ID: 1018770967

View in Genome Browser
Species Human (GRCh38)
Location 6:166971146-166971168
Sequence TCACGAATGTACAAAGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018770960_1018770967 18 Left 1018770960 6:166971105-166971127 CCTGCCCACTCTGCCTCCTGAGA No data
Right 1018770967 6:166971146-166971168 TCACGAATGTACAAAGCTTCGGG No data
1018770964_1018770967 2 Left 1018770964 6:166971121-166971143 CCTGAGAATTCTTGACCAGCAGA No data
Right 1018770967 6:166971146-166971168 TCACGAATGTACAAAGCTTCGGG No data
1018770961_1018770967 14 Left 1018770961 6:166971109-166971131 CCCACTCTGCCTCCTGAGAATTC No data
Right 1018770967 6:166971146-166971168 TCACGAATGTACAAAGCTTCGGG No data
1018770963_1018770967 5 Left 1018770963 6:166971118-166971140 CCTCCTGAGAATTCTTGACCAGC No data
Right 1018770967 6:166971146-166971168 TCACGAATGTACAAAGCTTCGGG No data
1018770962_1018770967 13 Left 1018770962 6:166971110-166971132 CCACTCTGCCTCCTGAGAATTCT No data
Right 1018770967 6:166971146-166971168 TCACGAATGTACAAAGCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018770967 Original CRISPR TCACGAATGTACAAAGCTTC GGG Intergenic