ID: 1018762078

View in Genome Browser
Species Human (GRCh38)
Location 6:166901519-166901541
Sequence CACAGTAAAGAGAAGGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018762072_1018762078 20 Left 1018762072 6:166901476-166901498 CCAGGTGAACTCATACAGGGGGT 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG 0: 1
1: 0
2: 1
3: 9
4: 154
1018762075_1018762078 -10 Left 1018762075 6:166901506-166901528 CCAGAGGAAAGCACACAGTAAAG 0: 1
1: 0
2: 3
3: 20
4: 267
Right 1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG 0: 1
1: 0
2: 1
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018762078 Original CRISPR CACAGTAAAGAGAAGGCCGT GGG Intronic
900602580 1:3509429-3509451 CTCAGGAAAGAGAAGGCTCTGGG + Intronic
902225649 1:14994939-14994961 CACAGCATGGAGTAGGCCGTGGG + Intronic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
907350804 1:53829191-53829213 CAAAGTAAAGAGATGGCAGGAGG + Intronic
909079078 1:71087324-71087346 CACAGAAAAGAAAAAGCAGTTGG + Intergenic
911051997 1:93679521-93679543 CACAGTAGAGAGAAGTCAGATGG - Intronic
911332866 1:96545524-96545546 CACAGCAAATAGCAGGCCCTAGG - Intergenic
913709630 1:121469711-121469733 CAAATTAAAGAGAAGGCTATGGG - Intergenic
915769051 1:158399113-158399135 CACAGCAATGAGGAGGCAGTTGG + Exonic
917931373 1:179824892-179824914 CAGAGTTAAGAGAAGGGCGGGGG - Intergenic
919303996 1:195806663-195806685 CAGACAAAAGAGAAGGCCATGGG + Intergenic
920423097 1:205849427-205849449 CACAGCAAAGAGTGGGCAGTGGG - Intronic
923654295 1:235901797-235901819 CACAGTAAAGAGGGGGCTGAAGG + Intergenic
1063386264 10:5618032-5618054 CCTAGCAAAGAGAAGGCCCTGGG + Intergenic
1063550402 10:7027284-7027306 AAAAGTATAGAGAAGGCTGTCGG + Intergenic
1069457739 10:68567085-68567107 CAGAGTAAAAAGATGGACGTTGG - Intronic
1069658584 10:70108499-70108521 CAAAGGCAGGAGAAGGCCGTGGG - Intronic
1070175736 10:73967634-73967656 CCCAATACAGGGAAGGCCGTTGG + Intergenic
1071780719 10:88841308-88841330 CAGAGAAGAGAGAAGGCAGTAGG + Intronic
1072371100 10:94767168-94767190 AAGAGTAAAGAGTAGGCCATGGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1074819524 10:117168006-117168028 CACGGTAACTAAAAGGCCGTCGG + Intergenic
1076309550 10:129494895-129494917 CACAGCACAGAGAAGGAAGTTGG - Intronic
1078054253 11:7994387-7994409 CAAAGTAAACAGATGGCCTTGGG - Intronic
1079406899 11:20155877-20155899 CACAGTAAGGTCCAGGCCGTGGG + Intergenic
1084763036 11:71286070-71286092 CACAGAAAGGTGAAGGCTGTAGG - Intergenic
1085173760 11:74469225-74469247 CAGAGTAAATGCAAGGCCGTGGG - Intergenic
1085432942 11:76471525-76471547 CACAGTAAAGAGGAATCAGTAGG - Intronic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1091658391 12:2362727-2362749 CACAGGAGAGAGAGGGCTGTAGG - Intronic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1104723157 12:131057595-131057617 CACACGGAAGAGGAGGCCGTGGG - Intronic
1108909357 13:55524297-55524319 CAGAGTAAAGAGAAAGTAGTGGG - Intergenic
1109413833 13:62009414-62009436 CACAGTTAAAAGAAGGCCTAGGG - Intergenic
