ID: 1018767353

View in Genome Browser
Species Human (GRCh38)
Location 6:166944854-166944876
Sequence GTGTGGGCCTGGTGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 553}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018767353 Original CRISPR GTGTGGGCCTGGTGGGCAGA GGG (reversed) Intronic
900266941 1:1762154-1762176 TTGTGTGGCTGCTGGGCAGATGG - Intronic
900427501 1:2587221-2587243 GCGTGCGCCTGGTGGGCGTAGGG + Exonic
900465378 1:2822706-2822728 GTGTGGGTCTCGTGAGCAGGAGG - Intergenic
900513850 1:3072235-3072257 TTGTGAGCCAGGTGGGCAGGTGG + Intronic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900990813 1:6097366-6097388 GAGAGGCCCTGCTGGGCAGAGGG + Intronic
901650349 1:10739530-10739552 GAGTGGGCCCGGGGGGCGGAGGG - Intronic
901748952 1:11394092-11394114 GGCTGGGTCTGCTGGGCAGAGGG - Intergenic
901769650 1:11523871-11523893 GCCTGGGCCCGATGGGCAGAGGG - Intronic
902300132 1:15495795-15495817 ATTTGTGCCAGGTGGGCAGAGGG - Intronic
902392769 1:16115885-16115907 GTGGGGGACTGGGGGGCAGGAGG + Intergenic
902469871 1:16641647-16641669 GTGTAGGGCTTGTGGGGAGATGG + Intergenic
902490553 1:16777887-16777909 GGGAAGGGCTGGTGGGCAGAGGG + Intronic
903374836 1:22859285-22859307 GGGTGGGCCTGGTGGGGGGGGGG + Intronic
903385766 1:22925162-22925184 GTGTAGGGCTGGGGGGCTGAGGG - Intergenic
904250183 1:29217808-29217830 GTGTGGGCGTAATGGGGAGATGG + Intronic
904297021 1:29526478-29526500 GTGGTGGCCTGGAGGGGAGAAGG - Intergenic
904384107 1:30130447-30130469 GGGGAGGCCTGGTGGGCAGGTGG - Intergenic
904384122 1:30130492-30130514 GGGGAGGCCTGGTGGGCAGGTGG - Intergenic
904586943 1:31585877-31585899 GTGAGGGGCGTGTGGGCAGAGGG + Intronic
904612248 1:31732168-31732190 GGGAGGGGCAGGTGGGCAGAGGG + Intronic
904826053 1:33274510-33274532 GTAAGGGATTGGTGGGCAGAGGG + Intronic
904855935 1:33498388-33498410 GTGTGGGCCAGGTGAGAAAATGG + Intergenic
905120587 1:35678830-35678852 GTGTGGGCCTGTAGGGGAGTGGG - Intergenic
905824475 1:41018072-41018094 GTGTAGGCCAGGTGGGCAGCGGG + Exonic
905861611 1:41355622-41355644 GGGAGGGCCTGGTGGGAGGAGGG + Intergenic
906157482 1:43622224-43622246 AGGTGGGTCTGGTGGACAGAAGG - Exonic
906203972 1:43977086-43977108 GCGTGGGCATCGTGGGCAGTGGG + Exonic
907006540 1:50920216-50920238 GCTTGAGCCTGGGGGGCAGAGGG + Intronic
907059575 1:51407895-51407917 GTGTGGGCTTTGTGGCTAGATGG - Intronic
907267625 1:53272432-53272454 GCATGAGCCTGGGGGGCAGAGGG - Intronic
907311697 1:53542512-53542534 GTGTGGGGCGGGTGGGGAGATGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
910502411 1:87908034-87908056 GTGGGGGTGGGGTGGGCAGAAGG + Intergenic
910589793 1:88918543-88918565 CAGTGGGCCTGGTGTGTAGATGG + Intergenic
910739397 1:90498323-90498345 ATGTGGGCCTGGTGGTTAGTTGG + Intergenic
913185093 1:116363635-116363657 GCCTGGGCCTGGTGTGCAGGTGG - Intergenic
913531715 1:119738372-119738394 GTGTGGGGCTGCTGGGCAGCAGG - Intronic
914814747 1:151055217-151055239 CTAAGGGCCTGGTGGGAAGAGGG + Intronic
915033984 1:152907405-152907427 GGGAGGGGCCGGTGGGCAGAAGG + Intergenic
915289994 1:154877184-154877206 GGGTGGGAGTGGTGGGCAGGAGG - Intergenic
915304202 1:154968685-154968707 GTGTGGGGCATGTGGGGAGAGGG - Intronic
915420059 1:155773329-155773351 TTGGGGGGATGGTGGGCAGATGG - Intronic
916522387 1:165575877-165575899 GCGTGGGCCTGGGGGTCAGGAGG - Intergenic
917789588 1:178491029-178491051 GGATGGGCCTGGTGGACAGGAGG + Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
920226947 1:204446137-204446159 CAGTGAGCCTGGTGGGCACACGG + Exonic
920432444 1:205927635-205927657 GTGTGGGGCTGGGGGGCACGGGG + Intronic
920744819 1:208616761-208616783 GGGTGGGCGTGGTGGGGAGGTGG + Intergenic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921261458 1:213388440-213388462 GTGGGGGCCTGGTGGGGGGCAGG + Intergenic
921599411 1:217090419-217090441 GCCTGGGCCCGGTGGGTAGAAGG - Intronic
921600646 1:217102964-217102986 GAGAGGGCCTGCTTGGCAGAGGG + Intronic
921953194 1:220955238-220955260 GTAGAGGCCTGGTGGGGAGACGG + Intergenic
922175373 1:223193285-223193307 GTGGAGGCCTGGTGGGCTGGAGG + Intergenic
922448744 1:225719498-225719520 CTGTGGACTTGGTGGGCACACGG - Intergenic
922455902 1:225773369-225773391 CTGTGGACCTGGTAGGCAGTGGG + Intergenic
923264533 1:232301398-232301420 GTGTGAGCCTGCTGGGGAGCAGG - Intergenic
923438406 1:233992145-233992167 GGGTGGGATTGGTGGGCAAAGGG + Intronic
923529889 1:234804648-234804670 GGGAAGGGCTGGTGGGCAGAGGG - Intergenic
1063223990 10:3997479-3997501 GGGAGGTCCAGGTGGGCAGATGG - Intergenic
1063227935 10:4033809-4033831 GGGTGGGCCTGGGAGGCAGGAGG + Intergenic
1063389071 10:5637144-5637166 GGGTGGGCCATGTGGGCAAATGG - Intergenic
1063487162 10:6430686-6430708 GAGTGGGGCTGGTGGGGAGTTGG + Intronic
1067041982 10:42959516-42959538 GTGACTTCCTGGTGGGCAGAGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067054415 10:43042668-43042690 GTTTGGGCCGGGTAGGCATAGGG + Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067513087 10:46911516-46911538 CTGGGGGCCAGGTGGGCAGGGGG + Intronic
1067649166 10:48140326-48140348 CTGGGGGCCAGGTGGGCAGGGGG - Intergenic
1067699409 10:48557844-48557866 TTGGGGGCCTGGGGAGCAGAGGG + Intronic
