ID: 1018767474

View in Genome Browser
Species Human (GRCh38)
Location 6:166945343-166945365
Sequence TCTGGGGAGGCGTGATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 190}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018767474_1018767481 5 Left 1018767474 6:166945343-166945365 CCTCTTCATCACGCCTCCCCAGA 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1018767481 6:166945371-166945393 TTCCCTGCAGTGAGTCCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 111
1018767474_1018767485 13 Left 1018767474 6:166945343-166945365 CCTCTTCATCACGCCTCCCCAGA 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1018767485 6:166945379-166945401 AGTGAGTCCCGGAGGAGAGGAGG 0: 1
1: 0
2: 1
3: 15
4: 260
1018767474_1018767488 28 Left 1018767474 6:166945343-166945365 CCTCTTCATCACGCCTCCCCAGA 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1018767488 6:166945394-166945416 AGAGGAGGAGAGTCTGTGTGAGG 0: 1
1: 0
2: 3
3: 82
4: 632
1018767474_1018767484 10 Left 1018767474 6:166945343-166945365 CCTCTTCATCACGCCTCCCCAGA 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1018767484 6:166945376-166945398 TGCAGTGAGTCCCGGAGGAGAGG 0: 1
1: 0
2: 0
3: 26
4: 171
1018767474_1018767480 2 Left 1018767474 6:166945343-166945365 CCTCTTCATCACGCCTCCCCAGA 0: 1
1: 0
2: 0
3: 16
4: 190
Right 1018767480 6:166945368-166945390 CCATTCCCTGCAGTGAGTCCCGG 0: 1
1: 0
2: 1
3: 18
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018767474 Original CRISPR TCTGGGGAGGCGTGATGAAG AGG (reversed) Intronic
900202917 1:1419365-1419387 TCCCGAGAGGCGTGATGCAGGGG + Exonic
901167430 1:7230296-7230318 TCTGGGGAGGAGGGTGGAAGAGG + Intronic
901684022 1:10933821-10933843 TCTGGGGAGGCCTGAGGAGGCGG + Intergenic
901780773 1:11593229-11593251 TCTGAGGAGGCGAGACGGAGGGG + Intergenic
901848976 1:12003295-12003317 TCTGGTGAGGGCTGATGAAATGG - Intronic
902167975 1:14587836-14587858 TCTGGGGAGGTGCGTAGAAGGGG - Intergenic
902253911 1:15175037-15175059 TTTGGGCAGGAGAGATGAAGGGG - Intronic
902902091 1:19524820-19524842 TCTGCGGAGGAGAGATGGAGAGG + Intergenic
903264467 1:22149261-22149283 TCTGGGGTGGGGAGATGGAGGGG - Intergenic
908471428 1:64447632-64447654 GCTGGGAAGGTGGGATGAAGGGG + Intergenic
908743835 1:67356252-67356274 TCTGGGGAATAGTGATGAAGCGG + Intronic
909131091 1:71738392-71738414 TCTGGGGAGGGTGGAGGAAGAGG - Intronic
910455486 1:87393278-87393300 TATGGTGAGGCATGATGAAATGG - Intergenic
910793791 1:91077138-91077160 TAAGGGGAAGCGTGATGAGGAGG - Intergenic
915319293 1:155047465-155047487 TCTGGGCAGGCTTGAAAAAGGGG + Intronic
916550424 1:165844668-165844690 TCTGGGGAGGTGAGAGGGAGAGG + Intronic
918473733 1:184901724-184901746 CCTGGGGAGGCTTGGTGATGTGG - Intronic
