ID: 1018764322

View in Genome Browser
Species Human (GRCh38)
Location 6:166920689-166920711
Sequence ATTGGCTTCCTGGCCTCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 797
Summary {0: 1, 1: 1, 2: 12, 3: 91, 4: 692}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018764316_1018764322 14 Left 1018764316 6:166920652-166920674 CCTTAAGGCTGTAAGGAAAACCC 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1018764322 6:166920689-166920711 ATTGGCTTCCTGGCCTCAAGAGG 0: 1
1: 1
2: 12
3: 91
4: 692
1018764319_1018764322 -6 Left 1018764319 6:166920672-166920694 CCCAAAGTCTGCATTGGATTGGC 0: 1
1: 0
2: 1
3: 10
4: 89
Right 1018764322 6:166920689-166920711 ATTGGCTTCCTGGCCTCAAGAGG 0: 1
1: 1
2: 12
3: 91
4: 692
1018764313_1018764322 22 Left 1018764313 6:166920644-166920666 CCCAGGAGCCTTAAGGCTGTAAG 0: 1
1: 0
2: 2
3: 12
4: 123
Right 1018764322 6:166920689-166920711 ATTGGCTTCCTGGCCTCAAGAGG 0: 1
1: 1
2: 12
3: 91
4: 692
1018764314_1018764322 21 Left 1018764314 6:166920645-166920667 CCAGGAGCCTTAAGGCTGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1018764322 6:166920689-166920711 ATTGGCTTCCTGGCCTCAAGAGG 0: 1
1: 1
2: 12
3: 91
4: 692
1018764320_1018764322 -7 Left 1018764320 6:166920673-166920695 CCAAAGTCTGCATTGGATTGGCT 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1018764322 6:166920689-166920711 ATTGGCTTCCTGGCCTCAAGAGG 0: 1
1: 1
2: 12
3: 91
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018764322 Original CRISPR ATTGGCTTCCTGGCCTCAAG AGG Intronic
900112939 1:1016414-1016436 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
900364532 1:2305706-2305728 CTTGGCTTGCTGCCCCCAAGGGG + Intronic
900635172 1:3660136-3660158 CTTGACTTCTTAGCCTCAAGAGG - Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
900961291 1:5922599-5922621 CTTGAACTCCTGGCCTCAAGTGG - Intronic
901577908 1:10215628-10215650 CTTGACCTCCTGGGCTCAAGTGG + Intronic
902307369 1:15552089-15552111 CTTGAACTCCTGGCCTCAAGTGG + Intronic
902357619 1:15917041-15917063 CTCTGCTTCCTGGGCTCAAGTGG - Intronic
903053810 1:20620959-20620981 CTTGAATTCCTGACCTCAAGAGG - Intergenic
903593726 1:24478297-24478319 CTCGACTTCCTGGGCTCAAGTGG + Intergenic
903872983 1:26450364-26450386 CTTGAACTCCTGGCCTCAAGTGG + Intronic
904097772 1:27994882-27994904 AATAGCCTCCTGGGCTCAAGTGG - Intronic
904445199 1:30567508-30567530 TTTGGCTTCATAACCTCAAGAGG + Intergenic
904694856 1:32323615-32323637 CTTGAACTCCTGGCCTCAAGTGG + Intronic
905186818 1:36203085-36203107 ATTGAATTCCTGACCTCAAGTGG + Intergenic
905628077 1:39501681-39501703 CTTGAACTCCTGGCCTCAAGTGG + Intronic
905636137 1:39554090-39554112 CTTGCCTTCCTGGCTTCTAGTGG - Intergenic
905844964 1:41221666-41221688 CTTGAACTCCTGGCCTCAAGTGG - Intronic
906019478 1:42614700-42614722 ATCTGCCTCCTGGGCTCAAGTGG - Intronic
906469683 1:46117991-46118013 CTTGACCTCCTGGGCTCAAGTGG - Intronic
906519768 1:46460089-46460111 TCTGGGATCCTGGCCTCAAGGGG + Intergenic
906811385 1:48830495-48830517 ATTGGTCCCCTGACCTCAAGAGG - Intronic
907031232 1:51174445-51174467 CTTGAACTCCTGGCCTCAAGCGG + Intergenic
907478689 1:54727630-54727652 CTCGAATTCCTGGCCTCAAGTGG - Intronic
908362408 1:63381958-63381980 CTTGGGCTCCTGGCCTCAAGTGG + Intronic
908475460 1:64483622-64483644 CTTGAACTCCTGGCCTCAAGGGG - Intronic
908689926 1:66767475-66767497 CTTGAACTCCTGGCCTCAAGTGG + Intronic
909031186 1:70543087-70543109 ATTGATTTCCAGGCCTGAAGGGG + Intergenic
909062047 1:70890348-70890370 ATTGGCTTTCTGATCTTAAGAGG - Intronic
909669216 1:78169161-78169183 CTTGAATTCCTGGGCTCAAGCGG + Intergenic
909954957 1:81768265-81768287 CTTGAACTCCTGGCCTCAAGCGG + Intronic
910089859 1:83449685-83449707 ATGGGTTTAATGGCCTCAAGTGG + Intergenic
910153713 1:84187802-84187824 TTCGGCTTCCTTGCCTCAAGAGG - Intronic
910255379 1:85242303-85242325 CTTGAACTCCTGGCCTCAAGGGG + Intergenic
910309270 1:85805058-85805080 GTTGAAGTCCTGGCCTCAAGAGG + Intronic
910697066 1:90030748-90030770 TTTGACCTCCTGGGCTCAAGCGG + Intronic
910938904 1:92511612-92511634 CTTGAACTCCTGGCCTCAAGTGG - Exonic
911636875 1:100245865-100245887 CTTGACCTCCTGGGCTCAAGTGG - Intronic
911681615 1:100723055-100723077 ATCGGCTTCCCAGCCTCCAGAGG - Exonic
911733223 1:101311070-101311092 ATTGACTTCTTGGCATGAAGTGG - Intergenic
912432945 1:109639108-109639130 ATTGGCCTCCTGGCCTGCTGGGG - Intergenic
913127831 1:115809660-115809682 CCTAGCTTCCTGGCATCAAGAGG + Intergenic
914902668 1:151719647-151719669 ATAACCTTCCTGCCCTCAAGTGG + Intronic
915455052 1:156034951-156034973 CTTGACTTCTTGGGCTCAAGTGG + Intergenic
915696083 1:157743520-157743542 TTTGACGTCCTGGGCTCAAGTGG - Intergenic
915952992 1:160202437-160202459 CTTGGGTTCCTGCCTTCAAGGGG - Intergenic
916328034 1:163585207-163585229 ATTGAACTCCTGGGCTCAAGGGG + Intergenic
916644936 1:166774857-166774879 TTTGAATTCCTGGGCTCAAGTGG - Intergenic
917227223 1:172797352-172797374 TTTGGCTTCCTGGCCTCCAGAGG - Intergenic
917332098 1:173891706-173891728 CTTAAATTCCTGGCCTCAAGTGG - Exonic
917933556 1:179841529-179841551 CTGGACCTCCTGGCCTCAAGGGG - Exonic
918010360 1:180580988-180581010 CTTGACCTCCTGGCCTCAAAGGG - Intergenic
918391141 1:184064041-184064063 ATTGGCTGCCTGGGCTCATCGGG + Intronic
918586953 1:186199359-186199381 CTTGGACTCCTGGCCTCAACTGG + Intergenic
919735205 1:200945069-200945091 CTTGAACTCCTGGCCTCAAGGGG + Intergenic
920867649 1:209766642-209766664 CTTGAACTCCTGGCCTCAAGTGG - Intronic
921659648 1:217785984-217786006 TTTGGCTTCCTGGCTTCATAAGG - Intronic
922093745 1:222423079-222423101 ACTTGCTTCCTGGCCTCACAGGG + Intergenic
922926367 1:229350264-229350286 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
923384046 1:233449028-233449050 ATCAGGTTACTGGCCTCAAGGGG + Intergenic
923400234 1:233609762-233609784 ATGGGCTTCATGACCTCAACAGG - Intergenic
923777393 1:236991997-236992019 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
924556385 1:245122541-245122563 ATCGACCTCCTGGACTCAAGGGG + Intronic
924651565 1:245932779-245932801 CTTGAACTCCTGGCCTCAAGTGG + Intronic
924742067 1:246800205-246800227 CTTGACTTCCTGGGCTCAGGTGG + Intergenic
1063469663 10:6274113-6274135 CTTGACCTCCTGGGCTCAAGCGG - Intergenic
1063632674 10:7748763-7748785 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1063950082 10:11214062-11214084 CTTGGACTCCTGGCCTCAAGTGG - Intronic
1064964953 10:21005647-21005669 CTTGACTTCCTGGGCTCAAGTGG - Intronic
1065902009 10:30216711-30216733 CTTGAGCTCCTGGCCTCAAGTGG + Intergenic
1066060944 10:31723058-31723080 CTTGAAATCCTGGCCTCAAGTGG - Intergenic
1066189326 10:33041618-33041640 GTGGGCTTCCTTGCCTCCAGTGG - Intergenic
1066338414 10:34504340-34504362 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1067683123 10:48452449-48452471 TGTGTTTTCCTGGCCTCAAGGGG + Intronic
1068247246 10:54389081-54389103 ATGGGCTTCCTGGTCTCAATAGG - Intronic
1068795623 10:61076411-61076433 CTTGGACTCCTGGCCTCAAGTGG + Intergenic
1068891058 10:62148742-62148764 ATCAGCTTCCTGGCCTTTAGTGG + Intergenic
1069635406 10:69921907-69921929 CTGGGCTTCCTGGCCTCCTGGGG + Exonic
1069967000 10:72127769-72127791 CTTGACCTCCTGGGCTCAAGTGG - Intronic
1070017419 10:72547256-72547278 TTTGAACTCCTGGCCTCAAGCGG + Intronic
1070256917 10:74820996-74821018 CTTGACCTCCTGGGCTCAAGCGG + Intergenic
1070304176 10:75228472-75228494 GTTGAATTCCTGGGCTCAAGTGG + Intronic
1071280924 10:84102527-84102549 CTTGGCTTCCTAGCCTGGAGGGG - Intergenic
1071389083 10:85152327-85152349 CTTGACATCCTGGCCTCAAGCGG - Intergenic