1068854447 10:61783226-61783248 GTGACGGCCCTGTGGGCAGAGGG - Intergenic
1070191944 10:74119009-74119031 GAGTGGCCCTGCTGGGAAGATGG - Exonic
1070718415 10:78739440-78739462 GTGTGGGCCTTGCTGGGAGAGGG - Intergenic
1070831062 10:79418406-79418428 GTGTCTGCCTGGCAGGCAGAGGG - Intronic
1071290656 10:84186395-84186417 GTGTGTGTGTGGTGTGCAGAGGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1072686961 10:97543196-97543218 GGGAGCGCCTGGTGGGAAGAGGG + Intronic
1075502569 10:122989189-122989211 GGGTGGGCGGGGTGGGCAGAAGG + Intronic
1076193881 10:128501161-128501183 TTCTGGGCCTTGTGGGCACAGGG - Intergenic
1076317199 10:129550952-129550974 GTTTCGGCCTGGAGGGCAGGTGG + Intronic
1076525928 10:131112389-131112411 GTGGGGGCCTGGGGGACAGGGGG - Intronic
1076599144 10:131645869-131645891 GTGTGTGCCTTGAGGGGAGAGGG + Intergenic
1076723691 10:132403852-132403874 GAGGGTGCCAGGTGGGCAGATGG + Intronic
1077187933 11:1243765-1243787 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077188360 11:1245436-1245458 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077188890 11:1247536-1247558 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077189315 11:1249207-1249229 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077342390 11:2031917-2031939 GGGTGGGCCGGGCAGGCAGAGGG - Intergenic
1077404117 11:2375203-2375225 GTGTGAGCCTGGGAGGCAGGGGG - Intergenic
1077528916 11:3086203-3086225 GCGTGGGCCTGGGGTGCAGGAGG + Intergenic
1077537190 11:3130026-3130048 GTGTAGGGCTGGTGGGGAGCAGG - Intronic
1078496051 11:11818110-11818132 ATGTGGTCCTGATGGGAAGATGG + Intergenic
1078514356 11:12009384-12009406 GGGTGGGCCTGGTGGGCGGGCGG - Intronic
1078539369 11:12200859-12200881 GGTCGGGCCTGGTGGACAGAAGG + Intronic
1079244118 11:18740814-18740836 GTGTGAGCCTCAGGGGCAGAGGG + Intronic
1079813772 11:25029090-25029112 GTGGGGACCTGGTGGGTAGGAGG + Intronic
1081038147 11:38176482-38176504 TTATGGGCATGGTGGGCTGAAGG - Intergenic
1081577123 11:44326106-44326128 CTGGAAGCCTGGTGGGCAGAAGG + Intergenic
1081787284 11:45756525-45756547 GAGTGGGCCTGGCTGGGAGAGGG + Intergenic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083170892 11:60923658-60923680 GCGTGTGCTTGCTGGGCAGAGGG + Intergenic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084006140 11:66324685-66324707 GTGTGGGCCTGTGGGGGTGAGGG + Intergenic
1084264833 11:67999498-67999520 AGGTGAGCCTGGTGGGCAGCAGG - Exonic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084889080 11:72227956-72227978 GTGTAGGTCTGGTGGGGAGACGG + Intronic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085607140 11:77911327-77911349 GTGTGAGTTTGGTGGCCAGATGG + Intronic
1087198518 11:95322227-95322249 CTGTGGGCTTGGTGCCCAGAGGG - Intergenic
1088087430 11:105997785-105997807 GATTGGGACTGGTGGGGAGAGGG + Intronic
1088495843 11:110430397-110430419 GTGTGGGCCCGGCGCGCAGAAGG - Intronic
1089184763 11:116607306-116607328 GTTTGGGGCTGTTGGGTAGAGGG - Intergenic
1089338730 11:117743496-117743518 TTGGGGAACTGGTGGGCAGATGG - Intronic
1089441832 11:118524121-118524143 ATGAGGACTTGGTGGGCAGAGGG - Exonic
1089456389 11:118628233-118628255 GGGTGGTCCGGGTGGGCAGCGGG - Exonic
1089509167 11:118985018-118985040 GTGCAGGCCTGTTGGGCAGGAGG - Intergenic
1089683971 11:120135121-120135143 ATGTGGTTCTGGTGGGCAGGAGG - Intronic
1090413765 11:126526898-126526920 GTTAGGGACTGATGGGCAGAGGG - Intronic
1091002735 11:131924061-131924083 GTGGGCCCGTGGTGGGCAGAGGG + Intronic
1091307039 11:134542932-134542954 GAGTGGGCCTGTGGGTCAGAGGG + Intergenic
1202825376 11_KI270721v1_random:87106-87128 GGGTGGGCCGGGCAGGCAGAGGG - Intergenic
1091576582 12:1742330-1742352 GGGAGGCCCAGGTGGGCAGATGG - Intronic
1091763757 12:3104925-3104947 GTGTGGGGGTGATGGGCAGGGGG + Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1093547830 12:20369134-20369156 TTGTGGGCCTGGGGAGAAGAAGG + Intergenic
1093612739 12:21182528-21182550 GGGAGGGACTGGCGGGCAGAAGG - Intronic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1096891131 12:54772674-54772696 GTGGGGGGCTGGTGGGGAGGTGG - Intergenic
1098012674 12:66071353-66071375 GTGTGGGGGTGGTGGGCCGCAGG - Intergenic
1098355597 12:69610119-69610141 GTGTGCGCCGTGTGGGGAGATGG - Exonic
1102213994 12:111147421-111147443 GTGGGAGCCTGGCGGGCAGTGGG - Intronic
1103912638 12:124360746-124360768 GGGTGGGCATTGCGGGCAGAGGG - Intronic
1103931330 12:124452644-124452666 GGGAGGGCGAGGTGGGCAGAGGG + Intronic
1104179073 12:126360698-126360720 GTGGGTGACTGGTGGGGAGAAGG + Intergenic
1104305532 12:127607544-127607566 GTCTGGGCGTGGGGGTCAGATGG + Intergenic
1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG + Intronic
1104735399 12:131133177-131133199 GTGAGGGCCTGGGGAGCTGAGGG - Intronic
1104751633 12:131243862-131243884 GTCTGGGCCTTGTGTGCACATGG - Intergenic
1104780259 12:131415213-131415235 GTCTGGGCCTTGTGTGCACATGG + Intergenic
1105214889 13:18278283-18278305 GTGAGGGCATGATGGACAGATGG - Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105708303 13:22982233-22982255 TTGTGTGCATGGTGGGCACATGG + Intergenic
1106149846 13:27088601-27088623 TTGGGGGCATGGTAGGCAGAGGG + Intronic
1106285818 13:28317338-28317360 ATCTGGGCCTGATGGGCTGAGGG + Intronic
