ID: 1018768440

View in Genome Browser
Species Human (GRCh38)
Location 6:166952279-166952301
Sequence GTAACAAAAGTGCCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 1, 2: 3, 3: 22, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018768440_1018768449 28 Left 1018768440 6:166952279-166952301 CCAGCTTGTGGCACTTTTGTTAC 0: 1
1: 1
2: 3
3: 22
4: 195
Right 1018768449 6:166952330-166952352 CTCCTGGAGGCAGTCTCTGCAGG 0: 1
1: 0
2: 3
3: 33
4: 238
1018768440_1018768445 12 Left 1018768440 6:166952279-166952301 CCAGCTTGTGGCACTTTTGTTAC 0: 1
1: 1
2: 3
3: 22
4: 195
Right 1018768445 6:166952314-166952336 AAGCTCACACACAGCCCTCCTGG 0: 1
1: 0
2: 3
3: 22
4: 243
1018768440_1018768446 15 Left 1018768440 6:166952279-166952301 CCAGCTTGTGGCACTTTTGTTAC 0: 1
1: 1
2: 3
3: 22
4: 195
Right 1018768446 6:166952317-166952339 CTCACACACAGCCCTCCTGGAGG 0: 1
1: 0
2: 2
3: 38
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018768440 Original CRISPR GTAACAAAAGTGCCACAAGC TGG (reversed) Intronic
902416071 1:16240180-16240202 GTAACAAAAATACCACAGTCTGG + Intergenic
902967155 1:20013878-20013900 ATAAAAAAAATGCCACAAACTGG + Intergenic
903638387 1:24837342-24837364 GTAACAAAATTGACACAAGGAGG + Intronic
903912674 1:26739186-26739208 GTAAGAAAAGTTACAGAAGCTGG - Intronic
907606216 1:55819729-55819751 GTAAGAAAACTGACACCAGCTGG - Intergenic
909099767 1:71336100-71336122 TTAGCAAAAGTGATACAAGCAGG + Intergenic
910730776 1:90393456-90393478 GCAACAAGACAGCCACAAGCAGG - Intergenic
911651751 1:100396800-100396822 AAACCAAAAGTGCCACAAGATGG - Intronic
912259521 1:108096544-108096566 CTATCAAAAGTACCACAAACTGG - Intergenic
913092765 1:115490814-115490836 GTCACAAAACTGCCACAGTCTGG - Intergenic
913261731 1:117004844-117004866 GTAGCAAAAGTACCATAAACTGG + Intronic
913645962 1:120854046-120854068 ATAACAAAAGGGACACAATCAGG - Intergenic
914080677 1:144408837-144408859 ATAACAAAAGGGACACAATCAGG + Intergenic
914175588 1:145277371-145277393 ATAACAAAAGGGACACAATCAGG + Intergenic
914530309 1:148518840-148518862 ATAACAAAAGGGACACAATCAGG + Intergenic
920035829 1:203064813-203064835 GTAACACAAGTGAGAGAAGCAGG - Intronic
920350117 1:205332310-205332332 CTAACAAAAATACCACAAGTAGG - Intergenic
922637457 1:227188883-227188905 TTAACAAATGTGCCACACTCTGG + Intronic
923296369 1:232598534-232598556 ATAACAAAAATAGCACAAGCTGG + Intergenic
1063273806 10:4541529-4541551 TTAGCAAATGTGACACAAGCAGG + Intergenic
1064602288 10:17006126-17006148 GTAACAAAAATGCCACAGATTGG - Intronic
1069922212 10:71822789-71822811 GGAACAAAAGTGCTAAAAACAGG + Intronic
1070032976 10:72694707-72694729 GGAACAAAAGTGGCACAAACTGG - Intronic
1072583227 10:96758600-96758622 GTAGCAGCTGTGCCACAAGCAGG + Intergenic
1074098714 10:110336154-110336176 GTTCCAAAAGCGCGACAAGCAGG - Intergenic