1071968933 10:90882742-90882764 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1072617038 10:97056837-97056859 ATTGTCTCCCAGGGCTCAAGAGG - Intronic
1073270030 10:102254884-102254906 ATTGGCTACCAGGCAGCAAGTGG + Intronic
1073360682 10:102896110-102896132 CTTGACCTCCTGACCTCAAGTGG - Intronic
1073479017 10:103773952-103773974 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1073761705 10:106636173-106636195 CTTGACTTCCCGGGCTCAAGTGG - Intronic
1074119458 10:110482703-110482725 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1074383400 10:112998156-112998178 CTTGAACTCCTGGCCTCAAGAGG + Intronic
1074545194 10:114396786-114396808 GTTGGCTGCCTGGCCTTTAGGGG + Intronic
1075057054 10:119226941-119226963 CTTGGCCTCCTGGGCTCAAGTGG + Intronic
1075573926 10:123564764-123564786 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
1075858625 10:125653757-125653779 CTTGAACTCCTGGCCTCAAGAGG - Intronic
1075978984 10:126721123-126721145 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1076745684 10:132512431-132512453 ATTGTTTTCCTGGCCACAGGTGG - Intergenic
1077547755 11:3183114-3183136 TTTGACTTCCTGGGCTCAAGTGG + Intergenic
1078775770 11:14392382-14392404 CTCGAATTCCTGGCCTCAAGTGG - Intergenic
1079426738 11:20350560-20350582 CATGGCTTCCTAGCCTTAAGAGG + Intergenic
1079646710 11:22871983-22872005 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1080313943 11:30926875-30926897 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1081797118 11:45828288-45828310 GTTGCCTGCCTGGCCTCAGGAGG - Intergenic
1082012740 11:47461365-47461387 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1084990586 11:72920518-72920540 CTTGAAGTCCTGGCCTCAAGTGG - Intronic
1085367462 11:75963878-75963900 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1086075178 11:82843088-82843110 CTTGCACTCCTGGCCTCAAGTGG - Intronic
1086472185 11:87126089-87126111 CTTGAATTCCTGACCTCAAGTGG + Intronic
1086505290 11:87497913-87497935 CTTGGCTTCCTGGGCTCCATAGG - Intergenic
1087036078 11:93758088-93758110 TTTGAATTCCTGGCCTCCAGCGG - Intronic
1087209080 11:95427868-95427890 CTTGGACTCCTAGCCTCAAGTGG - Intergenic
1087733821 11:101809313-101809335 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1087901383 11:103645609-103645631 CTTGCTCTCCTGGCCTCAAGTGG - Intergenic
1088022658 11:105138463-105138485 ATGGGCTTCTTAGGCTCAAGAGG + Intronic
1088184890 11:107155893-107155915 CTTGGCTTCCTAGCTACAAGAGG + Intergenic
1088806836 11:113360246-113360268 GTTGGGTTCCTGGACTCTAGGGG - Intronic
1088881815 11:113978769-113978791 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1089010182 11:115125986-115126008 ACTGGTTTCTTGGCCTCCAGTGG - Intergenic
1089393181 11:118115898-118115920 CTGGGATTCCTGACCTCAAGGGG - Intronic
1089433749 11:118444792-118444814 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1089629396 11:119774701-119774723 ACTGGGTTCCTGTCCTCAAGGGG - Intergenic
1089734203 11:120538570-120538592 ATTGGCTTCCTGGCCGCTTACGG + Intronic
1089939748 11:122403370-122403392 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1090226041 11:125072905-125072927 ACTTCCTTCCTGGCCTCCAGAGG - Intronic
1090342271 11:126034597-126034619 CTTGGCTTCCTGTGCTCTAGTGG - Intronic
1090866998 11:130709896-130709918 ATTGTCTTCCTGGTCACCAGTGG + Intronic
1091478530 12:801625-801647 CTTGATCTCCTGGCCTCAAGTGG + Intronic
1092275107 12:7054856-7054878 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1092565292 12:9659017-9659039 TTTGGTTTCCTAGCCTCAAGAGG + Intergenic
1092832779 12:12461389-12461411 CTTGAGTTCCTGGGCTCAAGTGG + Intronic
1093237409 12:16628592-16628614 CTTGAATTCCTGGCCTCAAGTGG - Intergenic
1095354347 12:41253967-41253989 CTTCCCTTCCTGGCCTCTAGTGG - Intronic
1095369473 12:41449502-41449524 ATGGGATCCCTGCCCTCAAGGGG + Intronic
1095610192 12:44119350-44119372 ATGAGCTTCCTGCCATCAAGAGG - Intronic
1095894225 12:47264410-47264432 AATGGCCTCCAGGCCTCCAGAGG - Intergenic
1096242870 12:49968580-49968602 AATGGCTACCTGGCCTCAGGAGG + Intronic
1097270365 12:57770449-57770471 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1097624667 12:61985380-61985402 ATTGTCTTCCTCCCCTCAAATGG - Intronic
1098183554 12:67873364-67873386 ATCGACCTCCTGGTCTCAAGTGG + Intergenic
1098229233 12:68356011-68356033 CTTGAGCTCCTGGCCTCAAGTGG + Intergenic
1098361604 12:69659570-69659592 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1098897092 12:76075942-76075964 CTTGAACTCCTGGCCTCAAGCGG - Intronic
1099149521 12:79092004-79092026 ATTGGCTTCCCAGCCTCAAGAGG - Intronic
1100403651 12:94253756-94253778 CTTGACCTCCTGGGCTCAAGTGG + Intronic
1100810439 12:98332069-98332091 CTTGAACTCCTGGCCTCAAGCGG - Intergenic
1100836021 12:98567844-98567866 CTTGACCTCCTGGCCTCAAGGGG - Intergenic
1101092513 12:101302147-101302169 GTTGAACTCCTGGCCTCAAGTGG + Intronic
1101453107 12:104799730-104799752 TTTGGTTTCCTAGCCTCAAGAGG + Intergenic
1101970178 12:109307394-109307416 CAGGGCTCCCTGGCCTCAAGGGG + Intronic
1101986931 12:109454507-109454529 CTCGACCTCCTGGCCTCAAGTGG - Intronic
1102014367 12:109637970-109637992 ATTGGCTTCGTGGCCACACCTGG - Intergenic
1102624029 12:114220250-114220272 ATGGGATTCCTGCCCTCATGGGG - Intergenic
1102890743 12:116556870-116556892 TTTGCCTTCCTGTCCACAAGAGG + Intergenic
1103300686 12:119924416-119924438 TTTGAACTCCTGGCCTCAAGTGG - Intergenic
1103522211 12:121543900-121543922 CTTGACCTCCTGGACTCAAGTGG - Intronic
1103594366 12:122014928-122014950 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1103804242 12:123560033-123560055 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1104410729 12:128555628-128555650 TTTGGCTTCCTGGACTCCATAGG + Intronic
1104797108 12:131527567-131527589 CTTGCCTTCCTGGGCTCAGGTGG - Intergenic
1104985664 12:132595478-132595500 CTCCGCTTCCTGGGCTCAAGGGG - Intergenic
1105310770 13:19208016-19208038 CTCGACTTCCTGGGCTCAAGTGG - Intergenic
1105360439 13:19709072-19709094 CTCGACTTCCTGGGCTCAAGTGG - Intronic
1106513703 13:30434099-30434121 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1106944319 13:34809764-34809786 CTTGGCTTCCTATCCTCAAGAGG + Intergenic
1107284374 13:38773648-38773670 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1107715299 13:43193789-43193811 ATGGGCTTCCTGTCCTAAAAGGG - Intergenic
1108138840 13:47396711-47396733 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1108301118 13:49077056-49077078 CTCGTATTCCTGGCCTCAAGAGG - Intronic
1108334857 13:49429310-49429332 CTTGAATTCCTGACCTCAAGCGG + Intronic
1109089415 13:58021204-58021226 TTTGACTTCCTGGCCTCAAGAGG + Intergenic
1109163090 13:59001093-59001115 ATAGGCTGCCTGGCCACAAAAGG + Intergenic
1110129969 13:71995841-71995863 CTTGGACCCCTGGCCTCAAGTGG + Intergenic
1110738028 13:78961178-78961200 AGTGGCTTCCTGTCCTGAAGTGG - Intergenic
1110768491 13:79307507-79307529 CTCTGCTTCCTGGACTCAAGTGG + Intergenic
1110927200 13:81168536-81168558 CTCGGATTCCTGGCATCAAGTGG + Intergenic
1113829434 13:113283589-113283611 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1114601328 14:23957768-23957790 TTTGAACTCCTGGCCTCAAGTGG + Intronic
1114605517 14:23992897-23992919 TTTGAACTCCTGGCCTCAAGTGG + Intronic
1114611017 14:24040550-24040572 TTTGAACTCCTGGCCTCAAGCGG + Intergenic
1115138737 14:30143083-30143105 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1115210390 14:30961824-30961846 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1115221550 14:31063074-31063096 CTTGAACTCCTGGCCTCAAGGGG - Intronic
1115246192 14:31298513-31298535 CTTGAACTCCTGGCCTCAAGCGG + Intronic