1106355640 13:28980386-28980408 ATGTTGGCCTGTGGGGCAGAAGG - Intronic
1106411023 13:29511600-29511622 GTGGGGGCCTTGTTGGCAGCTGG - Exonic
1111397212 13:87678492-87678514 GTGTGGGGCAGGTGTGGAGAAGG + Exonic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113913282 13:113854849-113854871 GTTTGCACGTGGTGGGCAGAAGG + Intronic
1113949946 13:114066330-114066352 GTGAGGCCCTGGTGGGAAAAGGG + Intronic
1114567835 14:23645477-23645499 GTGTGGGTCTGGGGAGCTGAAGG + Exonic
1114621561 14:24099237-24099259 GTGAGGGCCTGGTGAGAAGCAGG + Intronic
1115776399 14:36720060-36720082 GGGTGGGCCTGGCTGGCAGAGGG - Intronic
1117838266 14:59830120-59830142 GGGTGCTGCTGGTGGGCAGAGGG - Intronic
1117881327 14:60316211-60316233 TGGTGGGCCTGGTGGGCTGGTGG - Intergenic
1118138461 14:63053098-63053120 GGGTGTGCTTGGTGGGAAGAAGG + Intronic
1118726506 14:68632735-68632757 GGGTGGGCATGGTGGGCCAACGG - Intronic
1119336553 14:73838141-73838163 GTGTGGGCCTGGTATACAGGTGG - Intergenic
1119972869 14:78991922-78991944 GTGTGACCCTGGTGGGTTGATGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121105234 14:91275026-91275048 GTGGGGGCGCGGTGGGCATACGG + Intronic
1121711985 14:96045333-96045355 GTGTGGGTGTTTTGGGCAGAGGG + Intronic
1121823847 14:96994221-96994243 GTCTGGAGCTGGTGGGGAGATGG + Intergenic
1122307786 14:100776666-100776688 GTGTGGGCCGGGGGGGGAGGTGG - Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1202889625 14_KI270722v1_random:143791-143813 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1123751906 15:23363651-23363673 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124077528 15:26460575-26460597 GTGTAGGGGTAGTGGGCAGATGG - Intergenic
1124284272 15:28387575-28387597 GGGTGGGGGTGGTGGCCAGAGGG - Intronic
1124298425 15:28524039-28524061 GGGTGGGGGTGGTGGCCAGAGGG + Intronic
1124575806 15:30907276-30907298 GGGAGGCCCAGGTGGGCAGATGG + Intronic
1125679845 15:41523734-41523756 GCGGGGGCCTGGTGGACAGCCGG + Intronic
1127817653 15:62625836-62625858 GAGTGGGCAGAGTGGGCAGATGG + Intronic
1127841315 15:62834630-62834652 TTGTGTGCCAGGTGGGGAGACGG - Intronic
1128382702 15:67125145-67125167 GGGTGGGCCTGGATGGCATACGG - Intronic
1129708777 15:77809614-77809636 GGGAAGGCCTGGTGGGCTGAGGG + Intronic
1130296117 15:82647878-82647900 GTGTGGCCCTGCGGGGCTGACGG + Intronic
1131158620 15:90090284-90090306 GTGTGTGCCTGGTGGACAGTGGG - Intronic
1131955603 15:97732055-97732077 ATGTGGGCCTGGGAGGCAGCAGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132243196 15:100276228-100276250 GTGGGTGCCTGGTGGGAAGGTGG + Intronic
1132558912 16:584663-584685 TGGTGGGCCAGGTGGGCAGCTGG - Intergenic
1132738892 16:1401186-1401208 GTGGGTGCCTGGTGGGCTGGGGG + Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1135160995 16:20096317-20096339 GTGTGTTCCTGGTTGACAGAGGG + Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136407629 16:30057726-30057748 GTTTGGGGCTGAGGGGCAGAAGG + Intronic
1136543755 16:30943852-30943874 GAGGGGGCATGGTGGGAAGAAGG - Intronic
1137539625 16:49353319-49353341 ATGTGGGGCTGCTGGGCAAATGG + Intergenic
1137722108 16:50633438-50633460 GTGTGGGCCACGTGGCCAGAGGG + Exonic
1138350190 16:56342209-56342231 GTGTGGGCCTGGAGTGGGGAAGG + Intronic
1138657165 16:58498180-58498202 GGGAGGGCATTGTGGGCAGAGGG + Intronic
1139710296 16:68770803-68770825 GGCAGGGCCTGGTGGGTAGATGG + Intronic
1141225458 16:82110787-82110809 GTGTGGGCCAGGTGGGTAGAGGG - Intergenic
1141602229 16:85133817-85133839 GTGGGGGCCGGGAGTGCAGACGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142020779 16:87780883-87780905 GTGAAGGACTTGTGGGCAGAGGG - Intergenic
1142262104 16:89047905-89047927 TTGGGGGCCTGGTGGGGTGATGG + Intergenic
1142307575 16:89294118-89294140 GGGAGGGCCTGGTGGGGAGCGGG - Intronic
1142431819 16:90032676-90032698 GTGTGGTGCAGGTGAGCAGATGG + Intronic
1142555530 17:774168-774190 GTGTGGGACTCGTGGAGAGATGG - Intronic
1142670094 17:1484125-1484147 GTGAGGCCCTTGTGGGGAGATGG - Intronic
1142745677 17:1956428-1956450 GTGGGGGCCTGGTGGGGGGGCGG + Intronic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1142986318 17:3697136-3697158 GTGCGGGGGTGGGGGGCAGACGG + Intergenic
1143115800 17:4581391-4581413 ATGTGGACCTGGGGTGCAGAGGG + Intergenic
1143387778 17:6542203-6542225 TTGTAGACCTGATGGGCAGATGG - Intronic
1143713401 17:8749636-8749658 GGGAGGCCCAGGTGGGCAGATGG - Intergenic
1143715292 17:8763460-8763482 GGGAGGCCCAGGTGGGCAGATGG - Intergenic
1143773555 17:9183244-9183266 GTGTTGGGCTGGCGGGCAGCTGG - Intronic
1144754791 17:17672742-17672764 GTGTGGTTCCAGTGGGCAGAGGG - Intergenic
1144833298 17:18143624-18143646 GTGTGGGTCTGGGTGGCAGCAGG + Intronic
1146001415 17:29132835-29132857 GGGAGGGACTGGTGGACAGAGGG + Intronic
1146208959 17:30927017-30927039 CTATGGGCCTGGTGCGCAGGTGG + Intronic
1146397363 17:32479470-32479492 GGGTGTGCCTGGTGGGCAAGAGG + Intronic
1146615711 17:34355789-34355811 CTCTGGGCCTGAGGGGCAGAAGG + Intergenic
1146638286 17:34521937-34521959 TTGTGGGCCGGATGGGCAGGAGG + Intergenic
1146742841 17:35301447-35301469 GTGTGAGCTTGGTGGGGGGAGGG + Intergenic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1148343507 17:46888234-46888256 GTGTGGGTCAGGTGGGGAGTTGG + Intergenic