1113085076 13:106561638-106561660 CAAAGTAGAAAGAAGGCCCTAGG + Intronic
1117031882 14:51680369-51680391 TACAGTAAAATGAAGGCTGTGGG - Intronic
1117571699 14:57055432-57055454 CACAGAAAAGAGTAGGCCAGAGG - Intergenic
1121312214 14:92941327-92941349 CACAGTAGAGAGCAGGCGGACGG + Exonic
1122674758 14:103402581-103402603 TACATTAAATAGAAGGCAGTTGG + Intronic
1124036116 15:26054799-26054821 CACAGTATAGAGTAGGCTATTGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1128668860 15:69559269-69559291 CAGCGCAAAGAGAAGGCTGTGGG - Intergenic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1133784109 16:8962362-8962384 CGCTGTAAAGAGAAGGGTGTTGG - Intronic
1134052138 16:11144712-11144734 CACAGTGAAGAGAGGGCCGTTGG + Intronic
1134690830 16:16190197-16190219 CACAGAGAAGAGGAGGCCGGAGG + Exonic
1138008969 16:53360537-53360559 CACAGTAAATATTAGGCAGTGGG + Intergenic
1138338982 16:56276124-56276146 CACTATAAAGAGGAGGCAGTGGG - Intronic
1140317909 16:73917267-73917289 CACATTTAAAAGAAGGCAGTTGG + Intergenic
1141850091 16:86639228-86639250 CACAGTGAAGAGAAGCCACTCGG - Intergenic
1141856088 16:86682431-86682453 CACGGGACAGAGCAGGCCGTGGG + Intergenic
1142131977 16:88435290-88435312 CAGAAAAAAGAGAAGGCCGGAGG + Exonic
1146471113 17:33125829-33125851 GACAGGAAAGATAAGGCTGTAGG - Intronic
1146840761 17:36152534-36152556 CACAGCAAAGAGAATGTAGTTGG - Intergenic
1147008978 17:37428534-37428556 CACAGGAAAGATAAGGCAATAGG - Intronic
1147163236 17:38579679-38579701 CAAAAGAAAGAGAAGGCCGGGGG + Intronic
1147935063 17:44006447-44006469 CAGAGAAAAGAGAGGTCCGTGGG + Intronic
1148166521 17:45487826-45487848 GGCAGTGGAGAGAAGGCCGTGGG - Intronic
1148367907 17:47070532-47070554 GGCAGTGGAGAGAAGGCCGTAGG + Intergenic
1149858762 17:60108434-60108456 CACAGCAAAGAGAATGTAGTTGG + Intergenic
1153774163 18:8438206-8438228 CAGAGTAAAGACATGGCCTTGGG - Intergenic
1154138994 18:11806701-11806723 CACAATATTGAGAAGGCCCTTGG - Intronic
1155851203 18:30776507-30776529 AACAGTAAAGAGAAAGGCTTAGG - Intergenic
1157076245 18:44470925-44470947 CAGAGTAAAGAAAATGCCTTGGG + Intergenic
1157092586 18:44653747-44653769 CACAGGAAAGAGTAGGGCTTAGG + Intergenic
1157330671 18:46701569-46701591 CACAGCAAGAAGAAGGCCATTGG + Intronic
1158231327 18:55258954-55258976 CACAGAATAGAGAGGGCAGTGGG - Intronic
1160700144 19:502159-502181 CACAGTTAAGAGAAGCCCACTGG - Intronic
1160841263 19:1147919-1147941 CACAGCAAGGAGAAGGTCCTGGG + Intronic
1160974314 19:1785158-1785180 CACAGAAACGGGAAGGTCGTGGG + Exonic
1162544817 19:11322515-11322537 CACATTAAACCAAAGGCCGTGGG - Exonic
1163458941 19:17424874-17424896 CAGAGTAAAGAGAGGGCCAAAGG - Intronic
1164785112 19:30924359-30924381 CACAGTAAGGAGAAGCCAGGAGG - Intergenic
1166518744 19:43465404-43465426 CCCCGTACAGAGAAGGCTGTGGG - Intronic
927690952 2:25207757-25207779 CACAGGACAGAGAAGGCCAAGGG - Intergenic
931601317 2:64005905-64005927 TACAGTAAATAGAAGGAAGTAGG + Intronic
935305889 2:101735957-101735979 ATCAGTAAATAGAAGGCTGTAGG - Intronic
