ID: 1018758627

View in Genome Browser
Species Human (GRCh38)
Location 6:166871385-166871407
Sequence GCCTCCAACATTCCTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018758627_1018758632 8 Left 1018758627 6:166871385-166871407 CCAAACAAAGGAATGTTGGAGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1018758632 6:166871416-166871438 GTTGGAAGCCCTCCGCTCCCGGG 0: 1
1: 0
2: 1
3: 15
4: 116
1018758627_1018758633 9 Left 1018758627 6:166871385-166871407 CCAAACAAAGGAATGTTGGAGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1018758633 6:166871417-166871439 TTGGAAGCCCTCCGCTCCCGGGG No data
1018758627_1018758630 -10 Left 1018758627 6:166871385-166871407 CCAAACAAAGGAATGTTGGAGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1018758630 6:166871398-166871420 TGTTGGAGGCTTTGAAGGGTTGG 0: 1
1: 0
2: 2
3: 31
4: 303
1018758627_1018758631 7 Left 1018758627 6:166871385-166871407 CCAAACAAAGGAATGTTGGAGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1018758631 6:166871415-166871437 GGTTGGAAGCCCTCCGCTCCCGG No data
1018758627_1018758634 15 Left 1018758627 6:166871385-166871407 CCAAACAAAGGAATGTTGGAGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1018758634 6:166871423-166871445 GCCCTCCGCTCCCGGGGTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 101
1018758627_1018758637 19 Left 1018758627 6:166871385-166871407 CCAAACAAAGGAATGTTGGAGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1018758637 6:166871427-166871449 TCCGCTCCCGGGGTAGAGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018758627 Original CRISPR GCCTCCAACATTCCTTTGTT TGG (reversed) Intronic