ID: 1018758634

View in Genome Browser
Species Human (GRCh38)
Location 6:166871423-166871445
Sequence GCCCTCCGCTCCCGGGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018758627_1018758634 15 Left 1018758627 6:166871385-166871407 CCAAACAAAGGAATGTTGGAGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1018758634 6:166871423-166871445 GCCCTCCGCTCCCGGGGTAGAGG 0: 1
1: 0
2: 0
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018758634 Original CRISPR GCCCTCCGCTCCCGGGGTAG AGG Intronic