ID: 1018769365

View in Genome Browser
Species Human (GRCh38)
Location 6:166957474-166957496
Sequence TGCACCCGCGGCCCCGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018769350_1018769365 21 Left 1018769350 6:166957430-166957452 CCAACACCCTGGCCTTCCCAGCC No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769352_1018769365 14 Left 1018769352 6:166957437-166957459 CCTGGCCTTCCCAGCCCTTCAGA No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769358_1018769365 4 Left 1018769358 6:166957447-166957469 CCAGCCCTTCAGAGGCACGGGTT No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769347_1018769365 24 Left 1018769347 6:166957427-166957449 CCCCCAACACCCTGGCCTTCCCA No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769346_1018769365 27 Left 1018769346 6:166957424-166957446 CCTCCCCCAACACCCTGGCCTTC No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769360_1018769365 -1 Left 1018769360 6:166957452-166957474 CCTTCAGAGGCACGGGTTCCCCT No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769349_1018769365 22 Left 1018769349 6:166957429-166957451 CCCAACACCCTGGCCTTCCCAGC No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769359_1018769365 0 Left 1018769359 6:166957451-166957473 CCCTTCAGAGGCACGGGTTCCCC No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769354_1018769365 9 Left 1018769354 6:166957442-166957464 CCTTCCCAGCCCTTCAGAGGCAC No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769348_1018769365 23 Left 1018769348 6:166957428-166957450 CCCCAACACCCTGGCCTTCCCAG No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769357_1018769365 5 Left 1018769357 6:166957446-166957468 CCCAGCCCTTCAGAGGCACGGGT No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data
1018769351_1018769365 15 Left 1018769351 6:166957436-166957458 CCCTGGCCTTCCCAGCCCTTCAG No data
Right 1018769365 6:166957474-166957496 TGCACCCGCGGCCCCGCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018769365 Original CRISPR TGCACCCGCGGCCCCGCCCA CGG Intergenic