ID: 1018770810

View in Genome Browser
Species Human (GRCh38)
Location 6:166970347-166970369
Sequence GTGCCATCTGCTTCTCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018770810_1018770821 16 Left 1018770810 6:166970347-166970369 CCCCTAGGAGAAGCAGATGGCAC No data
Right 1018770821 6:166970386-166970408 TCCCACACTGGGGCAGAGGGAGG No data
1018770810_1018770819 12 Left 1018770810 6:166970347-166970369 CCCCTAGGAGAAGCAGATGGCAC No data
Right 1018770819 6:166970382-166970404 AGGGTCCCACACTGGGGCAGAGG No data
1018770810_1018770813 -8 Left 1018770810 6:166970347-166970369 CCCCTAGGAGAAGCAGATGGCAC No data
Right 1018770813 6:166970362-166970384 GATGGCACCTGTCAAGAGTAAGG No data
1018770810_1018770816 4 Left 1018770810 6:166970347-166970369 CCCCTAGGAGAAGCAGATGGCAC No data
Right 1018770816 6:166970374-166970396 CAAGAGTAAGGGTCCCACACTGG No data
1018770810_1018770814 -7 Left 1018770810 6:166970347-166970369 CCCCTAGGAGAAGCAGATGGCAC No data
Right 1018770814 6:166970363-166970385 ATGGCACCTGTCAAGAGTAAGGG No data
1018770810_1018770820 13 Left 1018770810 6:166970347-166970369 CCCCTAGGAGAAGCAGATGGCAC No data
Right 1018770820 6:166970383-166970405 GGGTCCCACACTGGGGCAGAGGG No data
1018770810_1018770817 5 Left 1018770810 6:166970347-166970369 CCCCTAGGAGAAGCAGATGGCAC No data
Right 1018770817 6:166970375-166970397 AAGAGTAAGGGTCCCACACTGGG No data
1018770810_1018770818 6 Left 1018770810 6:166970347-166970369 CCCCTAGGAGAAGCAGATGGCAC No data
Right 1018770818 6:166970376-166970398 AGAGTAAGGGTCCCACACTGGGG No data
1018770810_1018770824 26 Left 1018770810 6:166970347-166970369 CCCCTAGGAGAAGCAGATGGCAC No data
Right 1018770824 6:166970396-166970418 GGGCAGAGGGAGGAGTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018770810 Original CRISPR GTGCCATCTGCTTCTCCTAG GGG (reversed) Intergenic