1076076831 10:127540096-127540118 GCCACCAAAGGGCCACAAGCAGG - Intergenic
1076421152 10:130332715-130332737 GTAACAAAAGTGCCCCCCGGTGG + Intergenic
1078443423 11:11386136-11386158 GTAATGAAAGTGCCACCATCTGG - Intronic
1078906380 11:15691899-15691921 GTAACCTAAGTGCCTCCAGCAGG - Intergenic
1078992228 11:16660903-16660925 GTAACAAAAATACCAAAAACTGG - Intronic
1080985923 11:37465632-37465654 TTAACAAAAATGCCCCAAGGAGG + Intergenic
1081202550 11:40235038-40235060 TTAACAAAAGTGCTGCAATCAGG - Intronic
1082758003 11:57096995-57097017 ATAGCAAAAGTACCACAAACTGG - Intergenic
1085503641 11:77043153-77043175 GTAACAAAAATACCATAAACTGG + Intergenic
1088372981 11:109111620-109111642 GTAAAAAAAGTCCCACAAACTGG - Intergenic
1088677469 11:112209044-112209066 GTAACAAATGTACCATTAGCAGG - Intronic
1090521771 11:127487389-127487411 GTAGCAACTGTGCCACATGCTGG - Intergenic
1091772248 12:3159903-3159925 ATAACCAAAGTACCACAGGCTGG - Intronic
1095354204 12:41252301-41252323 GTAACCCAAATGCCACAAACAGG + Intronic
1097510489 12:60532412-60532434 GTAAGAAAAGTGACATTAGCAGG - Intergenic
1097772913 12:63609657-63609679 GTAACAAAAGTACCACAGACAGG - Intronic
1099418645 12:82425005-82425027 GTAACAAAATAACCACAAACTGG - Intronic
1099747933 12:86731615-86731637 GGAAACAAAGTGCCACAAGCTGG - Intronic
1100699497 12:97131132-97131154 GTAACAAAATTTCTCCAAGCTGG + Intergenic
1105269963 13:18863779-18863801 GTAACAAATGTACCACACTCTGG + Intergenic
1106522877 13:30513261-30513283 GTGACTAAAGAGCCAAAAGCTGG - Intronic
1107012761 13:35684444-35684466 CCAACAAAAGTACCATAAGCTGG + Intergenic
1108118545 13:47158216-47158238 GTAACAAAAATGTCATAAACTGG - Intergenic
1109120407 13:58449054-58449076 CTACCTAAAGTGCCTCAAGCAGG + Intergenic
1109657582 13:65413888-65413910 ACAACAAAAGTGACACATGCAGG + Intergenic
1110143606 13:72161940-72161962 GTAACATAAGCTTCACAAGCTGG + Intergenic
1110971193 13:81763889-81763911 GTAACAAAAATGTCACAAACTGG + Intergenic
1111106132 13:83647950-83647972 GAAGCAAAAGTGCTAAAAGCGGG - Intergenic
1112155712 13:96815065-96815087 GTGACAAAAGTACCACTAACTGG + Intronic
1112251258 13:97782606-97782628 ATAACAAAAATACCACAAACTGG - Intergenic
1112364581 13:98745769-98745791 GTAACAAAAGCACCACAAACTGG - Intronic
1113565771 13:111318852-111318874 GTAACAAAAATGCCACAGCCTGG + Intronic
1115508809 14:34119746-34119768 GTAACAAAAATGACTGAAGCAGG + Intronic
1117216016 14:53552441-53552463 ATAACCAAAGTGCCACCATCAGG - Intergenic
1117400696 14:55356174-55356196 ATAAAAACAGTGCCCCAAGCTGG - Intronic
1118510016 14:66461879-66461901 GTAACAAAAGTTCAAAAAGTAGG + Intergenic
1120899730 14:89565361-89565383 ATAACAAAAGTGCCACAAACTGG - Intronic
1122739491 14:103863420-103863442 GTAACAAACGTGCCACTGTCAGG - Intergenic
1126709438 15:51441122-51441144 GTACCAACAGTGCCACAGGGGGG - Intergenic