1115625359 14:35186675-35186697 CTTGACCTCCTGGGCTCAAGTGG + Intronic
1115831739 14:37350295-37350317 CTTGCACTCCTGGCCTCAAGTGG + Intronic
1117248847 14:53915121-53915143 CTCGGCTTCCTGGATTCAAGTGG - Intergenic
1118110375 14:62711739-62711761 AGTGGCTTCCTGAGCTCTAGGGG - Intronic
1118216448 14:63813088-63813110 CTTGGCTTCCTAGCCTTCAGAGG + Intergenic
1118462374 14:65998864-65998886 ATGGGCTTCCTTGCCCCAAAAGG - Intronic
1118863244 14:69682110-69682132 CTTGAATTCCTGGCCTCAAGTGG - Intronic
1119307086 14:73616185-73616207 CGTGAATTCCTGGCCTCAAGTGG + Intronic
1119360778 14:74047516-74047538 CTTGACTTCTTGGGCTCAAGTGG + Intronic
1119873413 14:78036021-78036043 CTTGGCTTCCTGTTCTCCAGTGG + Intergenic
1120162682 14:81162615-81162637 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1121764257 14:96472244-96472266 CTTGACCTCCTGGGCTCAAGTGG + Intronic
1121930298 14:97966211-97966233 CTGGGCCTCCTGGTCTCAAGAGG - Intronic
1121984537 14:98491445-98491467 CTTGGACTCCTGGGCTCAAGTGG + Intergenic
1122282404 14:100631189-100631211 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1122466540 14:101937737-101937759 CTTGAATTCCTGGGCTCAAGGGG - Intergenic
1122545239 14:102518064-102518086 AGGGGCTTCCTGGCCCCAGGAGG + Intergenic
1122584186 14:102793234-102793256 CTTGGCCTCCTGTGCTCAAGTGG + Intronic
1123029649 14:105445595-105445617 ATCGGCATCCTGGCCTCGTGGGG + Intronic
1123218685 14:106837077-106837099 ATTGGCTTCCAGGTCTGAACTGG + Intergenic
1124468853 15:29965429-29965451 ATCGACCTCCTGACCTCAAGTGG + Intronic
1124636939 15:31371539-31371561 ATTGCCTTCCTGCCCTGCAGGGG + Intronic
1125136428 15:36349314-36349336 CTTGATTTCCTGGGCTCAAGTGG - Intergenic
1126015008 15:44342347-44342369 CTTGACCTCCTGGGCTCAAGTGG + Intronic
1126636915 15:50788843-50788865 CTTGACCTCCTGGGCTCAAGTGG + Intergenic
1127944195 15:63733632-63733654 CTTGAATTCCTGGACTCAAGCGG - Intronic
1128009608 15:64280482-64280504 CTTAGCTTCCTGGGTTCAAGCGG + Intronic
1128139793 15:65291159-65291181 GTTGAACTCCTGGCCTCAAGTGG + Intronic
1128342771 15:66834344-66834366 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1128417708 15:67462047-67462069 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1128430530 15:67588898-67588920 CTTGACCTCCTGGGCTCAAGTGG + Intronic
1128532228 15:68462241-68462263 AGTGGCTTCGTGTGCTCAAGTGG + Intergenic
1128669003 15:69560240-69560262 CTCGAATTCCTGGCCTCAAGTGG - Intergenic
1128815763 15:70606958-70606980 TTTAGCTTCCTGGCTTCTAGTGG - Intergenic
1128862047 15:71082434-71082456 ATGGCCTTCAAGGCCTCAAGTGG - Intergenic
1128926573 15:71661613-71661635 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1128993859 15:72282281-72282303 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1129173976 15:73826493-73826515 ACTGGCTTCCTGACCTAAACGGG + Intergenic
1129174969 15:73833241-73833263 ATGGGCTTCTTGGCATCAAAGGG + Intergenic
1129480405 15:75820728-75820750 CTTGACTGCCTGGGCTCAAGTGG + Intergenic
1129916835 15:79282056-79282078 TTTGAACTCCTGGCCTCAAGCGG + Intergenic
1130302047 15:82687878-82687900 CTTGGACTCCTGGGCTCAAGTGG - Intronic
1130987373 15:88853416-88853438 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1131136481 15:89940580-89940602 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1131208029 15:90468282-90468304 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1131221859 15:90591181-90591203 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1131822700 15:96289011-96289033 CTTGAATTCCTGACCTCAAGTGG - Intergenic
1131963206 15:97810346-97810368 CTTGACTTCCGGGGCTCAAGCGG - Intergenic
1132558286 16:582316-582338 AGGGGCGTCCTGGCCACAAGGGG - Intronic
1132716119 16:1290690-1290712 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1133711122 16:8401989-8402011 CTTGACCTCCTGGGCTCAAGCGG - Intergenic
1134110387 16:11511931-11511953 CTTGGCCTCCTGGGGTCAAGGGG - Intronic
1134355984 16:13482714-13482736 CTTGACTTCCTGGGCACAAGTGG - Intergenic
1134541839 16:15073370-15073392 CTTGACCTCCTGGGCTCAAGCGG - Intronic
1134807803 16:17140439-17140461 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1134814439 16:17194400-17194422 CATGCCTACCTGGCCTCAAGTGG + Intronic
1135073984 16:19377402-19377424 CTTGACCTCCTGGGCTCAAGCGG - Intergenic
1135144186 16:19947437-19947459 CTTGACTTCCTGGGCTCAAGCGG + Intergenic
1135300762 16:21325033-21325055 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1135323338 16:21511349-21511371 ATGGGCTTCCTGGTCACAAGTGG - Intergenic
1135393553 16:22113816-22113838 TTTGAATTCCTGGCCTCAAGTGG + Intronic
1135468688 16:22709847-22709869 CTTGAACTCCTGGCCTCAAGCGG + Intergenic
1135722830 16:24831770-24831792 TTCGGCCTCCTGGGCTCAAGAGG + Intergenic
1135751837 16:25064627-25064649 CTTGACCTCCTAGCCTCAAGTGG + Intergenic
1135760574 16:25134818-25134840 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1136180859 16:28550852-28550874 CTTGAATTCCTGGGCTCAAGCGG + Intergenic
1136334824 16:29604615-29604637 ATGGGCTTCCTGGTCACAAGTGG - Intergenic
1136378779 16:29881167-29881189 ATTGCCTCCCTGGCCTCTGGAGG + Intronic
1137777921 16:51071861-51071883 AGTGTCCTCCTGGCCCCAAGGGG + Intergenic
1138002400 16:53295344-53295366 CTTGAATTCCTGACCTCAAGTGG + Intronic
1138109124 16:54309226-54309248 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1138633344 16:58316957-58316979 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1138679406 16:58674186-58674208 CTTGAACTCCTGGCCTCAAGCGG + Intronic
1139174157 16:64667216-64667238 CTAGAATTCCTGGCCTCAAGTGG - Intergenic
1139786784 16:69399420-69399442 ATTTGCTTCCTGGACTGTAGAGG + Intronic
1139934381 16:70558333-70558355 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1141573019 16:84945948-84945970 CTTGATTTCCTGGGCTCAAGTGG + Intergenic
1142035540 16:87860433-87860455 ATGGGCTTCCTGGTCACAGGTGG - Intronic
1143489735 17:7279142-7279164 CTAGACTTCCTGGGCTCAAGCGG - Intergenic
1144269615 17:13603079-13603101 TTTGGCTTCCTTGCCTCCACAGG + Intergenic
1144800855 17:17925949-17925971 TTTGAATTCCTGGGCTCAAGTGG - Intronic
1145034050 17:19527759-19527781 CTCTGCTTCCTGGGCTCAAGAGG - Intronic
1145725316 17:27115555-27115577 ATGGGCTTCCTGTTCTCAATAGG + Intergenic
1145821454 17:27839725-27839747 ACTGACTTCATGGCCTGAAGAGG + Intronic
1146013697 17:29215899-29215921 CTTGACTTCCTGGCCTCAAGTGG - Intergenic
1146199032 17:30839662-30839684 CTCGGCTTCCTGGGTTCAAGCGG + Intronic
1146207407 17:30916802-30916824 CTCGAATTCCTGGCCTCAAGTGG - Intronic
1146236492 17:31169763-31169785 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1146341296 17:32021586-32021608 TTCAGCTTCCTCGCCTCAAGTGG + Exonic
1146378778 17:32313135-32313157 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1146414180 17:32616537-32616559 CTTGAATTCCAGGCCTCAAGTGG + Intronic
1146415077 17:32624269-32624291 ATTGAACTCCTGGGCTCAAGCGG + Intronic
1146510254 17:33441193-33441215 CTTGAATTCCTGGACTCAAGTGG + Intronic
1146853109 17:36240490-36240512 CTTGAATTCCTGGCCTCAAGAGG - Intronic
1146869019 17:36364370-36364392 CTTGAATTCCTGGCCTCAAGAGG - Intronic
1147071894 17:37965005-37965027 CTTGAATTCCTGGCCTCAAGAGG - Intergenic
1147083421 17:38044531-38044553 CTTGAATTCCTGGCCTCAAGAGG - Intronic
1147099365 17:38168502-38168524 CTTGAATTCCTGGCCTCAAGAGG - Intergenic
1147277264 17:39328832-39328854 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1147812673 17:43184134-43184156 CTTGACTTCCTGGGCTCAAGTGG + Intronic