920176506 1:204105039-204105061 TGTGGGGAGGAGAGAGGAAGAGG + Intronic
924867842 1:248005023-248005045 GCAGGGGAGGGGTGATAAAGTGG + Intronic
1064263876 10:13808884-13808906 TGTGGGGGGCAGTGATGAAGAGG - Intronic
1065382279 10:25102328-25102350 GCTGGGGTGGCGTGCTGATGAGG + Intergenic
1065570304 10:27064460-27064482 TCGGGGGATGCCTGATTAAGAGG + Intronic
1065798386 10:29328408-29328430 TGTGAGGAGGCGTGAAGAAGTGG - Intergenic
1067767533 10:49098269-49098291 GCAGGTGAGACGTGATGAAGTGG - Intronic
1072370758 10:94764594-94764616 GCTGGAGAGGGGTGAAGAAGGGG + Intronic
1073335501 10:102704898-102704920 AGTGGGGTGGCCTGATGAAGTGG + Intronic
1077264398 11:1641885-1641907 TCTGGGGATGGGTGATCTAGGGG - Intergenic
1078351833 11:10601321-10601343 TCAGGGGAGGCTTCATGGAGAGG + Intronic
1078437981 11:11341103-11341125 TCTGGGGAGTCAAGGTGAAGGGG - Intronic
1079151915 11:17907590-17907612 CCTGGGGAGGAGTGAGGAAAAGG - Intronic
1080458794 11:32436414-32436436 TTTGGGGAGGAGGGGTGAAGGGG + Intergenic
1080815492 11:35752494-35752516 TCTGTGGAGGGGTGAGGGAGGGG - Intronic
1083122462 11:60528356-60528378 TCTGGGAAGGCTTCATAAAGTGG - Intronic
1084635463 11:70389504-70389526 TCTGGGAAGACGGGAGGAAGAGG - Intergenic
1085447715 11:76611679-76611701 TCTGAGCAGGCTTTATGAAGGGG + Intergenic
1090260228 11:125314145-125314167 TCTGGGGACAGTTGATGAAGGGG + Intronic
1091405748 12:208241-208263 TCAGGGGAGGCAAGATGAAGGGG - Intronic
1091446235 12:545690-545712 TGTGGGGAGGAGTGAGGAATGGG + Intronic
1091987261 12:4921007-4921029 TCTGGGGAGGACTGATGCAGTGG - Intronic
1092139294 12:6171821-6171843 TCTGGGGCGGCGAGGGGAAGCGG - Intergenic
1092609668 12:10158580-10158602 TCTGGGGAGGAGTCATCAGGAGG + Exonic
1095418522 12:42001066-42001088 TCTTGGGAGGGGTGAAGAAGTGG - Intergenic
1095430762 12:42132215-42132237 TCTGGGGAGTCTTGATTAACTGG - Intronic
1096716369 12:53493811-53493833 TCTGGGGAAGCCTGGTGAACTGG - Exonic
1096791990 12:54051258-54051280 TGTGGAGAGGGTTGATGAAGAGG - Intronic
1101039017 12:100735604-100735626 ACTAGGGAGGTGGGATGAAGAGG + Intronic
1102851232 12:116246891-116246913 GGTGGGGAGGCGGGAAGAAGAGG + Intronic
1104994541 12:132645287-132645309 TCTGGAGAGGCGAGCTGGAGAGG + Intronic
1105763053 13:23531287-23531309 GCTGGATAGGGGTGATGAAGGGG - Intergenic
1107630475 13:42337622-42337644 TCTTAGCAGGCATGATGAAGGGG - Intergenic
1111885153 13:94011476-94011498 TCTGGGGATGGGTGAGGGAGGGG - Intronic
1113505557 13:110813497-110813519 TCAGTGGAGGCGTGGTGAGGGGG - Intergenic
1115404566 14:32999927-32999949 TGTGGTGAGTTGTGATGAAGTGG + Intronic
1115795491 14:36930806-36930828 TGTGGGGAGGAGTGAGGCAGGGG - Intronic
1117322373 14:54636292-54636314 ACTGGAGAGGAGTGATCAAGAGG + Intronic