1148745711 17:49916853-49916875 ACGTGGGCCTGGTGGGGAGGAGG - Intergenic
1149085157 17:52708039-52708061 GTGTGGGGTTGGTGGGGAGGTGG + Intergenic
1149679162 17:58492716-58492738 GTGTCAGCCTGGTAGGCAAATGG - Intronic
1150437845 17:65167896-65167918 GTGTGACCCTGGTGGGCTGGTGG + Intronic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1150626091 17:66842089-66842111 GTGAGGGCATGGTGGGCAGTGGG - Intronic
1151320034 17:73347537-73347559 CTGTGGGCCCCGTGGGCTGAGGG - Intronic
1152146493 17:78571856-78571878 GTTTGGGATTGGTGGGCAGAAGG - Intronic
1152462852 17:80450379-80450401 GCGTGGGCCGGGTGGGAAGAGGG - Intergenic
1152573652 17:81131038-81131060 GTGAGGGCTGGGTGGGGAGATGG - Intronic
1152615271 17:81334924-81334946 GTGAGGGCGTGGATGGCAGAGGG - Intergenic
1152658423 17:81530637-81530659 GTGGGGGCTTGGTGGGCACCTGG - Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1153915905 18:9743869-9743891 GTCTGTGCCTGTTGGGAAGATGG + Intronic
1154043068 18:10877715-10877737 GTGGAGGCCTGGCTGGCAGAGGG - Intronic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1154432784 18:14321122-14321144 GTGAGAGGGTGGTGGGCAGAAGG + Intergenic
1156396273 18:36702991-36703013 GTGAGGTCCTGTTGGTCAGAGGG + Intronic
1158091233 18:53716156-53716178 GTCAGGGGCTGGTGGGCAAAGGG - Intergenic
1160431591 18:78816790-78816812 CTGTCAGCCTGGTGGGCAGAAGG - Intergenic
1160589766 18:79936979-79937001 GTGGGGTCCTTGAGGGCAGAAGG + Intronic
1160702336 19:513781-513803 ATGTGGGGCTGGTGTGCAGTAGG - Intronic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160915863 19:1496221-1496243 CTGTGCCCCTGGTGGGGAGAGGG - Intronic
1160978556 19:1806203-1806225 GTGTGGGGAGGGTTGGCAGAGGG - Intronic
1161297220 19:3526198-3526220 GTGGGGGCCTGCAGGGCGGATGG - Intronic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161345635 19:3767586-3767608 GTGTCGGCCTGGCGGGAAGTGGG + Intronic
1161717796 19:5886601-5886623 GTGTGGCCCTTGTGGACACAGGG + Intronic
1162125474 19:8497567-8497589 GTGTGGCCCAGGTTGGCAGCAGG - Intronic
1162523807 19:11196529-11196551 GTGGTGGCTTGGTGGGCAGTGGG - Intronic
1162562181 19:11423216-11423238 ATGTGGGCCTTGTGAGCGGATGG - Intronic
1162575550 19:11496890-11496912 CAGTGGGCCTTGTGGGCCGAAGG - Intronic
1162762346 19:12896239-12896261 GTGTGGGCTCGGTGTGAAGATGG + Exonic
1163034882 19:14564592-14564614 GTGAGGGCGTGGTGGACAGGAGG - Intronic
1163256430 19:16158705-16158727 TTGAGGGCCTGGTGTGCAGTAGG + Intergenic
1163674087 19:18646709-18646731 ATGCGGGCATGGCGGGCAGAAGG - Intronic
1163695096 19:18760015-18760037 GTGTTTTCCTGGTCGGCAGACGG - Exonic
1164575029 19:29400888-29400910 ATGTGGGCATGGTGGGGACAGGG + Intergenic
1164823760 19:31269024-31269046 GTGTGGACCTGCTGGGCAGCAGG - Intergenic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165148755 19:33749071-33749093 GAGAGGCCCTGGTGGGCAGAAGG + Intronic
1165148838 19:33749441-33749463 GTGGGGGGATGGTGGGGAGATGG - Intronic
1166105925 19:40598098-40598120 GGGTGGGGGTGCTGGGCAGACGG - Intronic
1166193742 19:41193354-41193376 GCGTGGGCCCGGGGGGCAGGTGG - Exonic
1166349800 19:42191143-42191165 GGGTGGACCTGGAGGGCAAATGG - Intronic
1166991233 19:46693971-46693993 GGGTGGGCCAAGTGGGCAGGGGG - Exonic
1166993147 19:46705119-46705141 TTCAGGGCCTGGGGGGCAGATGG - Intronic
1167213458 19:48148512-48148534 GTGGGGACATGGTGTGCAGAGGG + Intronic
1167239937 19:48337775-48337797 GTGCTGGCCTGGTGAGAAGAGGG - Intronic
1167268384 19:48494336-48494358 ATGAGGGCCTGGTGGGCTGTGGG - Intronic
1168564553 19:57412221-57412243 GAGTGGGCCTGGGGGGCTGCTGG - Intronic
1202665026 1_KI270708v1_random:110558-110580 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
925162310 2:1694511-1694533 AGGAGGGCCAGGTGGGCAGAGGG - Intronic
925292745 2:2758643-2758665 GTGTGGGACTGGTGGGCCTGGGG + Intergenic
925305080 2:2842546-2842568 GTGTGGCTCTGGTGGGCTGGAGG + Intergenic
925357185 2:3250120-3250142 TCTTGGGCCTGGAGGGCAGAAGG - Intronic
925516986 2:4693494-4693516 GTGTGGGCTGCGTGGGGAGAGGG + Intergenic
926730843 2:16034375-16034397 GTGTGGTCCTGGGGGGTGGAGGG + Intergenic
926756991 2:16244359-16244381 CCGTGGGCCTGGTGGGAGGAGGG + Intergenic
926774913 2:16412521-16412543 GTGGGGGCTTGGTGGGGAGTTGG - Intergenic
927826433 2:26312901-26312923 GTGGGGGCCAGCTGGGCAGTCGG - Intronic
928626210 2:33142467-33142489 GCGTGGTGGTGGTGGGCAGAGGG + Intronic
929651240 2:43681773-43681795 GATGGGGCCTGGTGGGGAGAGGG - Intronic
929668619 2:43852487-43852509 GTGAGGGCCTGGGGGGCAGATGG + Intronic
929789694 2:45013764-45013786 GTGAAGGCCTGGAGGGCAGAGGG - Intergenic
929918683 2:46156856-46156878 GTGTGTGGGAGGTGGGCAGATGG - Intronic
930867221 2:56133730-56133752 GTGTGAGCCTGGGTGACAGAGGG + Intergenic
931344319 2:61432232-61432254 GAGTGGCCAAGGTGGGCAGATGG + Intronic
932331889 2:70902376-70902398 GTGTGGACCTGTTGGGCACCAGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932721067 2:74139329-74139351 GTGGGGGCCTGGTGTCCTGACGG - Intronic
932977788 2:76625120-76625142 GGGAGGGGCTGGTGGGTAGATGG + Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933689979 2:85172306-85172328 GTGTGGGGGTGGTGGCCACAGGG - Intronic