1127621117 15:60735848-60735870 GCAGCAAAAGTGTCACCAGCAGG + Intronic
1129108614 15:73324771-73324793 GTAACAAAAGTGCCGCAGACTGG - Intronic
1129429254 15:75486550-75486572 GTAACAAAAATACCACATGCAGG - Intronic
1130878297 15:88032863-88032885 GGGACACAACTGCCACAAGCCGG - Exonic
1131167126 15:90150306-90150328 ATAACAAAAGTTCCACAGACTGG + Intergenic
1134570081 16:15283474-15283496 GTAACAAAAGTCACCCATGCAGG - Intergenic
1134732295 16:16472575-16472597 GTAACAAAAGTCACCCATGCAGG + Intergenic
1134935141 16:18239388-18239410 GTAACAAAAGTCACCCATGCAGG - Intergenic
1135460643 16:22639387-22639409 GTAACAAAAATATCACAAACTGG - Intergenic
1137600760 16:49754654-49754676 GTAACACATGTGCACCAAGCCGG + Intronic
1138709572 16:58954944-58954966 ATAACAGAAATGCCACAAGCTGG + Intergenic
1139839633 16:69868099-69868121 GTAACACAAGAGCCAAAAACTGG + Intronic
1139961498 16:70720702-70720724 GAGACACAAGTGCCACAATCAGG + Intronic
1140654398 16:77124592-77124614 GTAACAAAAATACCACAGACTGG - Intergenic
1141002722 16:80323538-80323560 TTAAGAAAAGTGGCACAAGCTGG + Intergenic
1149184885 17:53985933-53985955 GTAACAAAAATACCATAAACTGG + Intergenic
1152083415 17:78202828-78202850 GCAACCAAACTGCCACAAGCTGG + Intronic
1154374046 18:13794143-13794165 GTCACAAAATTCCCACTAGCAGG - Intergenic
1154418079 18:14196198-14196220 GTAACAAATGTACCACACTCTGG - Intergenic
1154438645 18:14366707-14366729 GTTACAAAAATGCCATAAACTGG - Intergenic
1154957530 18:21274025-21274047 ATAACAAAAATACCACAAACTGG + Intronic
1155923890 18:31633440-31633462 ATACCAAAAGTGGTACAAGCTGG + Intronic
1158963891 18:62607348-62607370 GTAATAAAAGTTCCACCAACTGG + Intergenic
1159779342 18:72643184-72643206 GTAACTAAAGTGACATAAGGCGG - Intergenic
1159949997 18:74475944-74475966 ATAACAAAAATACCACAAACTGG - Intergenic
1163387277 19:17007607-17007629 GTAACAGTAGAGCCACAGGCAGG - Intronic
1164763907 19:30748492-30748514 ATAACAAAAGTACCACAGACGGG + Intergenic
1166659218 19:44634987-44635009 GTAACAAAAATGCTACAGACCGG + Intronic
1166966584 19:46532878-46532900 GTAAAAAAACTACCACCAGCCGG - Intronic
1167102550 19:47413056-47413078 GCAACAACAGTGTCACAAACAGG - Intronic
1168055357 19:53861077-53861099 GTAACAAATCTACCACTAGCTGG - Intergenic
925039576 2:720937-720959 GGAATAAAAGTGTCCCAAGCGGG - Intergenic
926823867 2:16882745-16882767 GTAGCAATAGTGCCACATGGTGG - Intergenic
927462377 2:23310248-23310270 ATAACAAAATTTCCACAAGATGG + Intergenic
931135416 2:59394405-59394427 GTTACAAAAGAGAGACAAGCAGG - Intergenic
931611301 2:64104036-64104058 CTAACAAAATTTCCAGAAGCTGG - Intronic
938196398 2:129332702-129332724 GTAACAAAAGTGCCCCAGGATGG - Intergenic
939104331 2:137931837-137931859 GTTACAAAAATACCATAAGCAGG + Intergenic
940586659 2:155660300-155660322 GTAACAAAATTACCACATACTGG - Intergenic
