ID: 1018757516

View in Genome Browser
Species Human (GRCh38)
Location 6:166862804-166862826
Sequence ACCTCCCGCCGCAGAACGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018757497_1018757516 21 Left 1018757497 6:166862760-166862782 CCACCTCCCCAGCCCGCCGCGCC 0: 1
1: 3
2: 18
3: 239
4: 2321
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757507_1018757516 -3 Left 1018757507 6:166862784-166862806 CCCCGGAGACCCACACCGCCACC No data
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757494_1018757516 27 Left 1018757494 6:166862754-166862776 CCTTCCCCACCTCCCCAGCCCGC 0: 1
1: 1
2: 25
3: 281
4: 2523
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757509_1018757516 -5 Left 1018757509 6:166862786-166862808 CCGGAGACCCACACCGCCACCTC 0: 1
1: 0
2: 0
3: 37
4: 364
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757504_1018757516 8 Left 1018757504 6:166862773-166862795 CCGCCGCGCCTCCCCGGAGACCC No data
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757508_1018757516 -4 Left 1018757508 6:166862785-166862807 CCCGGAGACCCACACCGCCACCT 0: 1
1: 0
2: 1
3: 20
4: 224
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757506_1018757516 0 Left 1018757506 6:166862781-166862803 CCTCCCCGGAGACCCACACCGCC No data
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757503_1018757516 9 Left 1018757503 6:166862772-166862794 CCCGCCGCGCCTCCCCGGAGACC 0: 1
1: 0
2: 2
3: 35
4: 257
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757499_1018757516 15 Left 1018757499 6:166862766-166862788 CCCCAGCCCGCCGCGCCTCCCCG No data
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757496_1018757516 22 Left 1018757496 6:166862759-166862781 CCCACCTCCCCAGCCCGCCGCGC 0: 1
1: 0
2: 1
3: 59
4: 563
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757500_1018757516 14 Left 1018757500 6:166862767-166862789 CCCAGCCCGCCGCGCCTCCCCGG No data
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757495_1018757516 23 Left 1018757495 6:166862758-166862780 CCCCACCTCCCCAGCCCGCCGCG 0: 1
1: 0
2: 0
3: 73
4: 667
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757505_1018757516 5 Left 1018757505 6:166862776-166862798 CCGCGCCTCCCCGGAGACCCACA No data
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757502_1018757516 13 Left 1018757502 6:166862768-166862790 CCAGCCCGCCGCGCCTCCCCGGA 0: 1
1: 3
2: 3
3: 41
4: 677
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757498_1018757516 18 Left 1018757498 6:166862763-166862785 CCTCCCCAGCCCGCCGCGCCTCC No data
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40
1018757493_1018757516 28 Left 1018757493 6:166862753-166862775 CCCTTCCCCACCTCCCCAGCCCG 0: 1
1: 2
2: 18
3: 201
4: 2032
Right 1018757516 6:166862804-166862826 ACCTCCCGCCGCAGAACGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018757516 Original CRISPR ACCTCCCGCCGCAGAACGGG AGG Intronic