936032600 2:109084309-109084331 CACAGTGGTGAGAAGGGCGTTGG + Intergenic
940865634 2:158815158-158815180 CCCAGTGAAGAGAAGGCTGAGGG - Intronic
941994789 2:171592121-171592143 CAGAGTAAAGTCAAGGCAGTGGG - Intergenic
943033155 2:182709874-182709896 CAAACAAAAGAGAAGGCAGTAGG - Intergenic
944503887 2:200390103-200390125 TACAGTCCAGAGAAGGCTGTGGG - Intronic
945673677 2:212831748-212831770 TAAAACAAAGAGAAGGCCGTGGG + Intergenic
948213269 2:236210608-236210630 CACAGGAAACAGAAGGCCTTTGG + Intronic
1169677377 20:8169190-8169212 CAAAGTAAAGAGATGGCAGTAGG - Intronic
1170373921 20:15679405-15679427 CACAGTAAAGGCAAGGGAGTTGG - Intronic
1177514768 21:22135053-22135075 CACAGTGATGAGAAGTCTGTTGG - Intergenic
1178996904 21:37410745-37410767 CACAGAAAATAGAAGACAGTTGG + Intronic
1179243697 21:39612569-39612591 CACAGGAGAGGGAAGGCTGTGGG - Intronic
1180112335 21:45666671-45666693 CACAGAAACTAGAAGGCTGTAGG - Intronic
1180374462 22:12077865-12077887 CACAGTATAGACAAGGCTGGGGG - Intergenic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1184284190 22:43458846-43458868 CACAATAACCAGAAGGCAGTGGG - Intronic
950189570 3:10967211-10967233 CACAGCCAAGAGAAAGCCCTTGG + Intergenic
953569030 3:44057133-44057155 CACAGGAAACAGAAGGACCTCGG - Intergenic
953583847 3:44181701-44181723 CACAGGAAAGAGAAGGCAGGGGG + Intergenic
955284463 3:57625525-57625547 CACTGTAAATAGAAGGCACTAGG + Exonic
956164815 3:66388672-66388694 CACAGAGAACAGAAGGCAGTAGG + Intronic
957969843 3:87368672-87368694 CAGAGTAAAGAGGAGGCACTAGG + Intergenic
962981140 3:140491177-140491199 GGGAGTAAAGAGAAGGCCGGAGG - Intronic
965463497 3:168998676-168998698 CAGAGTACAGAAAAGGCCTTAGG + Intergenic
965476824 3:169166203-169166225 CACAATAAATAGAAAGCCATTGG - Intronic
968082284 3:195854791-195854813 CCCAGGAAGGAGAAGGCCGACGG - Intergenic
970506255 4:16733602-16733624 CAAAATAAAGAGAAAGCCTTGGG + Intronic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
972247050 4:37256093-37256115 TACATTAGAGAGAAGGCTGTGGG + Intronic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
974379489 4:61120172-61120194 CACATTAGGGAGAAGGCCATGGG + Intergenic
974814821 4:66990358-66990380 CACAGGAAAGAGAAAGTCTTTGG - Intergenic
977393455 4:96443521-96443543 CACAGTAAAGTGAAAACTGTGGG - Intergenic
978387308 4:108188990-108189012 CATAGTCAAGAGAAGGCCTTGGG - Intergenic
980140343 4:128908461-128908483 CAAAGTGAAGAGAATGCCTTAGG + Intronic
980654741 4:135767086-135767108 CAGAGTGAAGAGCAGGCCTTGGG + Intergenic
982390772 4:154861877-154861899 CAGAGTAAAAACAAGGCCATAGG + Intergenic
983631561 4:169854444-169854466 CTCAGTAATGAGAAGGCGGCAGG + Intergenic
986111957 5:4728205-4728227 CACAGTGAGGATAAGGCCATGGG + Intergenic
989457251 5:41658374-41658396 GTCAGGAAAGAGAAGGCCATTGG + Intergenic
990258784 5:53999116-53999138 GAGAATAAAGAGAAGGCTGTAGG + Intronic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
999373831 5:151072628-151072650 AACAGTATAGAGAAGGCTGCAGG - Intronic
999491556 5:152056296-152056318 CACAGTAAGGACAGGGCCGCTGG + Intergenic