943622974 2:190170019-190170041 GTAACAAAAATACCACAGGTTGG + Intronic
946678543 2:222188856-222188878 ATAACAAAAGTACCACAAACTGG + Intergenic
947076779 2:226353553-226353575 ATGACAAAATTTCCACAAGCTGG - Intergenic
947386017 2:229591193-229591215 ATAACAAAAATGCCACAAACTGG - Intronic
947956396 2:234195820-234195842 TGAAGCAAAGTGCCACAAGCTGG + Intergenic
1171213603 20:23335685-23335707 GTCACCAAAGTGGCACAGGCTGG + Intergenic
1173531913 20:43776286-43776308 GGTAACAAAGTGCCACAAGCGGG + Intergenic
1174468232 20:50733678-50733700 ATAACAAAAATGCCATAAGAAGG - Intronic
1176855219 21:13963079-13963101 GTAACAAATGTACCACACTCTGG + Intergenic
1177142426 21:17371322-17371344 ATAACAAAAATGCCATAAACTGG - Intergenic
1177239083 21:18432779-18432801 CTAAACAAAGTGCCACAAGCTGG - Intronic
1177573206 21:22916657-22916679 ATAACAAAAATACCACAAACTGG + Intergenic
1181486622 22:23235671-23235693 ATAACAAAAATGCCATAAACTGG + Intronic
1182731033 22:32493768-32493790 GAAAAAAAAGTTCCACAATCAGG - Intronic
949397990 3:3635514-3635536 ATAAAAAAAGTACCACAAACTGG + Intergenic
950469486 3:13175634-13175656 ATAACAAAAATGCCATACGCTGG + Intergenic
953247896 3:41212541-41212563 GTAAGAAATGTGCCAAAGGCAGG - Intronic
955164701 3:56499638-56499660 ATAACAAAAGTACCATAGGCTGG - Intergenic
955242806 3:57194300-57194322 ATAACAAAAATGCCACAGACTGG + Intergenic
955414921 3:58683312-58683334 GAACCACAAGTGCCACAAGAAGG + Intergenic
955762345 3:62300599-62300621 GAAACAAGAGTGGCAGAAGCAGG + Intergenic
958846531 3:99271465-99271487 ATAACAAAAATGCCATAAACTGG - Intergenic
958983640 3:100754811-100754833 GTAACATATGTTCCAGAAGCAGG + Intronic
959630409 3:108501065-108501087 GTAACAAAACTACCACAAGCTGG - Intronic
963448057 3:145440155-145440177 GTACCAACAGTGCCACAGGGAGG + Intergenic
963692999 3:148528721-148528743 GTCACAGAAGGGCCAGAAGCTGG - Intergenic
965116131 3:164491369-164491391 GTAACAAAAATACCATAAACTGG - Intergenic
965619301 3:170626368-170626390 GTAACAAAAATACCACAGACTGG - Intronic
966902157 3:184494329-184494351 GGAAAGAAAGGGCCACAAGCAGG - Intronic
967593336 3:191302774-191302796 GTAACAAAAGTGCCATATTCTGG - Intronic
970912017 4:21287811-21287833 ATAACCAAAGTGCAAAAAGCAGG - Intronic
972028939 4:34427908-34427930 ATAACAAAAATGCCATAAACTGG + Intergenic
972053606 4:34771978-34772000 GTAACAAAAGGGACACATGTGGG - Intergenic
975536058 4:75452332-75452354 GTAACAAAAATGCCATAAACTGG + Intergenic
975996673 4:80323127-80323149 GTAACACAAATGTCAGAAGCTGG + Intronic
977677416 4:99763197-99763219 GTAACAAATGTGCCAAAGGATGG - Intergenic
977748202 4:100576931-100576953 GTAACAAAAATGCCGCAGACTGG + Intronic
979804927 4:124959805-124959827 GTAAAGAAAGTGCCACCAGAGGG + Intergenic
981587179 4:146316601-146316623 GTAAAAAAAATACCACAAACTGG - Intronic
983473561 4:168186664-168186686 GTGACAAAAGTACCATAAACTGG - Intronic
