ID: 1018770963

View in Genome Browser
Species Human (GRCh38)
Location 6:166971118-166971140
Sequence GCTGGTCAAGAATTCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018770963_1018770968 6 Left 1018770963 6:166971118-166971140 CCTCCTGAGAATTCTTGACCAGC No data
Right 1018770968 6:166971147-166971169 CACGAATGTACAAAGCTTCGGGG No data
1018770963_1018770967 5 Left 1018770963 6:166971118-166971140 CCTCCTGAGAATTCTTGACCAGC No data
Right 1018770967 6:166971146-166971168 TCACGAATGTACAAAGCTTCGGG No data
1018770963_1018770966 4 Left 1018770963 6:166971118-166971140 CCTCCTGAGAATTCTTGACCAGC No data
Right 1018770966 6:166971145-166971167 TTCACGAATGTACAAAGCTTCGG No data
1018770963_1018770969 7 Left 1018770963 6:166971118-166971140 CCTCCTGAGAATTCTTGACCAGC No data
Right 1018770969 6:166971148-166971170 ACGAATGTACAAAGCTTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018770963 Original CRISPR GCTGGTCAAGAATTCTCAGG AGG (reversed) Intergenic
No off target data available for this crispr