1148044025 17:44731388-44731410 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1148138123 17:45308884-45308906 CTTGACCTCCTGGCCTCAAGTGG + Intronic
1148586942 17:48787731-48787753 ATTGGCTGACTGGCCTGGAGTGG - Intronic
1148662492 17:49346075-49346097 ATAGGATTCCTGGTCTCAGGAGG + Intronic
1149515754 17:57279727-57279749 CTTGAATTCCTGGGCTCAAGCGG + Intronic
1149636901 17:58178315-58178337 CTTGAATTCCTGGCCTCAAGTGG - Intergenic
1149804317 17:59600625-59600647 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1149916826 17:60617175-60617197 GCTGGTCTCCTGGCCTCAAGTGG + Intronic
1149924495 17:60689393-60689415 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1150082378 17:62251799-62251821 CTTGAATTCCTGGCCTCAAGAGG - Intergenic
1150111628 17:62505470-62505492 CTTGAAGTCCTGGCCTCAAGTGG + Intronic
1150755778 17:67911474-67911496 ACTGGGTTCCTGGCCTCTACTGG - Exonic
1150848206 17:68680450-68680472 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1152104350 17:78320074-78320096 CTTGACCTCCTGGGCTCAAGGGG - Intergenic
1152500532 17:80705753-80705775 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1152869065 17:82741990-82742012 ATCGGCCTCCTGGGTTCAAGCGG + Intronic
1152980363 18:270615-270637 CTTGAATTCCTGGGCTCAAGTGG + Intergenic
1153018043 18:601999-602021 CTTGAGCTCCTGGCCTCAAGTGG - Intronic
1153272768 18:3339561-3339583 CTTGGCTTCCTGGCCTCAAGAGG + Intergenic
1153865098 18:9260323-9260345 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1153901886 18:9624438-9624460 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1154141787 18:11830538-11830560 ATTGGCAGCCTGGCCTCCTGAGG - Intronic
1154169452 18:12039810-12039832 CTTGGCCTCCTGGGTTCAAGAGG - Intergenic
1154217685 18:12427475-12427497 CTTGAATTCCTGGCCTCAAGCGG - Intronic
1154934374 18:21036659-21036681 GTTGGTTTCCTGGCCTCAAGAGG + Intronic
1154957283 18:21271425-21271447 ATCAAATTCCTGGCCTCAAGTGG - Intronic
1155734885 18:29209313-29209335 CTTGGCTTCTTGGCCTCAAGAGG + Intergenic
1155831376 18:30518995-30519017 ATAGGGTTACTGTCCTCAAGGGG + Intergenic
1155995665 18:32329149-32329171 CTAGCATTCCTGGCCTCAAGTGG - Intronic
1156045230 18:32870501-32870523 ATTGATTTCCTGGCCTCTAAAGG - Intergenic
1156332753 18:36140061-36140083 CTTGGACTCCTGGCTTCAAGTGG + Intronic
1156501442 18:37562053-37562075 AATTGCTTTCTGGCCTCCAGGGG + Intronic
1156671492 18:39475112-39475134 ATTGAACTCCTGGCCTCAAGTGG + Intergenic
1157371586 18:47117756-47117778 TCTGGAATCCTGGCCTCAAGTGG - Intronic
1157655943 18:49388243-49388265 CTCAGCTTCCTGGGCTCAAGAGG - Intronic
1157693465 18:49702017-49702039 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1157838313 18:50929257-50929279 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1158083159 18:53617993-53618015 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1158171285 18:54603643-54603665 CTTGACTTCCTGTGCTCAAGTGG + Intergenic
1158303170 18:56075568-56075590 CTTGGCCTCTTGGGCTCAAGTGG - Intergenic
1158503344 18:58023289-58023311 CTTGACCTCCTGGACTCAAGCGG - Intergenic
1158607057 18:58905059-58905081 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1158614440 18:58973320-58973342 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1158803537 18:60942786-60942808 ATAGAGTTCCTGCCCTCAAGAGG + Intergenic
1158992724 18:62886492-62886514 CTTGAGCTCCTGGCCTCAAGTGG + Intronic
1159354412 18:67319144-67319166 CTTGAATTCCTGGACTCAAGTGG - Intergenic
1160194823 18:76744320-76744342 TTTGGCTTCCGAGCTTCAAGGGG - Intergenic
1160547210 18:79667104-79667126 TTTGGCTTTCTAGCCTCAAAAGG + Intergenic
1160893550 19:1392235-1392257 CTTGACCTCCTGGGCTCAAGCGG + Intronic
1160963203 19:1733846-1733868 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1161501731 19:4619986-4620008 TTTGAACTCCTGGCCTCAAGGGG + Intergenic
1161528333 19:4771192-4771214 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1162504822 19:11077250-11077272 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1162874572 19:13611188-13611210 CTTGACCTCCTGGGCTCAAGTGG - Intronic
1163970973 19:20794954-20794976 CTTTGCCTCCTGGGCTCAAGTGG + Intronic
1164947758 19:32310677-32310699 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1165043661 19:33086887-33086909 TTCTGCTTCCTGGGCTCAAGTGG - Intronic
1165505923 19:36229427-36229449 CTCAGCTTCCTGGCCTGAAGTGG + Intronic
1165670966 19:37678692-37678714 CTTGACCTCCTGGGCTCAAGTGG + Intronic
1165770510 19:38377271-38377293 CTTGACCTCCTGGGCTCAAGCGG + Intronic
1165880891 19:39042362-39042384 TTTGGCTTCTGAGCCTCAAGAGG + Intergenic
1166036445 19:40171555-40171577 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1166409243 19:42545575-42545597 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1166425292 19:42672555-42672577 TTTGGCTTCCTGGTCTCAAGAGG + Intronic
1166430420 19:42721478-42721500 TTTGGCTTCTTAGTCTCAAGAGG - Intronic
1166437349 19:42778994-42779016 TTTGGCTTCCTATTCTCAAGAGG - Intronic
1166443447 19:42836833-42836855 TTTGGCTTCCTAGTCTCAAGAGG - Intronic
1166447063 19:42867441-42867463 TTTGGCTTCCTATTCTCAAGAGG - Exonic
1166456458 19:42944391-42944413 TTTGGCTTCCTATTCTCAAGAGG - Intronic
1166457607 19:42955992-42956014 TTTGGCTTCCTCATCTCAAGAGG - Intronic
1166463139 19:43007492-43007514 GTTGGCTTCCTAGTCTCAAGAGG - Intronic
1166466249 19:43033663-43033685 TTTGGCTTCCTATTCTCAAGAGG - Intronic
1166467931 19:43050429-43050451 TTTGGCTTCCTCGTCTCCAGAGG - Intronic
1166469284 19:43064045-43064067 TTTGGCTTCCTAGTCTCAAGAGG - Intronic
1166480414 19:43167579-43167601 TTTGGCTTCCTAGTTTCAAGAGG - Intronic
1166485998 19:43212767-43212789 TTTGGCTTCCTATTCTCAAGAGG - Intronic
1166488525 19:43236296-43236318 TTTGGCTTCCTCATCTCAAGAGG - Intronic
1166490235 19:43253122-43253144 TTTGGCTTCCTAGTCTCAAGAGG - Intronic
1166493155 19:43276717-43276739 TTTGGCTTCCTGTTCTCAAGAGG - Intergenic
1166495198 19:43296770-43296792 TTTGGCTTCCTCATCTCAAGAGG - Intergenic
1166772546 19:45292785-45292807 CTCGACCTCCTGGCCTCAAGTGG - Intronic
1166826449 19:45612587-45612609 CTTGACCTCCTGGACTCAAGCGG - Intronic
1166967950 19:46541856-46541878 CTTGGCCTCCTGGGCTTAAGTGG + Intronic
1167854178 19:52224918-52224940 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1167875271 19:52407027-52407049 CTCGACTTCCTGGGCTCAAGTGG + Intronic
1168173338 19:54605909-54605931 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1168513425 19:56991634-56991656 CTCCGCTTCCTGGGCTCAAGTGG + Intergenic
1168532478 19:57140689-57140711 CTTGAACTCCTGGCCTCAAGTGG + Intronic
925633229 2:5916210-5916232 ATTAGCACCCTCGCCTCAAGGGG + Intergenic
925726216 2:6875067-6875089 TTTGGCTTCCTAGCCTCTAGAGG + Intronic
925759065 2:7166682-7166704 TCTGGAATCCTGGCCTCAAGTGG + Intergenic
926188765 2:10711738-10711760 CTTGTCCTCCTGGGCTCAAGTGG - Intergenic
927325492 2:21800660-21800682 CTTGACTTCCTGGGCTCAAGTGG + Intergenic
927643119 2:24858212-24858234 GTTGGACTCCTGGGCTCAAGAGG + Intronic
928818762 2:35334237-35334259 TTTGGTTTCCTATCCTCAAGAGG + Intergenic
929020979 2:37552897-37552919 AATGGCTTCTTGGTCTCAAAAGG + Intergenic
929145541 2:38704281-38704303 CTTGGCCTCCTGGGCTCACGCGG + Intronic
929169682 2:38918959-38918981 TTTGACCTCCTGGGCTCAAGTGG - Intronic
929599470 2:43196098-43196120 CTTGACCTCCTGGGCTCAAGTGG + Intergenic
930841107 2:55846334-55846356 CTTGGCTGCCTAGCCTCAAGAGG - Intergenic
930852866 2:55980132-55980154 CTTGGCTTCCTAGCCTCAAGAGG + Intergenic
931293827 2:60902676-60902698 GTTGACATCCTGGGCTCAAGCGG + Intronic
931607782 2:64068927-64068949 CTTCGCCTCCTGGGCTCAAGCGG + Intergenic