1118482369 14:66180150-66180172 TATGGGGAGGAGTGAGGGAGAGG - Intergenic
1124720523 15:32107766-32107788 TCTGGGGAGGGGTGAGAAAGGGG - Intronic
1128644025 15:69361828-69361850 TCAGGGAAGGCTTCATGAAGGGG + Intronic
1128812590 15:70583588-70583610 TCTGGGGAGAGGCGAAGAAGGGG - Intergenic
1131005014 15:88970965-88970987 TGTGGGGAGGTGTGAGGGAGAGG - Intergenic
1132178869 15:99736419-99736441 TATGGGGAAGCGGGATGAAAGGG + Intergenic
1133210857 16:4262739-4262761 TCTGGAGATGAATGATGAAGAGG - Intronic
1137895200 16:52204654-52204676 TCTGGGGAAGCGTGAATAAGAGG + Intergenic
1139906947 16:70372669-70372691 TCTGGCGAGGGCCGATGAAGGGG + Exonic
1140217572 16:73020851-73020873 ATTGGGGGGGCGGGATGAAGTGG - Intronic
1141115080 16:81301507-81301529 CCTGAGGAGGTGTGATGGAGGGG + Intergenic
1141333321 16:83132216-83132238 TCAGGAGAGGGGTGATGGAGAGG - Intronic
1141383802 16:83600819-83600841 TCAGGAGTGGCATGATGAAGCGG + Intronic
1143577870 17:7805160-7805182 TCTGGGGAAGTGGGAAGAAGAGG + Intronic
1145732178 17:27199064-27199086 CCTGGGGTGGTGTGGTGAAGGGG + Intergenic
1146227492 17:31079518-31079540 CCTGGGGTGGTGTGGTGAAGGGG - Intergenic
1146521178 17:33526760-33526782 TCTGGGGAGGGGAGGAGAAGGGG - Intronic
1146932213 17:36785329-36785351 ACTGGGGAGGAGTGAGGCAGAGG - Intergenic
1148880474 17:50722099-50722121 TCTGGGAAGGGGAGTTGAAGGGG - Intronic
1150229784 17:63543728-63543750 GCTGGGGAGGCAGGATGGAGAGG - Intronic
1150505063 17:65690565-65690587 TCTGGAGTGGTGTGAGGAAGAGG + Intronic
1151567569 17:74907677-74907699 GCTGGATAGGGGTGATGAAGGGG + Intergenic
1152143106 17:78550114-78550136 TGTGGGGAGGCGTGGGGAGGAGG + Intronic
1152736285 17:81998938-81998960 TGGGGGGAGGCGTGAGGGAGAGG - Intronic
1155709340 18:28856652-28856674 GCTGGGGATGAGTGATGAACGGG + Intergenic
1158887868 18:61845918-61845940 TGTGGGGGGGCGTGGTGATGAGG + Intronic
1161825336 19:6560196-6560218 TTTGGGGCTGCCTGATGAAGTGG + Intergenic
1162098453 19:8324830-8324852 TCTGGGGAGTGGGGAGGAAGAGG + Exonic
1162153618 19:8662345-8662367 TCAGGGGAGGCTTGCTGAGGAGG + Intergenic
1162406803 19:10479653-10479675 GCTGGGGAGCCTTGAGGAAGGGG - Intergenic
1164789545 19:30964471-30964493 TCTGGGTATGCCTGATGAACTGG + Intergenic
1166222644 19:41375628-41375650 TTTGCGGAGGAGTGCTGAAGGGG - Intronic
1166257365 19:41615947-41615969 CCTGGGGATGTGTGCTGAAGAGG + Intronic
1166519561 19:43471331-43471353 TCTGGGCAGGCCTGAGCAAGAGG - Intergenic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
925989512 2:9242784-9242806 TCTGGGGAAGCATGATGCTGGGG + Intronic
926241365 2:11089400-11089422 GCTGGGAAGGCGTGAAGGAGAGG - Intergenic
926694031 2:15758197-15758219 CCTGGGAAGGAGTGATGATGTGG + Intergenic