984490508 4:180429421-180429443 AAAACAAAAGAGCCACAGGCAGG - Intergenic
985922942 5:2993780-2993802 GTAAAAAAATTGCCACAAACTGG + Intergenic
987122209 5:14778018-14778040 GTAACACAAGTGGCAGAGGCAGG - Intronic
987185330 5:15411644-15411666 ATAACAAAACTACCACAAACAGG + Intergenic
987575897 5:19727585-19727607 CCTACAAAAGTGCCACAGGCTGG - Intronic
987766466 5:22237638-22237660 ATAACAAAAGTACCATAAACTGG - Intronic
987991189 5:25215026-25215048 CTAACTAAATTGCCAAAAGCTGG + Intergenic
988146731 5:27318806-27318828 GTAAAAAAAATACCTCAAGCTGG + Intergenic
988939978 5:36134778-36134800 GTAACAAAACTACTACAAACTGG - Intronic
990848426 5:60172568-60172590 GTAACAATTTTGCCTCAAGCTGG - Intronic
991560413 5:67945470-67945492 GTAACAAAAGTACCACAAACTGG - Intergenic
992095748 5:73361089-73361111 CTAACAAAAATGCCATAAACTGG + Intergenic
995010635 5:107253831-107253853 GTAACATGAGTGGGACAAGCTGG + Intergenic
995933515 5:117480961-117480983 GTAACAAAAATACCATAAACTGG - Intergenic
999385991 5:151154818-151154840 CTCACAAAAGTGACCCAAGCTGG - Intronic
999572576 5:152937355-152937377 ATAACAAAAATACCACAAACCGG - Intergenic
1000352258 5:160361202-160361224 GGAGCTAAAGTGCCACAGGCTGG + Intronic
1000522235 5:162309743-162309765 CTAACTAAAGTGCCACTACCTGG - Intergenic
1000810839 5:165858792-165858814 GTAAACAAAGTGCTACAAACAGG + Intergenic
1002040158 5:176507605-176507627 GTAATAAAAGTGCCCCGGGCTGG + Exonic
1002709691 5:181187780-181187802 GTGACAAAACTACCACAAACTGG - Intergenic
1005809330 6:29504171-29504193 TTAACAAAAATACCATAAGCTGG + Intergenic
1007038061 6:38696389-38696411 GTAACAAAAATTCCATAAACTGG + Intronic
1010587929 6:77677341-77677363 GTAAGAAACGTGGCACTAGCTGG + Intergenic
1010751042 6:79616316-79616338 GTATTAAAAATGCCACATGCAGG - Intergenic
1011512276 6:88114383-88114405 GTAACAAAAATGCCAAAGACTGG + Intergenic
1016023099 6:139256290-139256312 CTAACAAAAGTGCACCAAGTGGG - Intronic
1018768440 6:166952279-166952301 GTAACAAAAGTGCCACAAGCTGG - Intronic
1019093600 6:169561067-169561089 GTCACAAAAATGCCATAAACTGG + Intronic
1022365319 7:29709007-29709029 ATAACAAAAGTACCACAGACAGG + Intergenic
1022932478 7:35133351-35133373 ATAACAAAAGTACCACAGACAGG - Intergenic
1024701592 7:51909592-51909614 GTAACAAAAGTACCATAGACTGG + Intergenic
1025839280 7:65129441-65129463 GAAACATAAGTGCCTGAAGCAGG - Intergenic
1025883788 7:65566524-65566546 GAAACATAAGTGCCTGAAGCAGG + Intergenic
1025889657 7:65636082-65636104 GAAACATAAGTGCCTGAAGCAGG - Intergenic
1026103140 7:67399106-67399128 GTAACAAATGTGTTACAAGCCGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028428552 7:90719787-90719809 GTAACAAAAATCACATAAGCAGG - Intronic
1029828404 7:103226141-103226163 ATAACAAAAGTACCACAGACAGG - Intergenic
1029925410 7:104311076-104311098 GTAATAAAATTGCAACAGGCCGG + Intergenic