931608144 2:64072265-64072287 CTTGGCTTTGTAGCCTCAAGAGG + Intergenic
931852152 2:66262541-66262563 CTGGGCTTCCTGGCCTTCAGTGG - Intergenic
932041683 2:68305907-68305929 CTTGAACTCCTGGCCTCAAGTGG - Intronic
932247343 2:70206715-70206737 CTTGGACTCCTGGCCTCAAGTGG + Intronic
933973412 2:87488759-87488781 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
935075765 2:99742134-99742156 CTTGAACTCCTGGCCTCAAGCGG - Intronic
935331124 2:101978788-101978810 TTTAGCTCCCGGGCCTCAAGGGG - Intergenic
935543750 2:104378839-104378861 ATGGGCTTCCTGGGCTAGAGGGG - Intergenic
935805570 2:106744317-106744339 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
936518982 2:113200043-113200065 CTTGAACTCCTGGCCTCAAGTGG + Intronic
936842165 2:116784199-116784221 TTTGGCTTCCTACTCTCAAGAGG + Intergenic
937266188 2:120615985-120616007 AAAGGCTCCCTGCCCTCAAGGGG + Intergenic
937721170 2:125098707-125098729 ACTGACTTACTGGCCTCAAAAGG - Intergenic
938045643 2:128117307-128117329 CTTGAACTCCTGGCCTCAAGTGG + Intronic
938248574 2:129797013-129797035 GCTGGATTCCTGGCCTCATGGGG + Intergenic
938268524 2:129947890-129947912 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
938866293 2:135424511-135424533 ATTGAATGCCTGACCTCAAGTGG - Intronic
940329222 2:152456419-152456441 CTTGAATTCCTGACCTCAAGCGG + Intronic
940613611 2:156022731-156022753 ATTGTCTTGCTGGCATCTAGCGG - Intergenic
940653926 2:156465577-156465599 CTTGAACTCCTGGCCTCAAGGGG + Intronic
941633589 2:167910932-167910954 CTCAGCTTCCTGGGCTCAAGCGG + Intergenic
941970302 2:171342951-171342973 CTTGAATTCCTAGCCTCAAGTGG - Intronic
941991883 2:171565178-171565200 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
942292091 2:174483483-174483505 ATTGTGTTCCTGGCAGCAAGAGG - Intronic
942475944 2:176320914-176320936 CTTGAACTCCTGGCCTCAAGTGG + Intronic
943043037 2:182825582-182825604 ATTGAACTCCTGGCCTCAAGTGG - Intergenic
943073857 2:183172163-183172185 ATTGCCTACCTGGCTTCTAGTGG + Intergenic
943614484 2:190077521-190077543 CTTGAACTCCTGGCCTCAAGCGG + Intronic
943663880 2:190588412-190588434 AAGGTCTTCCTGTCCTCAAGGGG + Intergenic
943698373 2:190961414-190961436 CTTGAACTCCTGGCCTCAAGTGG + Intronic
943944121 2:194036614-194036636 ATTTGCTTCGTGGCTTAAAGAGG - Intergenic
944420827 2:199528105-199528127 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
944588967 2:201199429-201199451 CTTGAACTCCTGGCCTCAAGTGG - Intronic
944878787 2:203990115-203990137 AATTGCTTCCTGGGCTTAAGTGG + Intergenic
945211897 2:207391830-207391852 AGGTGGTTCCTGGCCTCAAGGGG - Intergenic
945218362 2:207459243-207459265 CTTGGCCTCCTGGCCTCAAGAGG + Intergenic
945402865 2:209407722-209407744 ATTGACCTCCTGGGCTCAGGTGG - Intergenic
945883024 2:215346244-215346266 CTTCGACTCCTGGCCTCAAGCGG + Intronic
946196823 2:218037612-218037634 TTTGGCTTTCTAGCCTCAAGAGG - Intronic
946288622 2:218725773-218725795 CTTGAACTCCTGGCCTCAAGTGG + Intronic
946377318 2:219319861-219319883 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
946853636 2:223931903-223931925 CTTGAACTCCTGGCCTCAAGTGG + Intronic
947504536 2:230697216-230697238 TGTGGCTTCCTAGTCTCAAGAGG - Intergenic
947596403 2:231414626-231414648 CTTGAATTCCTGACCTCAAGTGG - Intergenic
947730891 2:232431032-232431054 TTTGGCTTCCTAGCCTCAAGAGG + Intergenic
947783951 2:232797759-232797781 CTTGAACTCCTGGCCTCAAGTGG - Intronic
948089500 2:235280738-235280760 ATTGGCATCCTGGCCTATTGTGG + Intergenic
948445857 2:238032416-238032438 TTGGGCCTCCTGGACTCAAGTGG - Intronic
1168894605 20:1314671-1314693 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1169169626 20:3454335-3454357 CTTGACCTCCTGGGCTCAAGTGG + Intergenic
1170326788 20:15164674-15164696 TTTGAACTCCTGGCCTCAAGTGG - Intronic
1170843007 20:19939265-19939287 CTCGAATTCCTGGCCTCAAGTGG + Intronic
1171974332 20:31584651-31584673 CTTGGACTTCTGGCCTCAAGAGG - Intergenic
1172446432 20:34995872-34995894 ATGGAGTTCCTGCCCTCAAGGGG - Intronic
1172562794 20:35904502-35904524 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1173753970 20:45498526-45498548 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
1173821091 20:46021350-46021372 ACTGGCTTCTTGCCCTCAAGTGG - Intergenic
1174026683 20:47582584-47582606 CTTGAACTCCTGGCCTCAAGCGG + Intronic
1174613671 20:51819659-51819681 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1175797679 20:61782862-61782884 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1175826619 20:61939670-61939692 ATTGGCCTCCCGGCCTCCAGTGG - Exonic
1176066559 20:63199967-63199989 CTTGACCTCCTGGGCTCAAGCGG - Intronic
1176136641 20:63525543-63525565 GATGGCTTCCTAGCCTCAAGAGG + Intergenic
1176294224 21:5062194-5062216 TTTGGCTTCTTAGCCTCAAGAGG + Intergenic
1176302903 21:5107210-5107232 ACTGGGTGCCTGGCCTCAAAAGG - Intergenic
1176976892 21:15332707-15332729 ATTCTCTTCCTGCCCACAAGAGG - Intergenic
1177079892 21:16626334-16626356 ATTGAACTCCTGGGCTCAAGTGG + Intergenic
1177754982 21:25335369-25335391 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1178034812 21:28568468-28568490 TTTGGCTTTCTAGCCTCTAGAGG + Intergenic
1178102104 21:29280932-29280954 TTTGACCTCCTGGACTCAAGTGG - Intronic
1178348154 21:31849816-31849838 CTTGACTTCCTGGGCTCAGGTGG - Intergenic
1178404422 21:32312547-32312569 GTTGGCTGCCTGCCCTCCAGGGG - Exonic
1178482321 21:32990210-32990232 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
1178874353 21:36401823-36401845 CTTTGCTTCCTGGGTTCAAGCGG + Intronic
1179854121 21:44154713-44154735 ACTGGGTGCCTGGCCTCAAAAGG + Intergenic
1179863035 21:44201454-44201476 TTTGGCTTCTTAGCCTCAAGAGG - Intergenic
1180242176 21:46517144-46517166 CTTGACTTCTTGGGCTCAAGAGG + Intronic
1180835001 22:18925424-18925446 ACTGCCGTCCTGGCCTCATGAGG - Intronic
1180925143 22:19548547-19548569 CTTGAATTCCTGGGCTCAAGTGG - Intergenic
1180943786 22:19678602-19678624 CTTGGACTCCTGGACTCAAGTGG + Intergenic
1181147788 22:20860950-20860972 CTTGACATCCTGGGCTCAAGCGG - Intronic
1181279892 22:21711952-21711974 TTTGAGTTCCTGGGCTCAAGTGG - Intronic
1181564078 22:23723392-23723414 CTTGAATTCCTGACCTCAAGTGG - Intergenic
1182084682 22:27553408-27553430 CTTGAATTCCTGGCCTCAAGCGG - Intergenic
1182218155 22:28736718-28736740 ATTGAACTCGTGGCCTCAAGTGG - Intronic
1182379375 22:29873898-29873920 CTTGACCTCCTGGGCTCAAGTGG + Intergenic
1182640352 22:31762019-31762041 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1182913124 22:34004231-34004253 ACTGGCTTCCTTGCCTCCAGCGG - Intergenic
1183147646 22:36009456-36009478 ATCTGCCTCCTGGGCTCAAGAGG + Intronic
1183435647 22:37793020-37793042 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1183470879 22:38006001-38006023 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1183656442 22:39188102-39188124 CTTGACCTCCTGGGCTCAAGGGG + Intergenic
1184497932 22:44853705-44853727 CTTGGCTTTCTAGCCTCAAGAGG - Intronic
1203285090 22_KI270734v1_random:150723-150745 ACTGCCGTCCTGGCCTCATGAGG - Intergenic
949949706 3:9219052-9219074 CTTGAATTCCTGGCCTCAAGTGG + Intronic
949971704 3:9412629-9412651 ATTGAACTCCTGGCCTCAAGTGG + Intronic
950291520 3:11788377-11788399 CTTGACCTCCTGGGCTCAAGTGG + Intergenic
950380440 3:12609698-12609720 CTTGAATCCCTGGCCTCAAGCGG + Intronic
950765645 3:15271156-15271178 CTTGAATACCTGGCCTCAAGTGG - Intronic
950970044 3:17177249-17177271 GGTGGCATCCTGGCCTGAAGAGG + Intronic
950978402 3:17275453-17275475 CTTGAATTCCTGGGCTCAAGTGG - Intronic
952076756 3:29706154-29706176 ATTCTCTTCCTGACATCAAGTGG - Intronic