927024429 2:19050870-19050892 TCTGCTGAGGCTTCATGAAGTGG + Intergenic
929085621 2:38164725-38164747 GCTGGAGAGGAGAGATGAAGAGG - Intergenic
929660561 2:43780152-43780174 TGTGGGGATGCCTGAAGAAGTGG + Intronic
929793947 2:45044125-45044147 TCTGGAGAGGCCTGAGGAACAGG + Intergenic
930039108 2:47107005-47107027 GCTGGAGAGGGGCGATGAAGGGG - Intronic
938838275 2:135130981-135131003 TCAGGGAAGGCTTCATGAAGAGG + Intronic
942516369 2:176757723-176757745 TCTGGGGAGGGTTTATGCAGAGG - Intergenic
943736044 2:191355755-191355777 CCTGGGGAGGAGTGAGTAAGGGG + Intronic
946984379 2:225255849-225255871 GCTTGGGAGGCGTGAAGAAAAGG + Intergenic
1172072806 20:32270876-32270898 TTTGGGGAGGAGGGCTGAAGAGG - Intergenic
1173328651 20:42055881-42055903 TCTGGGGAGGCCAGCTGATGGGG + Intergenic
1175325999 20:58128990-58129012 AGTGGGGTGGCCTGATGAAGTGG - Intergenic
1176918883 21:14662328-14662350 TCTTGGGAGGCCTGATGGAAAGG - Intergenic
1182142487 22:27973038-27973060 TCTGGGGAGGGGTGGTGAGTGGG + Intergenic
1182624891 22:31638414-31638436 TCTGTGGAGGGGCGAGGAAGGGG + Intronic
1182780373 22:32862708-32862730 TCTTTGGAGGCGAGAGGAAGGGG + Exonic
1183937918 22:41274453-41274475 CCTGGGGAGGCCAGAGGAAGAGG + Intronic
1184107513 22:42376779-42376801 TCTGGTGAGGCGAGAGGTAGCGG + Intergenic
1184800326 22:46754943-46754965 TCTGGTGAGGGGGGATGAGGAGG + Intergenic
949953836 3:9251345-9251367 CCAGGGGAGGCGTGAGGCAGTGG - Intronic
954688473 3:52383364-52383386 TCTGGGGAGGGGTGAAGGAGTGG - Exonic
954879048 3:53821618-53821640 TCTGGGGAGCAGTAAAGAAGGGG + Intronic
955483675 3:59414504-59414526 TCTGGGGAAGGGTGAAGAAGGGG - Intergenic
956714777 3:72069340-72069362 TCTGGAGTGGAGTGATCAAGGGG - Intergenic
958110270 3:89133552-89133574 TCTGGAGATGCTTGAAGAAGTGG + Intronic
958548681 3:95589163-95589185 GCTGGATAGGGGTGATGAAGGGG + Intergenic
959733622 3:109632248-109632270 TCTTGGGAGGAGTGATGAAATGG - Intergenic
959806056 3:110555054-110555076 TCTGGGGAGGATTGGTAAAGAGG + Intergenic
960064067 3:113351978-113352000 GCTGGGTAGGGGTGAAGAAGGGG - Intronic
960687351 3:120307481-120307503 TGTGGAGAGGCGTCATGGAGTGG + Intergenic
967646759 3:191934115-191934137 TTTGGTGAGGTTTGATGAAGTGG - Intergenic
968229287 3:196995900-196995922 TCTAGGGAGGCGGGAGGGAGGGG - Intronic
968884825 4:3322261-3322283 TCTGGGGAGGAGCAAGGAAGGGG + Intronic
969046397 4:4339806-4339828 GCTGGGAAGGCGTGAAGGAGAGG - Intergenic
969436382 4:7191873-7191895 TGTGGGGAGGCGTGGGGAGGGGG - Intergenic
971577518 4:28294837-28294859 GGTGGGGAGGCGGGAGGAAGAGG + Intergenic
974187921 4:58464855-58464877 CCTGGATAGGGGTGATGAAGGGG - Intergenic
975324867 4:73048205-73048227 TCTGGGGAGTATTGATGCAGAGG + Intergenic