933938454 2:87225865-87225887 GGCTGGGTCTGGTGGGCACATGG - Intergenic
934540985 2:95174955-95174977 GTGTGGTCCTGGTGAGGAGGAGG - Intronic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935603054 2:104942126-104942148 GTGTGGGCCTTATAGGCTGATGG + Intergenic
936354684 2:111739909-111739931 GGCTGGGTCTGGTGGGCACATGG + Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937916830 2:127103452-127103474 GGGAGGGCCAGCTGGGCAGAGGG - Intronic
938069262 2:128299926-128299948 GGGTGGCTCTGGTGGGCAGAGGG + Intronic
938537212 2:132256698-132256720 GAGTGGGCCTGGTGGACACCCGG - Intronic
938924662 2:136028205-136028227 CCGTGGGCATGGTGGGCCGAGGG + Intergenic
941328142 2:164143395-164143417 GAGTGGGCATGGTGGGCCCATGG + Intergenic
944095384 2:195961392-195961414 GGGTGGGGCTGGTGGGTAGTGGG - Intronic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
944809069 2:203310119-203310141 GTTTGAGCCTGGGAGGCAGAGGG - Intergenic
945207027 2:207343171-207343193 GTGTGTGCCTGGTGGGGGTAGGG + Intergenic
945660337 2:212677991-212678013 GTGTGGCACTGGTGATCAGATGG + Intergenic
946382428 2:219358323-219358345 CAGGGTGCCTGGTGGGCAGAGGG - Intergenic
946929171 2:224655551-224655573 GCTTGGGCATGGTGGGCTGAAGG - Intergenic
946946967 2:224831428-224831450 GTGAGGTCCTGGGGGGCACAGGG + Intronic
947281427 2:228460071-228460093 GTGGGGCACTGGTGGGCACAGGG + Intergenic
947829071 2:233126006-233126028 TTATGGGCCTGGTGACCAGAGGG + Intronic
947914562 2:233823000-233823022 GTGTGAGCCTGCTGGCCAGGTGG + Exonic
948722607 2:239911054-239911076 TAGTGGGTCTGCTGGGCAGAGGG + Intronic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
948787266 2:240359135-240359157 GTCTGGGCCTGGTGGCATGAGGG - Intergenic
948993345 2:241565394-241565416 CAGTGGGCCTGAGGGGCAGAAGG - Intronic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
1169045937 20:2534603-2534625 GCATGGCCCTGGTGGGGAGAGGG + Intergenic
1169812297 20:9620468-9620490 GTCTGGGGCTGATGGGCAGTTGG + Intronic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1170454160 20:16517033-16517055 GTGTGGGTGTTGTGGCCAGAGGG - Intronic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1171767979 20:29300660-29300682 GCGTGGGCCTGGTGGGCGCCCGG - Intergenic
1171810679 20:29742886-29742908 GTATGGGCCTGGTGGGCGCCGGG - Intergenic
1171866114 20:30488477-30488499 GAGTGGGCGTGGTGGGCACCCGG - Intergenic
1172031494 20:31985170-31985192 GGGTGGGGCTGGGAGGCAGATGG - Intronic
1173652938 20:44678782-44678804 GGGTTGGCCTGGGGGGCAGGCGG + Intergenic
1174575803 20:51536283-51536305 ATGTGGCCCTGGAGGGCAGCAGG - Intronic
1175178258 20:57126820-57126842 GGGTGGGCCTGCTGGGGAGAGGG + Intergenic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175719435 20:61276750-61276772 GTCAGGGGCTGTTGGGCAGAGGG + Intronic
1176000767 20:62830364-62830386 GGGAGGGCCTTGTGGGCCGAGGG - Exonic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176019380 20:62954701-62954723 GTGCTGGCCAGGTGGGCACAGGG - Intronic
1176032974 20:63022668-63022690 GAGCGAGCCAGGTGGGCAGATGG + Intergenic
1176102168 20:63369595-63369617 GGGTGGGCAGGGTGAGCAGAGGG - Intronic
1176121458 20:63456094-63456116 GTGGGGGGCCCGTGGGCAGAGGG - Intronic
1176121474 20:63456128-63456150 GTGGGGGGCCTGTGGGCAGAGGG - Intronic
1176138358 20:63534783-63534805 GAGCGGGCCAGGTGGGCGGAGGG + Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176235387 20:64051301-64051323 GGGTGGGCCTCCTGGGCAGCTGG + Intronic
1176302719 21:5106225-5106247 GCCTCTGCCTGGTGGGCAGAGGG - Intergenic
1178730183 21:35094830-35094852 GTAGGGGTCAGGTGGGCAGAGGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179854305 21:44155698-44155720 GCCTCTGCCTGGTGGGCAGAGGG + Intergenic
1180131479 21:45829768-45829790 GTATGAGCCTGGGGGGCAGGTGG - Intronic
1180219412 21:46348446-46348468 GGGTGGTCCTCGTGTGCAGATGG + Intronic
1180245657 21:46545767-46545789 GTGTGCGCCTGCTGGCCAGGGGG - Intronic
1180312828 22:11253351-11253373 GAGTGGGCCTGGTGGGCACCCGG - Intergenic
1180331752 22:11487478-11487500 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1180731271 22:17984308-17984330 GTGTTGGCCTGGCTGGCAGCAGG - Intronic
1180834392 22:18922655-18922677 GGGTTGGCCTGGTGGGGAGGAGG - Intronic
1180937217 22:19633621-19633643 GTGCGGGCCTGGTGGGCCACAGG - Intergenic
1180954688 22:19736395-19736417 GTGGGGGCCTCGAGGGCAGCTGG + Intergenic
1181065418 22:20303448-20303470 GGGTTGGCCTGGTGGGGAGGAGG + Intergenic
1181118719 22:20650840-20650862 GTGTGGGAATTGTGGGGAGAAGG - Intergenic
1182095685 22:27623819-27623841 GTTTGGGCTTGGAGGGCTGAGGG - Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182623760 22:31631405-31631427 TTGCGTGCCTGGAGGGCAGAAGG - Intronic
1183058987 22:35323854-35323876 GTATGGGCGGGGCGGGCAGAGGG - Exonic
1183300635 22:37057384-37057406 GGGTGGGACCTGTGGGCAGAAGG - Exonic
1183469771 22:37999093-37999115 AGGTGGGCCTGCTGGGCAGCTGG + Intronic
1183684185 22:39351889-39351911 GATTGGGCCTGGTGGGATGAGGG + Intronic
1183777032 22:39972948-39972970 GTGTGGAGTTGGTGGGCAGATGG + Exonic
1183942296 22:41302394-41302416 GTCTGGGCCTGCTGGGCAGGGGG + Intronic
1184015294 22:41781490-41781512 GTGTGTGGCTGGTGGTCATAAGG + Intronic