952080267 3:29749528-29749550 CTTGTTTTCCTAGCCTCAAGAGG - Intronic
954007670 3:47604918-47604940 CTTGAATTCCTGGCCTCAAGTGG + Intronic
954055380 3:48019116-48019138 CTTGAATTCCTGGGCTCAAGTGG - Intronic
954769981 3:52958369-52958391 CTTGAATTCCTGACCTCAAGTGG - Intronic
954836900 3:53477860-53477882 CTTGGACTCCTGGCCTCAAGTGG - Intergenic
955323328 3:57990663-57990685 CTTGACCTCCTGGGCTCAAGTGG + Intergenic
956293823 3:67690812-67690834 ACTAGCTTCCTGTCCTCAAGGGG + Intergenic
956323795 3:68028078-68028100 CTTGAACTCCTGGCCTCAAGTGG - Intronic
956639310 3:71400575-71400597 CTTGCAATCCTGGCCTCAAGTGG + Intronic
957187524 3:76961977-76961999 CTTGAAATCCTGGCCTCAAGTGG - Intronic
957195173 3:77058615-77058637 CTTGACTTCCTGGGCTCAGGTGG + Intronic
958588580 3:96122796-96122818 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
958689295 3:97442364-97442386 CTTGAACTCCTGGCCTCAAGTGG - Intronic
959535521 3:107480968-107480990 CTTGACCTCCTGGGCTCAAGGGG + Intergenic
959584765 3:108015670-108015692 GTTGAACTCCTGGCCTCAAGTGG - Intergenic
959723395 3:109516699-109516721 CTTGGCTTCATAGCCTCAAGAGG + Intergenic
961763062 3:129185627-129185649 CTTGAACTCCTGGCCTCAAGCGG + Intergenic
963128552 3:141837008-141837030 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
963523401 3:146385012-146385034 TTTGGCTTCCTAGTCTCAAGAGG + Intergenic
964206886 3:154184790-154184812 ATTGGCTTCCACACCTCCAGTGG + Intronic
964301123 3:155286155-155286177 CTTAAATTCCTGGCCTCAAGTGG + Intergenic
964761010 3:160134984-160135006 CTTGACTTCCTGGGCTCAAGTGG - Intergenic
965169540 3:165244164-165244186 TTTGGCTTCCTAGCCTCAAAAGG - Intergenic
965822696 3:172700705-172700727 CTTGAACTCCTGGCCTCAAGGGG + Intronic
965831809 3:172799002-172799024 TTTGGTTTCCTAGCCTCAAGAGG + Intronic
966266556 3:178052886-178052908 TTTGGCTCTCTAGCCTCAAGAGG + Intergenic
966388897 3:179430674-179430696 CTTGACCTCCTGGCCTCAACTGG + Intronic
966413715 3:179668217-179668239 ATCGACCTCCTGGGCTCAAGTGG + Intronic
968844915 4:3035641-3035663 CTTGCACTCCTGGCCTCAAGTGG + Intronic
968857657 4:3139415-3139437 CTTGAACTCCTGGCCTCAAGCGG + Intronic
968888079 4:3346767-3346789 TTTGGCTTCCCAGCCTCAGGAGG - Intronic
970548682 4:17156633-17156655 ATTGGCGCCCTGCCCTCAAATGG - Intergenic
970601917 4:17647467-17647489 CTTGAAATCCTGGCCTCAAGTGG + Intronic
971066983 4:23044044-23044066 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
971399366 4:26262028-26262050 CTTGGCCTCCTGGGCTCAAGCGG + Intronic
972391613 4:38618942-38618964 ATTGAACTCCTGACCTCAAGTGG - Intergenic
972500594 4:39674498-39674520 CTTGAACTCCTGGCCTCAAGGGG + Intergenic
972549181 4:40111833-40111855 CTTGAACTCCTGGCCTCAAGTGG + Intronic
972561735 4:40234807-40234829 ATTGAACTCCTGGCCTCAAGTGG + Intronic
972662914 4:41134053-41134075 CTTGACCTCCTGGGCTCAAGTGG + Intronic
974251561 4:59391999-59392021 TTTGAACTCCTGGCCTCAAGTGG + Intergenic
975133407 4:70850578-70850600 TTTGGCTTCATAGCCTCAAGAGG + Intergenic
975871773 4:78786971-78786993 TTTGAACTCCTGGCCTCAAGTGG + Intronic
976548284 4:86363865-86363887 TTTGACCTCCTGGCCTCAAGGGG + Intronic
976562004 4:86512506-86512528 TTTGACTTCCTAGCCTCAAAAGG + Intronic
976838934 4:89408333-89408355 TTTGAATTCCTGGGCTCAAGTGG - Intergenic
977602441 4:98948814-98948836 TTTGGCTTCCCAGCCTCAAGTGG + Intergenic
978790816 4:112662146-112662168 TTCGACTTCCTGGGCTCAAGTGG + Intergenic
978887260 4:113779115-113779137 CTTGACCTCCTGGACTCAAGTGG + Intergenic
979185696 4:117789561-117789583 CTTGGCTTTCGAGCCTCAAGAGG - Intergenic
979232201 4:118358539-118358561 ATTAGCTTCTTGGCCTCCAGGGG + Intergenic
979532159 4:121780300-121780322 CTTGAATTCCTGGGCTCAAGAGG - Intergenic
979586790 4:122429212-122429234 CTTGAACTCCTGGCCTCAAGTGG - Intronic
979659474 4:123237451-123237473 CTTGAACTCCTGGCCTCAAGTGG - Intronic
979790341 4:124772593-124772615 CTTGAATTCCTGACCTCAAGTGG + Intergenic
980718240 4:136656923-136656945 TTTGATTTCCTGGGCTCAAGTGG + Intergenic
981646918 4:147009451-147009473 CTTGGCCTCCTGGGCTCAAGTGG - Intergenic
982253557 4:153431416-153431438 TTTGAACTCCTGGCCTCAAGTGG - Intergenic
982471676 4:155799054-155799076 CTTGAACTCCTGGCCTCAAGTGG + Intronic
982507823 4:156241912-156241934 CTCTGCCTCCTGGCCTCAAGTGG + Intergenic
982671486 4:158325128-158325150 CTTGAACTCCTGGCCTCAAGTGG + Intronic
982708573 4:158737172-158737194 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
983548288 4:168986721-168986743 CTTGAACTCCTGGCCTCAAGTGG - Intronic
983677361 4:170311330-170311352 TTTGGCTTCCTGGGCTCAAAGGG + Intergenic
983899206 4:173115107-173115129 AATGGCATGCTGTCCTCAAGAGG + Intergenic
985194025 4:187408353-187408375 TTTGGCTTGCTGGCCTCCATGGG + Intergenic
985576508 5:675717-675739 TGTGCCTTCCTGGTCTCAAGGGG + Intronic
985737236 5:1591103-1591125 CTTGAACTCCTGGCCTCAAGAGG - Intergenic
985773191 5:1825632-1825654 ACACGCTTCCTGGCCGCAAGCGG - Intergenic
986039379 5:3974118-3974140 ATTGGCTTTCTGGCCTCTTTTGG - Intergenic
986897241 5:12385239-12385261 ATTGCCTTCCTGGCTACCAGTGG + Intergenic
986926881 5:12765667-12765689 AATGGCTTGGTGGCCTCCAGTGG - Intergenic
986966569 5:13279468-13279490 ATAGGTTTCCTGGCTTCAAAAGG + Intergenic
987190366 5:15471016-15471038 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
987355515 5:17060253-17060275 CTTGAACTCCTGGCCTCAAGAGG - Intergenic
987368449 5:17171222-17171244 CTTGAACTCCTGGCCTCAAGTGG + Intronic
987890391 5:23868622-23868644 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
989156223 5:38347356-38347378 ACTTGCTTACTGGCTTCAAGTGG + Intronic
989351493 5:40492416-40492438 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
990540877 5:56771403-56771425 AATGGCTTCCTTGACTCAAAAGG + Intergenic
990589123 5:57243906-57243928 CTTGGACTCCTGGACTCAAGCGG + Intronic
990746941 5:58968084-58968106 ATTAGCTTCCTGGTCACATGTGG - Intergenic
991095881 5:62739221-62739243 CTTGAATTCCTGGTCTCAAGTGG + Intergenic
991117724 5:62973300-62973322 CTTGGACTCCTGGGCTCAAGGGG + Intergenic
991229186 5:64311128-64311150 ATTGAATTCCTGGCATTAAGTGG - Intronic
991644331 5:68786577-68786599 ATGGCCTTCCTGGCCTCAAAAGG + Intergenic
996556390 5:124783174-124783196 CTTGACTTCTTGGGCTCAAGTGG + Intergenic
996820164 5:127617740-127617762 CTTGAATTCCTGGGCTCAAGCGG + Intergenic
996996560 5:129703511-129703533 CTTGAACTCCTGGCCTCAAGTGG - Intronic
997541142 5:134663597-134663619 CCTGGCCTCCTGGCCTCAAGTGG - Intronic
997663844 5:135611288-135611310 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
997935987 5:138111511-138111533 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
998219864 5:140268426-140268448 CTTGAACTCCTGGCCTCAAGCGG - Intronic
999127002 5:149253205-149253227 ATTTGCTCCCTGCCCCCAAGGGG + Intronic
999127322 5:149255256-149255278 ATTTGCTCCCTGCCCTCAAGGGG - Intronic
999179121 5:149656514-149656536 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
999295448 5:150456924-150456946 CTTGACCTCCTGGGCTCAAGTGG + Intergenic
999336442 5:150721907-150721929 CTTGACTTCCTGGGCTCAAGGGG + Intronic
999686333 5:154106590-154106612 CTTGAATTCCTGGGCTCAAGTGG + Intronic
999982122 5:156967709-156967731 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
999987436 5:157017280-157017302 CTTGAATTCCTGGGCTCAAGTGG - Intergenic
1000310625 5:160040827-160040849 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1000870349 5:166569667-166569689 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1001392680 5:171392433-171392455 ATTGGACTCTTGGCCTCAAGTGG + Intronic
1001566502 5:172702947-172702969 CTTGACTTTCTGGTCTCAAGCGG + Intergenic