1030101042 7:105945591-105945613 GTGAACAAAGTGCCACAAACTGG - Intronic
1030366506 7:108653121-108653143 GTAACGAAAGTACCAAAAGTAGG - Intergenic
1031016150 7:116578788-116578810 ATAACAAAAATATCACAAGCTGG + Intergenic
1031223576 7:119005052-119005074 ATAACAAAAGTACCATAAACTGG - Intergenic
1034967662 7:155401353-155401375 CTGACAGAAATGCCACAAGCTGG - Intergenic
1036996160 8:13659480-13659502 ATAAAAAAAATGCCACAAGGTGG - Intergenic
1038534127 8:28341934-28341956 GTAACAAGAGTCCCCCAAGATGG - Intronic
1039080845 8:33732731-33732753 GTAACAGATGTGCCACCAGCTGG - Intergenic
1039176171 8:34808937-34808959 GTAACAGAAATGCCACATGGAGG - Intergenic
1040047629 8:42979525-42979547 GTAACTGAAAAGCCACAAGCTGG - Intronic
1040280929 8:46042246-46042268 GTCACAAAAGTGGCTCATGCAGG + Intergenic
1042749030 8:72138117-72138139 ATAAACAAAGTGCCACAACCTGG + Intergenic
1042793853 8:72638623-72638645 GAAACAAAAATCACACAAGCCGG + Intronic
1046204185 8:110968628-110968650 TTAATAAAAGTGCGACAAACTGG + Intergenic
1047654382 8:126960859-126960881 GTAACAATGGTGCTACAAACAGG + Intergenic
1048457573 8:134591929-134591951 GCAATCAAAGTGCCACATGCTGG - Intronic
1048603591 8:135944867-135944889 GTAACAAAATAACCATAAGCTGG - Intergenic
1049967122 9:789942-789964 GTAACAAAATTACTACAAACTGG + Intergenic
1052270856 9:26626578-26626600 GTAGCAAAAGCACCAGAAGCAGG + Intergenic
1055218033 9:73891481-73891503 CCAAGAAAAGTCCCACAAGCAGG - Intergenic
1059581999 9:115559877-115559899 GTAACAAATGTACCACTAGATGG + Intergenic
1060041104 9:120302312-120302334 CTAACAAAATTGACACAAGAGGG + Intergenic
1062020744 9:134318263-134318285 GGAACAGAAGTGCCACCAACAGG - Intronic
1185826749 X:3258651-3258673 GTAGCAAAAGTGTCACAGACCGG + Intergenic
1186039168 X:5457362-5457384 GTGACACAAGTCCCACAAGGTGG - Intergenic
1186715411 X:12245936-12245958 GTAACAGAAATGCCACAGACTGG - Intronic
1187489347 X:19736481-19736503 GAAACACAAATGCGACAAGCAGG + Intronic
1187590769 X:20714636-20714658 GCAACAAAAGAGCCACATCCTGG - Intergenic
1187862371 X:23694712-23694734 GTAACACAAAGGCCACAAGATGG + Intergenic
1188703789 X:33300754-33300776 GTAACAAAAATACCATAAACAGG - Intronic
1188871707 X:35381561-35381583 GTTACAAATGTGCCAAAAGGTGG - Intergenic
1192370603 X:70509777-70509799 GTGCCAAAAGTACCACAAGATGG + Intergenic
1192827365 X:74711720-74711742 ATAACAAAAATGCCACAGACTGG + Intergenic
1196002633 X:110803160-110803182 GTAACAAAAGGGACACAATGGGG - Intergenic
1196722297 X:118865708-118865730 GAAACAACAGTGACCCAAGCAGG - Intergenic
1196937018 X:120740310-120740332 GTCAGAAAAGGGCCAGAAGCTGG + Intergenic
1197492004 X:127129172-127129194 GTACCAACACTGCCACAGGCAGG + Intergenic
1200037026 X:153338080-153338102 GTGACAAAAGTGACAAACGCAGG - Intronic
1201685901 Y:16702203-16702225 GTAACAAAAGTACCACAAGCAGG + Intergenic