981532418 4:145765243-145765265 TCGGAGGAGGCGGGAGGAAGTGG - Intronic
981743353 4:148027113-148027135 TCTGGGGAGTCGGGGAGAAGAGG + Intronic
983834333 4:172370096-172370118 TCTGGATAGGGGTGAAGAAGGGG + Intronic
984540166 4:181028338-181028360 TCTAAGGAAGCATGATGAAGGGG + Intergenic
984918007 4:184740942-184740964 GCTGGATAGGGGTGATGAAGGGG - Intergenic
989349212 5:40465790-40465812 TCTGGAAAGGTGGGATGAAGTGG - Intergenic
989757625 5:44974997-44975019 TCTGGGGAAGTGTGAAGAGGAGG + Intergenic
991613965 5:68476937-68476959 TCTGGGGTGGGGTGGTGGAGGGG - Intergenic
994577909 5:101604390-101604412 TCTGGGGAGGGGTGAAGGACTGG + Intergenic
994784414 5:104137961-104137983 TCTTAGGAGGAGTGAGGAAGTGG - Intergenic
995060342 5:107806388-107806410 TTTGGGGAGGAGGGATGAGGTGG - Intergenic
998340401 5:141412783-141412805 TTAGGGGAGGTGTGATAAAGTGG - Intronic
999371235 5:151056576-151056598 TGTGGGGAGGGATGAGGAAGAGG - Intronic
1001907906 5:175488241-175488263 GCTGGGGCGGAGTGAGGAAGTGG - Intronic
1002926635 6:1609212-1609234 GCTGGGGAGGGGTCATGGAGGGG + Intergenic
1004562199 6:16761315-16761337 TCTGGGGTTGCGTGGGGAAGGGG + Exonic
1007789797 6:44302432-44302454 TCTGGGGAGCCGGGATGTGGCGG - Exonic
1007889714 6:45276475-45276497 TATGGGGAGGGGTGAAGAATTGG - Intronic
1007913694 6:45540763-45540785 CCTGGGGAGACTAGATGAAGGGG - Intronic
1009881557 6:69572705-69572727 TCTGGGGAGGCCTGCTATAGGGG + Intergenic
1011169988 6:84494867-84494889 TCTGGGGAGAAGTTAGGAAGGGG - Intergenic
1013082053 6:106821626-106821648 TCTGGGGAGGCGGGGAGAAGGGG - Intergenic
1013191814 6:107810135-107810157 TCTTGGGAGCTGTGAAGAAGAGG + Intronic
1013428778 6:110037712-110037734 TCTGGGGAGGAGGGAAGGAGGGG + Intergenic
1014131156 6:117835518-117835540 TCTGGGGAGATGTAAAGAAGTGG + Intergenic
1015446566 6:133312248-133312270 TGTGGGGAGGGGTGAGGAAAAGG + Intronic
1018767474 6:166945343-166945365 TCTGGGGAGGCGTGATGAAGAGG - Intronic
1019589056 7:1820064-1820086 TGTGGGGTGGCGTGAAGAGGTGG + Intronic
1019790041 7:3005844-3005866 TCTGGGGAAGCATGATAAAGTGG + Intronic
1022283491 7:28933562-28933584 GCCGGGGAGGAGTGAAGAAGGGG + Intergenic
1022529203 7:31056694-31056716 GCTGGGGAGCAGAGATGAAGGGG - Intronic
1022538892 7:31116960-31116982 TCAGGTGAGGCCTGATCAAGTGG - Intergenic
1023212689 7:37825058-37825080 TCTGTGGAGGGGTGAGGGAGGGG - Intronic
1023270077 7:38453141-38453163 TCTGGGGAGGAGTCAGAAAGGGG - Intronic
1024962916 7:54996331-54996353 TATGGGGAGGGGGGATGCAGGGG - Intergenic
1026023089 7:66725968-66725990 TCAAGGGAGGCCTGATGAATGGG - Intronic
1026464660 7:70643831-70643853 TCTGGGGAGACTTGCTGATGTGG - Intronic
1028773983 7:94657919-94657941 TCTGGGAAGGCGCGCTGCAGGGG - Intronic