1001863184 5:175078216-175078238 TTTGGCTTCCTAGCCTCAAGAGG + Intergenic
1002907410 6:1461489-1461511 CTTGGCTTTCTAGCCTCAAGAGG + Intergenic
1002988861 6:2219010-2219032 CTTGACCTCCTGGGCTCAAGCGG - Intronic
1003298220 6:4853007-4853029 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1003327330 6:5101871-5101893 CTTGACCTCCTGGGCTCAAGTGG + Intergenic
1003369977 6:5514993-5515015 CTTGAATTCCTGGTCTCAAGTGG + Intronic
1004232447 6:13845773-13845795 TTTGACCTCCTGGGCTCAAGTGG + Intergenic
1004546653 6:16604269-16604291 CTTGAATTCCTGGGCTCAAGTGG - Intronic
1004748912 6:18540685-18540707 TTTGAATTTCTGGCCTCAAGTGG + Intergenic
1005491144 6:26348471-26348493 CTTGAACTCCTGGCCTCAAGAGG - Intergenic
1005925142 6:30438233-30438255 TTTGACTTCTTGGGCTCAAGTGG - Intergenic
1006763664 6:36485987-36486009 CTTACCTTCCTGGGCTCAAGTGG + Intronic
1007744314 6:44034246-44034268 ACTGGGGTCCTGGCCTCCAGTGG + Intergenic
1007851798 6:44810233-44810255 ATGTGCTTCCTTGCCTCATGGGG - Intronic
1008147505 6:47909530-47909552 CTTGACCTCCTGGGCTCAAGCGG + Intronic
1008566162 6:52770642-52770664 ATTTGCTTTCTGGACTCAAATGG + Intergenic
1010119759 6:72361687-72361709 CTTGCCTTCCTAGCCTCTAGTGG + Intronic
1010495029 6:76523587-76523609 ACTGGCTTTGTGGCATCAAGAGG - Intergenic
1012000097 6:93644257-93644279 CTTGGTTTCCTAGCCTAAAGAGG + Intergenic
1012916006 6:105171584-105171606 CTTGACCTCCTGGGCTCAAGTGG - Intronic
1012949872 6:105506450-105506472 ATTGGCCGCCTTGCCTCCAGAGG - Intergenic
1013242245 6:108257298-108257320 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1013290516 6:108715350-108715372 CTTGAATTCCTGGGCTCAAGCGG + Intergenic
1013564828 6:111347806-111347828 CTTGAATTCCTGGCCTCAAAAGG + Intronic
1014313691 6:119837153-119837175 ATTAGTTTCCTGGCTTCAAGAGG + Intergenic
1015521449 6:134135625-134135647 ATTGGCTTCTTCACCTCAAAGGG - Intergenic
1015800210 6:137052748-137052770 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1016870896 6:148815447-148815469 CTTGGCTTCCTGCCCTCTTGGGG - Intronic
1017064640 6:150517963-150517985 TTTGACCTCCTGGGCTCAAGGGG + Intergenic
1017110599 6:150928761-150928783 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1017133989 6:151132337-151132359 GTTGCCTTCCTGCCCACAAGCGG - Intergenic
1017141386 6:151193283-151193305 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
1017509600 6:155102207-155102229 CTTGGACTCCTGACCTCAAGTGG + Intronic
1018466056 6:164046222-164046244 CTTGAGTTCCTGACCTCAAGTGG + Intergenic
1018764322 6:166920689-166920711 ATTGGCTTCCTGGCCTCAAGAGG + Intronic
1019557216 7:1638596-1638618 GTTGGCTTCCTGTCCTCACTCGG - Intergenic
1019744287 7:2690919-2690941 ATCGAACTCCTGGCCTCAAGTGG - Intronic
1020028166 7:4914068-4914090 CTTGACTTCCTGGGCTCAAGCGG + Intronic
1020066659 7:5193658-5193680 TTTGAGTTCCTGGGCTCAAGCGG + Intronic
1020179380 7:5909612-5909634 CTTGGCCTCCAGGGCTCAAGCGG - Intronic
1020286336 7:6684161-6684183 CTTGACCTCCTGACCTCAAGTGG + Intergenic
1020303556 7:6815248-6815270 CTTGGCCTCCAGGGCTCAAGCGG + Intronic
1020765109 7:12310048-12310070 CTTGGCTTTCTAGCCTCAAGAGG + Intergenic
1021140916 7:17023676-17023698 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1022001104 7:26227204-26227226 CTTGAATTCCTGGGCTCAAGTGG + Intergenic
1022169993 7:27816947-27816969 ATTGTCTTCCAGTCCCCAAGAGG - Exonic
1023753107 7:43390454-43390476 TTTGACTTCCTAGACTCAAGTGG - Intronic
1023801814 7:43841487-43841509 CTTGGCTTCCTAGCCTCAAGAGG + Intergenic
1024188369 7:46978669-46978691 CTTGACCTCCTGGGCTCAAGTGG + Intergenic
1024623110 7:51180440-51180462 CTTGGCTTCCTAGCCACAAGAGG + Intronic
1025107775 7:56186828-56186850 CTTGGCCTCCTGGGCTCAAGTGG - Intergenic
1025135534 7:56408735-56408757 ATGGAATTCCTGGCCTTAAGAGG - Intergenic
1025978571 7:66389106-66389128 CTTGACTGCCTGGGCTCAAGTGG - Intronic
1026298654 7:69078221-69078243 ACTGGCCTCCTGGACTCAGGTGG - Intergenic
1026310465 7:69179254-69179276 TTTGGCCTCCTGGGCTCAAGTGG + Intergenic
1026318391 7:69247325-69247347 CTTGACTTCCTGGGCTCAAGTGG + Intergenic
1026667463 7:72355304-72355326 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1026720082 7:72823226-72823248 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1027253437 7:76414214-76414236 CTTGAACTCCTGGCCTCAAGCGG + Intronic
1027306715 7:76906132-76906154 ATGGGTTTAATGGCCTCAAGTGG + Intergenic
1027340700 7:77204897-77204919 CTTGAATTTCTGGCCTCAAGTGG - Intronic
1027384708 7:77648273-77648295 ATTGAACTCCTGACCTCAAGTGG - Intergenic
1029579670 7:101427280-101427302 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1029630306 7:101746123-101746145 CCTGGACTCCTGGCCTCAAGAGG + Intergenic
1029913540 7:104181920-104181942 TTTGACTTCCTAGACTCAAGAGG + Intronic
1029925932 7:104316965-104316987 CTTGAATTCCTGGGCTCAAGTGG - Intergenic
1030311627 7:108074586-108074608 CTTGAATACCTGGCCTCAAGTGG + Intronic
1031420190 7:121542555-121542577 CTTGGCATACTAGCCTCAAGGGG + Intergenic
1032040835 7:128559401-128559423 CTTGAAGTCCTGGCCTCAAGTGG + Intergenic
1032123724 7:129175620-129175642 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
1032160338 7:129504636-129504658 CTTGAATTCCTGGGCTCAAGGGG + Intronic
1032308136 7:130756011-130756033 AAGGGCTTCCTGGCCTAAATAGG - Intergenic
1032839438 7:135702593-135702615 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1032879559 7:136074635-136074657 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1033399546 7:141009012-141009034 CTTGAATTCCTGACCTCAAGTGG + Intronic
1033713656 7:143976749-143976771 TTTGGCTTTCTAGCCTCATGGGG - Intergenic
1034261271 7:149757651-149757673 CTTGAACTCCTGGCCTCAAGCGG - Intergenic
1034399639 7:150853801-150853823 CTTGAATTCCTGACCTCAAGTGG - Intronic
1034544811 7:151782781-151782803 GTGTGCTTCCTGGCCTCACGCGG - Intronic
1036415003 8:8538814-8538836 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1036449051 8:8849298-8849320 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1036552809 8:9830009-9830031 CTTGACTTCCTGGGCTCAAGCGG + Intergenic
1036600080 8:10252633-10252655 ATTGGCTTCCTGGCCTGGGCTGG + Intronic
1036749771 8:11436347-11436369 ACTGGCTGCTTGGCCTCACGAGG - Intronic
1038217702 8:25577912-25577934 AGTGGCTTCCTGCTCTCAAGAGG + Intergenic
1038229206 8:25685078-25685100 CTTGAACTCCTGGCCTCAAGAGG + Intergenic
1038805306 8:30785347-30785369 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1038844483 8:31216220-31216242 CTTGAACTCCTGGCCTCAAGGGG + Intergenic
1038935516 8:32245819-32245841 TATAGCTTCCTAGCCTCAAGTGG - Intronic
1038967828 8:32595272-32595294 ATTGACCTCCTGGGCTCAGGTGG + Intronic
1039310067 8:36307865-36307887 ATTGGCTTTCTGTCCTCTGGTGG - Intergenic
1039562364 8:38522970-38522992 CTTGACATCCTGGCCTCAAGTGG + Intronic
1039695782 8:39909476-39909498 CTTGGCTTTCTAGCCTGAAGAGG + Intronic
1039804215 8:40984810-40984832 ATCATCTTCCTGGCCTCCAGTGG - Intergenic
1039813828 8:41074178-41074200 TTTGGCTTCATGGCCCCAATAGG + Intergenic
1039959854 8:42237938-42237960 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
1040395668 8:46997899-46997921 ATTGGCTTACTGGACTCACCTGG - Intergenic
1040993879 8:53381067-53381089 CTCCGCTTCCTGGGCTCAAGTGG - Intergenic
1041323624 8:56640316-56640338 CATGGCTTCCTGGTCTCAAGAGG - Intergenic
1041915446 8:63134184-63134206 CTTGGCTTCCTAGCCTTGAGAGG - Intergenic
1042846362 8:73172998-73173020 CTCGAATTCCTGGCCTCAAGTGG - Intergenic
1044567677 8:93682581-93682603 CTTGACCTCCTGGGCTCAAGCGG - Intergenic