1184094556 22:42309499-42309521 GCGGGGGCGAGGTGGGCAGAAGG - Intronic
1184284755 22:43464325-43464347 GTGTGTGTGTGGTGGGCATAGGG + Intronic
1184445234 22:44543200-44543222 GTGGGGTCCAGGTGGGCAGAGGG - Intergenic
1184710399 22:46246307-46246329 GGGTGGGCCAGGTGGGGAGGTGG - Intronic
1184838813 22:47040535-47040557 GTGTGGCTCTGATGGGGAGAGGG + Intronic
1185169030 22:49281475-49281497 GAGTGGGCTTGGTGGTCTGAGGG + Intergenic
1185172879 22:49303895-49303917 GCCTGGGCCTGGCGGGCAGGAGG - Intergenic
1203284481 22_KI270734v1_random:147954-147976 GGGTTGGCCTGGTGGGGAGGAGG - Intergenic
949281558 3:2352778-2352800 GTGCGGGACTGGTGGGCAGCAGG + Intronic
949482126 3:4503842-4503864 GTTTGGGCTATGTGGGCAGAGGG + Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950426210 3:12925998-12926020 GGGTGGTCCTGGTGGTCAAAGGG + Intronic
950691114 3:14658765-14658787 GGCTGGGCCTCATGGGCAGATGG + Intronic
952764233 3:36941348-36941370 CTGTGAGCCTGGTGGGCTGGTGG - Intronic
953334982 3:42087149-42087171 GTCTGGGGCAGTTGGGCAGATGG - Intronic
953849442 3:46454854-46454876 GAGAGGCCCAGGTGGGCAGAAGG + Intronic
954795227 3:53157998-53158020 GTGTGGGCCTCAGGGACAGAGGG + Intronic
954800413 3:53183840-53183862 GTGAGGGGCCAGTGGGCAGAGGG + Intronic
955446890 3:59021482-59021504 GTGTAGGCAGGGTGGGCAGATGG - Intronic
956203804 3:66735498-66735520 GTGTGTTCCTGGTAGGCAAATGG + Intergenic
957252348 3:77789319-77789341 GTTTGGTCATGGTGGGCACAGGG + Intergenic
959573091 3:107906578-107906600 GTTAGGGCCTGCTGGGCAGAAGG + Intergenic
960419214 3:117423012-117423034 GTGTGGCACCGCTGGGCAGAAGG - Intergenic
961366263 3:126401835-126401857 GTGTGAGCCTGGGGAGCACAGGG - Intronic
961457181 3:127030063-127030085 AGGTGGGCCTGGCTGGCAGATGG + Exonic
961511517 3:127406644-127406666 GTGGGGGAATGTTGGGCAGAGGG + Intergenic
961647778 3:128401536-128401558 GTGTGAGCATGGCAGGCAGAGGG + Intronic
961909623 3:130301264-130301286 GTGGGGGCTGGGAGGGCAGAGGG + Intergenic
962130551 3:132669506-132669528 GGGAGGGCTAGGTGGGCAGATGG - Intronic
962473653 3:135737096-135737118 ATGTGTGCCTGTTGGGCACATGG - Intergenic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
964408152 3:156371231-156371253 GTGTGGGCTTGGGAGGCAGTGGG + Intronic
965567968 3:170140952-170140974 GGGTGTGCCTGGTGGGGAGAAGG + Intronic
965883410 3:173414108-173414130 GTGGGGGCCTGGAAGGGAGAGGG + Intronic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
967915130 3:194572982-194573004 GTGTGGGCAAGGTGGGCGAAGGG - Intergenic
968120326 3:196121449-196121471 GTGTAGGTCTGGTGGGTAGGGGG - Intergenic
968232999 3:197015322-197015344 GCGTGGGCCAGGTGGGCGGGTGG - Intronic
968548128 4:1208864-1208886 GTGTCTGCCTGGTGGGCGGGCGG - Exonic
968626051 4:1627165-1627187 GTGGGGACCTGGTTGGCTGAGGG - Intronic
968648002 4:1749451-1749473 GTGAGGGGCTGGTGGGGAGGGGG - Intergenic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
969622265 4:8284529-8284551 GTGTGGGCATGGAGGCCAGTGGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971828804 4:31663189-31663211 GGGTAGGCCTGCTGGGAAGAAGG - Intergenic
971879738 4:32355746-32355768 GGTTGGTCCTGGTAGGCAGATGG - Intergenic
973367751 4:49221518-49221540 GTGAGAGCGTGGTGGGCAGTAGG - Intergenic
973723217 4:53746280-53746302 GTTTGCGTCAGGTGGGCAGAGGG + Intronic
973784712 4:54324069-54324091 GAGTGGCCCTGGTGGGCATGAGG - Intergenic
977879565 4:102188401-102188423 GGGTGGGCCTGGCTGGCAGTTGG + Intergenic
978861155 4:113450495-113450517 GTGTGTGCCTGGTGGGGATAGGG + Intergenic
979155391 4:117381458-117381480 GTCTGGGCCTGCTGAGCAAAAGG + Intergenic
980437070 4:132791106-132791128 GTGTGGGGCTGGTGGGGTAATGG - Intergenic
980866657 4:138561087-138561109 GTTTAGGCTTGGAGGGCAGATGG - Intergenic
981509866 4:145544197-145544219 GTGTGGGGGTGGGGGGCATATGG + Intronic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984329626 4:178298069-178298091 GTGTGGGGCGGGGGGGCAGTCGG + Intergenic
984902956 4:184600978-184601000 GTTTGAGCTTGGTGGGGAGAGGG + Intergenic
984924950 4:184798569-184798591 GTGTGGCCCTGTTTGCCAGAGGG - Intronic
985529973 5:428413-428435 ATGCGTCCCTGGTGGGCAGATGG + Intronic
985710316 5:1424144-1424166 AGGTTGGCCGGGTGGGCAGATGG + Intronic
985754952 5:1708178-1708200 GTGTGTGCCTTGTGTGCAGGTGG + Intergenic
986043605 5:4016786-4016808 GTGCAGGCCAGGTGGGCAGAGGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986284188 5:6347850-6347872 GTGAGGGCCTGGGGGGCCCAGGG + Intergenic
986350834 5:6878142-6878164 GTGAGTGCCTGGTGGGCAGAGGG + Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
988735478 5:34016215-34016237 GTGCGGGGGTGGTGGGGAGAGGG + Intronic
988854927 5:35219126-35219148 GAGTTGGACTGGTGGGGAGATGG - Intronic
989304559 5:39938391-39938413 GTGGTGGCATGGTGGGAAGAGGG - Intergenic
990264816 5:54063382-54063404 GTGTGGCTCTGGTGGACACAGGG - Intronic
991574687 5:68090674-68090696 GTGTGTGGGGGGTGGGCAGAGGG - Intergenic
992619006 5:78574267-78574289 GGCTGGGCCTGGTGTACAGAGGG - Intronic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
994570326 5:101506282-101506304 GTGTGGGCATGGTGGGCTGCAGG - Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995340881 5:111057833-111057855 GTGTGGGTATGGTGGACAAAGGG + Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