999623077 5:153491553-153491575 GACAGCAAAGAGAAGGCAGCTGG - Intronic
1002198937 5:177516287-177516309 CACCTTAAAGAGAAGGCTGAAGG - Exonic
1010636321 6:78262978-78263000 CACAGCAAAGATAAGGAAGTCGG + Intergenic
1012542094 6:100372994-100373016 CACAGCTAAGAGAAAGTCGTGGG + Intergenic
1015153593 6:130065259-130065281 CATAGTAAAAAGAAGTCCGGAGG - Intronic
1017111797 6:150939642-150939664 CGCAGTAGAGAGAAGGCAGGTGG - Intronic
1018761844 6:166900101-166900123 CACAGGAAAGAGAACGCCACGGG + Intronic
1018761950 6:166900760-166900782 AAGAGTAAAGAGAATGCCTTGGG + Intronic
1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG + Intronic
1018762187 6:166902311-166902333 CAGAGTAAAGAGACCGCCGTGGG + Intronic
1019177580 6:170168026-170168048 CACAGCAAGGAGTGGGCCGTGGG - Intergenic
1021258692 7:18427265-18427287 CACAAAAAAGATAAGGCTGTAGG - Intronic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1021310992 7:19095451-19095473 CAGAGTAAAGGGATGGGCGTGGG + Intronic
1021707375 7:23381000-23381022 CACAGTAAAAACAAGCCCCTGGG - Intronic
1022485908 7:30777476-30777498 CAGAGGAAAGAGGAGGCCGTAGG - Intronic
1023612293 7:41983260-41983282 CAGAGAAAAGAAAAGGCAGTAGG + Intronic
1023859599 7:44210203-44210225 CACAGGAAACAAAAGGCGGTGGG - Intronic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1027382957 7:77631098-77631120 CACAGTGAAGAGATGGCTGTTGG - Intronic
1030892340 7:115014256-115014278 CAGAGTTAAGAGACTGCCGTAGG + Intronic
1034754315 7:153600715-153600737 CACAGGGAAGAGAAGGCTGAAGG + Intergenic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1037281324 8:17246212-17246234 TCCAGTAATGAGAAGGCCTTTGG - Intronic
1038387153 8:27159387-27159409 CAAAATAAAGAGAAGCCTGTGGG - Intergenic
1042610915 8:70600183-70600205 CACAGGAACGAGGAGGCCCTTGG - Intronic
1045013644 8:97980396-97980418 CTCATCAAAGAGGAGGCCGTGGG + Intronic
1048518463 8:135132242-135132264 CACAGTACAGAAAATGCAGTTGG + Intergenic
1049385730 8:142342073-142342095 CACAGCAAAGGGGAGGCCCTGGG + Intronic
1051205858 9:14688444-14688466 CACAGGCAAGAGCAGGCCCTGGG - Intronic
1051912041 9:22163748-22163770 CCCAGCAAAGAGAAGAGCGTAGG - Intergenic
1054766178 9:69044463-69044485 CTCAGAAAAGAGAAGGCAGAAGG - Intronic
1061406809 9:130396810-130396832 CACAGTACAGACATGGCCCTTGG + Intronic
1061459252 9:130723142-130723164 CACAGGGCAGAGAAGGCCTTCGG - Intronic
1062142283 9:134966206-134966228 CACAGTAAAGAGAAGCCTGCAGG - Intergenic
1062556898 9:137117122-137117144 CAAAGTATAGAGAAGGCAGTGGG - Intergenic
1194290995 X:92071899-92071921 CACCCTGAAGAGAAGGCCATGGG - Intronic
1195571823 X:106405613-106405635 CACAGTAAATACTAGGCCATTGG + Intergenic
1198030745 X:132751345-132751367 AACAGTAAAGAGCAGGCCTCTGG + Intronic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199928866 X:152497414-152497436 CACCGTAAAGAATAGGCAGTAGG - Intergenic
1200248851 X:154541669-154541691 CTCAGGAAAGAGGAGGGCGTGGG - Intronic
1200608504 Y:5296474-5296496 CACCCTGAAGAGAAGGCCATGGG - Intronic