1044574522 8:93753645-93753667 ATTGACCTCCTGGGCTTAAGTGG + Intergenic
1044950609 8:97432233-97432255 CTTGAACTCCTGGCCTCAAGCGG + Intergenic
1044963646 8:97555098-97555120 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
1045028369 8:98111386-98111408 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1045223164 8:100218005-100218027 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1045581045 8:103480718-103480740 CTTGAATTCCTGGACTCAAGGGG + Intergenic
1046434582 8:114170580-114170602 ATTGGCTTCTTAGCCGCAGGAGG - Intergenic
1046798557 8:118398966-118398988 CTTGACCTCCTGGTCTCAAGTGG + Intronic
1046843163 8:118884239-118884261 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1046920897 8:119727361-119727383 CTTGACCTCCTGGGCTCAAGCGG - Intergenic
1046927998 8:119813894-119813916 TTTGAACTCCTGGCCTCAAGTGG - Intronic
1047355886 8:124121170-124121192 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1047356789 8:124129614-124129636 ATTGCCTGCCTGGCCACCAGGGG - Intergenic
1047420162 8:124701150-124701172 CTTGACCTCCTGGGCTCAAGTGG - Intronic
1047557360 8:125947140-125947162 CTTGGCTTCTTATCCTCAAGAGG - Intergenic
1048553351 8:135454338-135454360 TTTGGCTTCCAGGCCAAAAGAGG - Intergenic
1049099242 8:140567505-140567527 GTTGGCTTCCTGCACACAAGGGG + Intronic
1049232180 8:141490116-141490138 ATGGGCGTCCTGTCCTCCAGCGG - Intergenic
1049587935 8:143440582-143440604 CTTGGCTTCCTGGTCTCCATGGG + Intronic
1050495370 9:6235262-6235284 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1051507384 9:17841595-17841617 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1051644613 9:19255181-19255203 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1052553865 9:29987260-29987282 CTTGGCTTCCTAGCCTCGAGAGG - Intergenic
1055396858 9:75885050-75885072 CTTGAACTCCTGGCCTCAAGCGG + Intergenic
1056118606 9:83464797-83464819 CTTGAATTCCTGACCTCAAGTGG - Intronic
1056428222 9:86500399-86500421 CTTGCACTCCTGGCCTCAAGTGG + Intergenic
1056520762 9:87399190-87399212 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1056570521 9:87810679-87810701 ATTGACTGCCTGGCCTCCATTGG - Intergenic
1057382871 9:94584602-94584624 ATTGACTGCCTGGCCTCCATCGG - Exonic
1057557340 9:96098441-96098463 ATTGAACTCCTAGCCTCAAGCGG - Intergenic
1057894773 9:98900316-98900338 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1057947667 9:99343832-99343854 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
1058242448 9:102582610-102582632 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1058294830 9:103293400-103293422 CTTGGCTTCCCAGCCTCAAGGGG + Intergenic
1058650049 9:107167206-107167228 CTTGAATTCCTGGGCTCAAGTGG + Intergenic
1058656871 9:107230502-107230524 GTTGGCTACCTGGCCACAAAGGG - Intergenic
1058713145 9:107698402-107698424 GGTGGCTTCCTTCCCTCAAGGGG + Intergenic
1058768451 9:108206483-108206505 CTTGAATTCCTGGGCTCAAGTGG - Intergenic
1059101063 9:111472015-111472037 CTTGACCTCCTGGGCTCAAGTGG - Intronic
1059136679 9:111813850-111813872 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1059228726 9:112697287-112697309 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1059591823 9:115670218-115670240 CTTGAACTCCTGGCCTCAAGGGG + Intergenic
1059798743 9:117728424-117728446 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1060059225 9:120444192-120444214 CTTGAACTCCTGGCCTCAAGTGG - Intronic
1060749706 9:126161244-126161266 CTTGACCTCCTGGGCTCAAGTGG + Intergenic
1060993824 9:127864374-127864396 ATTGAACACCTGGCCTCAAGTGG - Intergenic
1060994260 9:127867389-127867411 ATTGGCTTCCTTGACGCGAGAGG - Exonic
1061298105 9:129687978-129688000 CTTGACCTCCTGGGCTCAAGCGG + Intronic
1061460098 9:130730654-130730676 CTTGACCTCCTGGGCTCAAGCGG + Intronic
1061816470 9:133200186-133200208 CGTGGCCTCCTGTCCTCAAGGGG - Intergenic
1062617847 9:137406129-137406151 CTTGACCTCCTGGGCTCAAGCGG - Intronic
1203400714 Un_KI270519v1:92292-92314 AAGTGCTTTCTGGCCTCAAGTGG + Intergenic
1185484354 X:470968-470990 AGTGGCTTCCTTGCCTCATAGGG + Intergenic
1187079053 X:15966875-15966897 CTTGGTTTCTTAGCCTCAAGAGG - Intergenic
1187220644 X:17322725-17322747 CTTGGTTTCCTACCCTCAAGAGG + Intergenic
1187338961 X:18404507-18404529 CTTGAACTCCTGGCCTCAAGCGG - Intergenic
1187427510 X:19191735-19191757 CTTGAATTCCTGACCTCAAGTGG + Intergenic
1187433636 X:19247455-19247477 CTTGAATTCCTGGGCTCAAGTGG - Intergenic
1187527870 X:20070340-20070362 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1187975686 X:24702550-24702572 ATTGGCTGCCTGACTGCAAGAGG - Intronic
1188016510 X:25112829-25112851 CTTGAATTCCTGGGCTCAAGTGG + Intergenic
1188203737 X:27325514-27325536 CTTGAACTCCTGGCCTCAAGTGG - Intergenic
1188317109 X:28688427-28688449 GTTGAACTCCTGGCCTCAAGTGG + Intronic
1189775341 X:44465262-44465284 CTTGACCTCCTGGGCTCAAGTGG - Intergenic
1189794013 X:44630306-44630328 ATTGAATTCCTGGGCTCAAGTGG + Intergenic
1190010757 X:46782781-46782803 CTTGGCCTCCTGAGCTCAAGCGG + Intergenic
1190769973 X:53506041-53506063 CTTGGCTCCTTAGCCTCAAGAGG + Intergenic
1191153039 X:57241705-57241727 ATTGGCTTTGTGGACACAAGGGG - Intergenic
1191606068 X:63064146-63064168 GTTGGCTTCCTGGCTTTGAGAGG - Intergenic
1192183976 X:68933979-68934001 CTTGAACTCCTGGCCTCAAGCGG - Intergenic
1192323265 X:70109651-70109673 TTTGGCTTTATAGCCTCAAGAGG - Intergenic
1192370942 X:70512436-70512458 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1192556785 X:72096358-72096380 ATTGGCTTTATGGGCTCCAGTGG - Intergenic
1192579724 X:72270925-72270947 CTTGAATTCCTGGGCTCAAGTGG - Intronic
1193100111 X:77601244-77601266 CTTGAACTCCTGGCCTCAAGCGG - Intronic
1193104041 X:77648947-77648969 CTTGACCCCCTGGCCTCAAGTGG - Intronic
1193124246 X:77854566-77854588 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1194106678 X:89778316-89778338 AGTGGCTTCCTCACCCCAAGTGG + Intergenic
1195124436 X:101791922-101791944 ATTGACTTTCTTGCCTGAAGAGG + Intergenic
1195178696 X:102335494-102335516 ATTGACTTTCTTGCCTGAAGAGG + Intergenic
1195180168 X:102351589-102351611 ATTGACTTTCTTGCCTGAAGAGG - Intergenic
1195392182 X:104374126-104374148 CTTGAACTCCTGGCCTCAAGCGG + Intergenic
1195407839 X:104536333-104536355 ATCTCATTCCTGGCCTCAAGTGG - Intergenic
1195525527 X:105884873-105884895 CTTGGCCTCCTGGGTTCAAGTGG + Intronic
1195663498 X:107405998-107406020 TTTAGTTTCCTGTCCTCAAGGGG - Intergenic
1195779869 X:108450311-108450333 CTTGAACTCCTGGCCTCAAGAGG + Intronic
1196005080 X:110828189-110828211 ATGGGCTTCGGGGACTCAAGGGG + Intergenic
1196847463 X:119907676-119907698 CTTGAACTCCTGGCCTCAAGTGG + Intronic
1196853377 X:119960406-119960428 CTCGAATTCCTGGCCTCAAGTGG - Intergenic
1197065519 X:122228819-122228841 ATTGGATTACTAGTCTCAAGTGG - Intergenic
1197228493 X:123977925-123977947 CTTGACTTTCTGGGCTCAAGCGG + Intronic
1197713682 X:129690207-129690229 ATTGGCTGTGTGGCCTCAGGGGG + Intergenic
1198049657 X:132938419-132938441 CTTGGACTCCTGGGCTCAAGTGG - Intronic
1198673075 X:139102653-139102675 ACTTGATCCCTGGCCTCAAGAGG + Intronic
1199199887 X:145074980-145075002 ATGTGGTTACTGGCCTCAAGGGG - Intergenic
1199348551 X:146772024-146772046 ATTAGCTTCCAGGGTTCAAGGGG - Intergenic
1199605086 X:149571337-149571359 TTTGGCTTCCTAGCATAAAGAGG - Intergenic
1199640571 X:149857350-149857372 TTTGGCTTCCTAGCATGAAGAGG + Intergenic
1199653484 X:149971424-149971446 CTTGAACTCCTGGCCTCAAGTGG + Intergenic
1200132079 X:153855506-153855528 CTCCGCTTCCTGGGCTCAAGCGG - Intergenic
1200458642 Y:3426180-3426202 AGTGGCTTCCTCACCCCAAGTGG + Intergenic