997754013 5:136377593-136377615 GTGGGAGATTGGTGGGCAGAAGG + Intronic
997777472 5:136624115-136624137 GTGTGGTGGTGGTGGGCAGTGGG - Intergenic
998150967 5:139757226-139757248 GAGTGGGCTGGGTGGGCAGTGGG + Intergenic
998397509 5:141828229-141828251 GCGTGGGCCTGGTACGCAGTAGG - Intergenic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
1000284384 5:159814698-159814720 GTCAGGGCCTGTGGGGCAGAAGG + Intergenic
1000684502 5:164230374-164230396 GGGTGGCCAAGGTGGGCAGATGG + Intergenic
1001577544 5:172773945-172773967 TTGTGGGCCTGGCTGCCAGAGGG + Intergenic
1001866108 5:175106953-175106975 GAGTGGACATGGTGGGTAGAGGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002065347 5:176648935-176648957 GTGACGGCTTAGTGGGCAGAGGG + Intronic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002475387 5:179462185-179462207 GTGTGGGCGTGGTGGGGGGAGGG - Intergenic
1002476152 5:179467558-179467580 GTGTGGGCGTGTTGGGAAGGTGG - Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003942071 6:11039308-11039330 CTGTGTGCCTGGTGAACAGAGGG - Intronic
1005890104 6:30130401-30130423 GTCTGGGCGTGGTGGGCATGGGG - Intergenic
1006347219 6:33492406-33492428 TTGTGGGTCTGGTGGCCACAGGG - Intergenic
1006367617 6:33624762-33624784 GGGTGGCCTTGGTGGGCAGATGG + Intronic
1006430442 6:33992709-33992731 GTCTGGGGCTGATGGGCAGCTGG - Intergenic
1006450774 6:34104606-34104628 GTGTGTGCCAGGTGGGGAGCAGG - Intronic
1006605018 6:35249845-35249867 GTGTGGACAGGGTGGGCAGGAGG - Exonic
1006635046 6:35456007-35456029 GGCTGGGCCTGGGGGGCAGGAGG + Exonic
1006884600 6:37370620-37370642 CTCAGGGCTTGGTGGGCAGAGGG - Intronic
1007369401 6:41416519-41416541 GTGTGTGTCTGGTGGGTGGAGGG - Intergenic
1007416393 6:41693886-41693908 GTGTGCGTGTGGTGGGCAGTGGG - Intronic
1007466910 6:42058938-42058960 GTGTGTGGTTGGGGGGCAGAGGG + Intronic
1007717335 6:43864902-43864924 GTGTGTTCCTGGTAGGCAGAAGG + Intergenic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1009290507 6:61875168-61875190 GTGTGGGCGTGGTGGGGGCAGGG + Intronic
1010659939 6:78557625-78557647 GTGTGGGGCAGGTGGGAAGGGGG - Intergenic
1011914750 6:92489273-92489295 GTGGGGGCATGGGGGGCAGGTGG + Intergenic
1012429035 6:99144862-99144884 ATGTTGGCATGGTGGGGAGATGG + Intergenic
1013954995 6:115831498-115831520 CTGTGGGCCTGCAGGGCTGATGG - Intergenic
1013990992 6:116253621-116253643 CCGTGGCCCTGCTGGGCAGAAGG - Exonic
1014109790 6:117607772-117607794 TTGTGGCCATGGTGAGCAGAGGG + Intergenic
1014852802 6:126362087-126362109 GGGAGGGGCTGGTGGGCAGGAGG + Intergenic
1014957382 6:127637655-127637677 GTGTGGGAATGGTGGGGACAGGG + Intergenic
1014992085 6:128093352-128093374 GGGAGGCCATGGTGGGCAGATGG + Intronic
1015268172 6:131309910-131309932 GTGTGGGCCTGGTTGTTTGAAGG - Intergenic
1017368200 6:153670033-153670055 GTTTGTGCCACGTGGGCAGAGGG + Intergenic
1017526547 6:155246226-155246248 GCGTGGGCCTGGAGGGCATCTGG + Intronic
1018682966 6:166280210-166280232 GGGAGGCCCAGGTGGGCAGATGG - Intergenic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018923898 6:168193762-168193784 ATATGGGCCTGGTGGGCAGGAGG + Intergenic
1019191692 6:170254871-170254893 CTGTGGGCCTGGTGGGCACCAGG + Intergenic
1019415392 7:924539-924561 GCGTGGACCTGGAGGGCAGGGGG - Intronic
1019421847 7:954369-954391 GTGTGGGCCGGGTGGGCGCGGGG - Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020176010 7:5882666-5882688 GAGTGGGCCTGGGGTGCAGTGGG + Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021488631 7:21194070-21194092 GTGTGTTCCTGGTGGTCAGTGGG + Intergenic
1022014171 7:26334887-26334909 ATTTGGGCCTGGTTTGCAGATGG + Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022288442 7:28977627-28977649 ATTTGGGCCTGGTTCGCAGATGG + Intergenic
1022466918 7:30658170-30658192 GTGTGGGCAGGGTGACCAGAAGG - Intronic
1023247802 7:38224603-38224625 GTGTGGATCTGCTGGACAGAGGG - Intronic
1023255880 7:38311632-38311654 GTGGGGGTCTGCTGGGCAGCAGG - Intergenic
1023370426 7:39507509-39507531 CTGTGGCCCTGGTTTGCAGATGG - Intergenic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1023864924 7:44234025-44234047 GTGGGGTCCTGGTGGGGAGAGGG + Intronic
1023874643 7:44280280-44280302 GTGTGGGCCTGGTATCCAGGAGG + Intronic
1024046521 7:45589301-45589323 GTGTGGTGGTGGTGTGCAGATGG + Intronic
1025260895 7:57416785-57416807 GTAGGGCCCTGGTGGGCAGCGGG + Intergenic
1025725154 7:64051406-64051428 GTCTGGCCTTTGTGGGCAGATGG - Intronic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1026889799 7:73975130-73975152 GTCTGGAACTGGTGGGGAGAAGG - Intergenic
1028232224 7:88319320-88319342 ATTTGTGCCAGGTGGGCAGAAGG + Intergenic
1028892534 7:96003872-96003894 GTGTGGACCTAGTTTGCAGAGGG - Intronic
1029082816 7:97988353-97988375 GGGTGGGCCTGGGGTGCAGTGGG - Intronic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029472019 7:100760603-100760625 GAGTGGGCAGGGTGGGCAGCAGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030082733 7:105791370-105791392 GTCAGGGCCTGGTAGGCAGGCGG + Intronic
1030673431 7:112362117-112362139 GTGGTGGCCAGGTGGGCAGGGGG - Intergenic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1031199457 7:118661225-118661247 TTCTGGCCCTGATGGGCAGAGGG + Intergenic
