCGCTGCAGGAAGGGGGG + Intronic
1152560733 17:81077664-81077686 ACCACCAGCCTCAGGACGGGCGG - Intronic
1152822309 17:82443619-82443641 ACCTCCGGCTGCAGAAAGGCAGG + Exonic
1157260719 18:46173885-46173907 TCCTCCCGCTGCAGACCGCGGGG - Intronic
1161640292 19:5418488-5418510 ACCCACCCCCGCAGAACTGGGGG - Intergenic
1164188472 19:22894028-22894050 ACCTCCCGCCGCGGACAGGACGG - Intergenic
1167308417 19:48721866-48721888 CCCTCCCCCTGCAGAGCGGGAGG - Exonic
1167622481 19:50567573-50567595 GACTCCCGCCCCAGAAAGGGGGG + Intronic
1167691136 19:50984088-50984110 CCCTCCCTCCGAAGGACGGGCGG + Intronic
935196650 2:100820285-100820307 GCCTCCCGCCGCCGCCCGGGAGG + Exonic
938389656 2:130894766-130894788 ACCTCCCGCCACAGGAGGAGAGG - Intronic
942150958 2:173075795-173075817 ACCTCCCGGCGCGAAACGGCTGG - Intronic
1171252938 20:23663202-23663224 ACCTCCCTCTGCAGCACAGGGGG - Intergenic
1171259426 20:23718519-23718541 ACCTCCCTCTGCAGCACAGGGGG - Intergenic
1175349825 20:58309825-58309847 ACCTACGGCCGGAGGACGGGCGG + Exonic
1176243140 20:64084220-64084242 TCCTCCCTCCGCAGGGCGGGAGG - Exonic
1179913351 21:44461434-44461456 ACCTCCCGCCACAGAGCCTGGGG + Exonic
1180733782 22:18001093-18001115 ACCTCCCGCCGGAGGATGCGTGG - Intronic
1181966355 22:26658762-26658784 CCCTCCCGCCGCAGCAGGTGGGG - Intergenic
1185296879 22:50058804-50058826 AAGTTCCGCCGCAGGACGGGGGG - Intergenic
969243594 4:5918182-5918204 ACCTCCCACCGCAGCAGGGATGG + Intronic
980065709 4:128186778-128186800 ACCTCCCGCCGCAGGACCAGAGG + Intronic
1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG + Intronic
1022821208 7:33962692-33962714 ACCTCCCGCTGCAGTACTGATGG + Intronic
1037694423 8:21210946-21210968 CCCTCCGGCAGCAGAACAGGAGG - Intergenic
1049088095 8:140493503-140493525 ACCTCCCACCCCAGCACTGGGGG - Intergenic
1061836290 9:133332253-133332275 ACCTCACGCCGCTGACCGGGAGG - Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062339507 9:136087697-136087719 AGCTTCCACCGCAGCACGGGGGG + Intronic
1062388213 9:136323367-136323389 GCCTCCCACCGCAGACCCGGGGG + Intergenic