1029115150 7:98232922-98232944 TCTGGGCCGGCGTGATGGACAGG + Exonic
1029200263 7:98834710-98834732 CCTGGGGAGGCGAGGGGAAGTGG + Intergenic
1029321340 7:99763226-99763248 TGTGTGGAGGAGTTATGAAGTGG + Intronic
1029667248 7:102003619-102003641 CCTGGGGTGACCTGATGAAGTGG - Intronic
1030681502 7:112439184-112439206 TCTGTGGAGGCGGAATGAAGTGG + Intronic
1030964051 7:115966855-115966877 CCTGAGGAGGAGTGCTGAAGAGG - Intronic
1032387411 7:131534216-131534238 TCTGGGGAGGGGAGAAGATGAGG + Intronic
1032746789 7:134794185-134794207 TCTGGGTAGAGGTGCTGAAGGGG - Intronic
1035798037 8:2377134-2377156 TGTCGGGAGGTGTGATCAAGGGG + Intergenic
1036752631 8:11452996-11453018 TGGGGGCAGCCGTGATGAAGGGG - Intronic
1036953438 8:13162765-13162787 GCTGGGGAGGCGTAAAGACGGGG - Intronic
1038420292 8:27430221-27430243 TCTGGGGAGGGGTGGAGGAGAGG - Intronic
1044744043 8:95355086-95355108 TTTGGGAGGGGGTGATGAAGGGG + Intergenic
1048528856 8:135229217-135229239 TCAGGAGAGGGTTGATGAAGAGG - Intergenic
1048782628 8:138018226-138018248 GCTGGGAAGGCCTCATGAAGGGG - Intergenic
1048998597 8:139809893-139809915 TCTGGGGTGGCGGGAGGAAGGGG - Intronic
1050027607 9:1352012-1352034 TCTGGGGAGTGGTGAAGAATTGG - Intergenic
1050776717 9:9272460-9272482 TCGGGGGATGTGTGATTAAGAGG - Intronic
1051529306 9:18082591-18082613 TCTGGGGAGGCTTGAAGAGGAGG - Intergenic
1053462972 9:38284873-38284895 ACCGGGGAGCCGTGCTGAAGGGG - Intergenic
1055075536 9:72211638-72211660 TCTGGGAAGGCTTTATGAAAGGG + Intronic
1056776781 9:89518769-89518791 TCTGGGGAGGGGGAAGGAAGGGG + Intergenic
1056905928 9:90647852-90647874 TCTGGGGAGGAGGGAAGGAGAGG - Intergenic
1056942089 9:90964704-90964726 TCTGGGAAAGGGAGATGAAGGGG - Intergenic
1059471556 9:114508562-114508584 TCTGGGGAGGCAGGATGTTGGGG - Intergenic
1060756569 9:126218516-126218538 TCTGGGGAGATGAGATGAAATGG + Intergenic
1060893016 9:127200504-127200526 GCTGTGGAGCAGTGATGAAGAGG - Intronic
1061971600 9:134048298-134048320 TCTTGGGAGGCTTGATGGGGCGG + Exonic
1202630903 M:15526-15548 TGTGGGGAGGGGTGTTTAAGGGG - Intergenic
1203745790 Un_GL000218v1:40151-40173 TCTGGGGAGGCGTGGATGAGGGG + Intergenic
1185782530 X:2861806-2861828 CCTGGGGAGGGGAGATGGAGGGG + Intronic
1186595127 X:10972892-10972914 TCTAGGGAAGGGAGATGAAGAGG - Intergenic
1186818674 X:13263920-13263942 TCTGGGGAGGAGTTTTAAAGGGG + Intergenic
1189465981 X:41277772-41277794 TGTGGGGAGGGGGGATGAATAGG - Intergenic
1193740117 X:85206839-85206861 TCTGGGGAGGCAAGAAGAGGAGG + Intergenic
1194981528 X:100445919-100445941 TCTGAGGAGGGTAGATGAAGGGG + Intergenic
1195680605 X:107543321-107543343 GCTGGAGTGGCGTGATGGAGGGG - Intronic
1201430426 Y:13896963-13896985 GCTGGACAGGAGTGATGAAGGGG - Intergenic