1031966377 7:128031027-128031049 GTGGGGGCGGGGAGGGCAGAGGG + Exonic
1032096178 7:128939413-128939435 GTCTGGACCAGGTGGGCAGCAGG + Intronic
1032307409 7:130748999-130749021 GTGTGGTACTGGTGGGAAAATGG + Intergenic
1033936299 7:146589820-146589842 GTGTGTTCCTGGTTTGCAGAAGG + Intronic
1034275246 7:149821149-149821171 GTGAGGCCCTGGGTGGCAGAAGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1035533811 8:375836-375858 GGGTGGACCTGCTGGACAGAGGG + Intergenic
1035553099 8:544915-544937 GGGCGGGCCTGGTGGGGAGGGGG - Intronic
1035555375 8:563546-563568 ATTTGTGCCAGGTGGGCAGAGGG - Intergenic
1035695287 8:1591321-1591343 ATGTGGGCCAGGTGGGAAGGAGG + Intronic
1035816305 8:2544867-2544889 GTGTGGATCTGCTGGGCATAGGG + Intergenic
1036622574 8:10434570-10434592 GTGAGGGCATGGGGGGCATACGG - Intergenic
1036696933 8:10981114-10981136 GTCTGGGCCTGGTTGACAGTGGG - Intronic
1037666859 8:20977164-20977186 GGCTGGGCTTGGTGAGCAGATGG + Intergenic
1037722523 8:21456953-21456975 AAGTGGGCCTGCTGGGTAGAAGG + Intergenic
1038740254 8:30211053-30211075 GGGTGGGCGTGGAAGGCAGAGGG - Intergenic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1039885422 8:41651440-41651462 GTGGGAGCCTGCTGGGAAGAGGG + Intergenic
1040288483 8:46112330-46112352 GTGTGGCCTTGGTGGGCTGCAGG - Intergenic
1040303496 8:46200260-46200282 GTGTGGCCTGGGTGGGCAGAGGG + Intergenic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1041100996 8:54396347-54396369 GTGTGGGCATTGCGGGGAGAAGG + Intergenic
1046454538 8:114440901-114440923 GGGAGGGGCTGGTGGGCAGAAGG - Intergenic
1048031807 8:130640206-130640228 AGGTGGGGCTGGTGGGCAGGAGG + Intergenic
1049326095 8:142022341-142022363 CTGTGGGCCTGGTGGGGGGTCGG - Intergenic
1049435123 8:142583035-142583057 GTGTGAGGCTGGGGGACAGAAGG + Intergenic
1049643140 8:143724573-143724595 GAATGGGGCTGGTGGGGAGAGGG + Exonic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049752015 8:144289409-144289431 GTGTGGTCCTGGAGGCCACATGG - Intronic
1049757169 8:144315873-144315895 GTGTGGGTCTGGTGAGCCGAGGG - Exonic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050523364 9:6524692-6524714 GTGTGAACCTGGGAGGCAGAGGG - Intergenic
1050541774 9:6676523-6676545 AAGTGAGCCTTGTGGGCAGAGGG - Intergenic
1051221529 9:14853282-14853304 TTAAGGGCCTAGTGGGCAGAGGG + Intronic
1053054063 9:34983552-34983574 GTGGGAGCCTGGTGAGCGGATGG - Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1055330991 9:75183727-75183749 GTGGGGACCCGGTGGGGAGAGGG + Intergenic
1055338123 9:75253617-75253639 GTGGGGGGCTGGTGGGGAGGTGG - Intergenic
1056116634 9:83447395-83447417 GTGTGGCCCTGTTGGGGACAGGG + Intronic
1057117715 9:92541412-92541434 GTGTGGGCGGGGTGGGGAGGGGG - Intronic
1057135199 9:92682509-92682531 GTGGGGGCCAGATGGACAGAAGG + Intergenic
1057721053 9:97532233-97532255 GGATGGGCCTGGTGGGGTGAGGG + Intronic
1057794019 9:98143028-98143050 GTGCTGGCCTAATGGGCAGAAGG - Intronic
1059646655 9:116274835-116274857 GTGTCTGACTGGAGGGCAGAGGG - Intronic
1059698740 9:116754905-116754927 GTGTGGGCCTGGTGGGTTACAGG - Intronic
1059733052 9:117075466-117075488 GTCTGGCAGTGGTGGGCAGATGG + Intronic
1060025499 9:120167459-120167481 GTGTGTGTCTGGTGTGTAGAAGG + Intergenic
1060039390 9:120286721-120286743 GTGAGGGCCTGCCTGGCAGAGGG + Intergenic
1060749636 9:126160616-126160638 ATGTGGGCCTGGGGGACCGAGGG - Intergenic
1060879466 9:127107951-127107973 GAGTGGGCATAGTGGGCAGAGGG + Exonic
1060917383 9:127399083-127399105 GTGAGGGCCTGGTGGCCTGTGGG + Intronic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1061160545 9:128891591-128891613 GTCTGGGCCCTGGGGGCAGAAGG - Intronic
1061244587 9:129394901-129394923 TTGGGGGTCTGCTGGGCAGAGGG - Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061741326 9:132708496-132708518 CTGTGGTCCTGGTGGGAACATGG - Intergenic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061908012 9:133708641-133708663 GAGTGGGCGTTGTGGACAGAGGG + Intronic
1061919050 9:133772197-133772219 GTCTGGGGCTGGTGGCCCGAAGG - Intronic
1061954939 9:133956387-133956409 CTGGGGGCCTGGTGGGGAAAGGG + Intronic
1061972801 9:134053928-134053950 GTGGGTGGTTGGTGGGCAGAAGG - Intronic
1062373532 9:136252187-136252209 GGGTGGGCCGGGTGGGCGGCCGG - Intergenic
1185603853 X:1355778-1355800 GTGTGCTGCAGGTGGGCAGAGGG + Intronic
1189381423 X:40505208-40505230 GTGGGGGCCTGGAGGGCTGTGGG + Intergenic
1190276975 X:48905145-48905167 GTGGGGCTCTGGTGGGCTGAGGG - Exonic
1194921516 X:99772109-99772131 GTGGGGGCCTGGGGGAGAGAGGG - Intergenic
1196913299 X:120506207-120506229 GCGGGGGCCTGGTGGGGAGGTGG - Intergenic
1198925224 X:141783920-141783942 GTGAGGGCCTGGTAGGGAGGTGG - Intergenic
1201077131 Y:10196730-10196752 GCGTGGGCCTGGTGGGCGCCCGG + Intergenic
1202102947 Y:21329812-21329834 GTGTGGGCCTTGTGGGCATGGGG - Intergenic
1202163345 Y:21958584-21958606 ATGGGGGCCTGGTAGGGAGATGG + Intergenic
1202228011 Y:22627784-22627806 ATGGGGGCCTGGTAGGGAGATGG - Intergenic
1202315146 Y:23568392-23568414 ATGGGGGCCTGGTAGGGAGATGG + Intergenic
1202555655 Y:26102201-26102223 ATGGGGGCCTGGTAGGGAGATGG - Intergenic