ID: 1018774328

View in Genome Browser
Species Human (GRCh38)
Location 6:166999290-166999312
Sequence CGCCCCGACGCGCAGCGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018774328_1018774334 14 Left 1018774328 6:166999290-166999312 CCAGCGCGCTGCGCGTCGGGGCG 0: 1
1: 0
2: 0
3: 2
4: 103
Right 1018774334 6:166999327-166999349 TCGGCCGCGTAGCCCGCGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 43
1018774328_1018774333 -5 Left 1018774328 6:166999290-166999312 CCAGCGCGCTGCGCGTCGGGGCG 0: 1
1: 0
2: 0
3: 2
4: 103
Right 1018774333 6:166999308-166999330 GGGCGGGGCTTTGGCTGCGTCGG 0: 1
1: 0
2: 1
3: 19
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018774328 Original CRISPR CGCCCCGACGCGCAGCGCGC TGG (reversed) Exonic
901084458 1:6602167-6602189 CGCCGCGCCGCGCCGCGCACTGG - Exonic
902169617 1:14599231-14599253 CGCCCCGGCGCCCAGGGCGGAGG + Intronic
903597134 1:24503159-24503181 CGCCCCGCCCCGCCCCGCGCTGG - Intronic
906168945 1:43707701-43707723 CGCCCCGAAGCGCACTGGGCAGG - Intronic
906627041 1:47333883-47333905 CGCCCCGCCCCGCGCCGCGCCGG + Exonic
906640598 1:47438489-47438511 CGCGGCGACGCGGAGCCCGCTGG + Exonic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
922234536 1:223712937-223712959 CGCCCCAGCGCGCCGCGGGCCGG - Intronic
922518175 1:226223648-226223670 CGCCCCTCCGAGCGGCGCGCTGG + Exonic
1065712626 10:28532726-28532748 CGCCCAGAGGCGCAGCGGGAGGG - Intronic
1073546487 10:104353755-104353777 CGGGCCGACGCGCCGAGCGCGGG + Exonic
1075106355 10:119542550-119542572 CGCCCCGACCCCGAGCCCGCGGG + Intronic
1076792418 10:132784532-132784554 CGCCCCGAGGCGAGGCGGGCCGG + Intergenic
1076977894 11:189444-189466 CGCACAGAGGCGCGGCGCGCGGG + Intronic
1081770791 11:45649665-45649687 CGCCCCCACCCGCACCGCCCGGG + Exonic
1084128655 11:67118093-67118115 CGCCCCGACTCGCCGGGGGCGGG + Intergenic
1085284570 11:75351546-75351568 CGCCCCCACGCGCCCCCCGCCGG + Intronic
1091558422 12:1593472-1593494 CGGCATGACGCGCAGCGCGGCGG - Exonic
1093675993 12:21941368-21941390 CGGCCCCAGGCGCGGCGCGCGGG - Intronic
1101037220 12:100717453-100717475 CGTCCAGGGGCGCAGCGCGCAGG + Intergenic
1104001539 12:124863667-124863689 CCCCGCGACGCCCAGCGCCCCGG + Exonic
1104344513 12:127983612-127983634 CTCCCCGCCGGGCAGCGCTCGGG + Intergenic
1106328686 13:28718828-28718850 CGCCCCGCCGCGCCGCGCTGAGG - Exonic
1106602642 13:31200484-31200506 CGCCCCCACAGGAAGCGCGCAGG + Intronic
1115175686 14:30559205-30559227 TGCCCCGACGTACAGCGGGCCGG + Exonic
1122582187 14:102777745-102777767 GGCCCCGCCGCCCAGGGCGCGGG - Intronic
1122779152 14:104136357-104136379 CGCCGCGCCCCGCACCGCGCAGG - Intergenic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1122930934 14:104932830-104932852 AGCCCTGGCGCGCAGCCCGCGGG + Exonic
1128501399 15:68229671-68229693 CGCCCCGAACCGCCCCGCGCTGG - Exonic
1129322279 15:74782025-74782047 CGCCCCGCCGCGCGCCGGGCAGG + Intergenic
1132743461 16:1427325-1427347 CCCCCCGACGAGAGGCGCGCTGG + Intergenic
1133024196 16:2980571-2980593 CGCCCCGCCGCTCACTGCGCAGG + Intergenic
1134290799 16:12901837-12901859 CCCCTCGGCGCGCGGCGCGCTGG + Exonic
1139504861 16:67393699-67393721 CGCCCCGAACTGCAGAGCGCTGG - Intergenic
1141839686 16:86566899-86566921 AGCCCCGAGGGTCAGCGCGCCGG - Intergenic
1141959177 16:87392781-87392803 CACCCCGCCGCGGAGGGCGCGGG - Intronic
1142465316 17:133909-133931 CGCACAGAGGCGCGGCGCGCGGG + Intergenic
1142876155 17:2853235-2853257 CGCCCCGGCTCGCAGCTCCCGGG - Intronic
1160835479 19:1122754-1122776 CTCCCCAGCGGGCAGCGCGCGGG - Exonic
1160869124 19:1269091-1269113 CGCCCCGCCCCGCCGCGCGCTGG + Intronic
1168104679 19:54159516-54159538 CGCTCCGGGGCCCAGCGCGCAGG - Intronic
926095631 2:10079645-10079667 CACCCCTAGGCGGAGCGCGCCGG - Intronic
929857563 2:45650098-45650120 CGCCCCGGGGCCCAGCGCTCCGG + Intergenic
931868266 2:66434187-66434209 CGCCGCGCCGCGCCGCGCCCTGG + Intronic
932288159 2:70553931-70553953 CGCCCCGCAGCGCTGCCCGCCGG + Exonic
933858476 2:86441567-86441589 CGCCCCGGCGCCCAGCTCCCCGG - Intronic
935971616 2:108534725-108534747 AGCCCCGACCCCCAGCGCTCGGG + Intronic
943185306 2:184598888-184598910 CGCCCACAGCCGCAGCGCGCCGG - Exonic
948953973 2:241272826-241272848 CGCTCCGAGGCGCGGCGCCCGGG + Exonic
1173939125 20:46894947-46894969 CGCCCCGACGCGGTGCGGGCGGG - Exonic
1174353202 20:49982599-49982621 CGCCCCCTGGCGCTGCGCGCCGG - Intergenic
1176029922 20:63006938-63006960 AGCCGCGACGCGCAGGGGGCGGG + Exonic
1176178700 20:63739950-63739972 CGCCTCGGCCCGCAGCGCACTGG - Exonic
1176181577 20:63752044-63752066 CACCCCGAGGCGCAGGGTGCAGG - Intronic
1176220982 20:63969380-63969402 GGCTCCGCCGCGCTGCGCGCAGG + Intronic
1178832703 21:36069970-36069992 CGCCCGGCCGCTGAGCGCGCAGG - Exonic
1178872105 21:36385553-36385575 CGCCCCAACGCGCGCCGCTCCGG - Intronic
1180109751 21:45642513-45642535 CGCCCCGAGGACCAGGGCGCTGG - Intergenic
1181256859 22:21568185-21568207 CGCCCTGGGCCGCAGCGCGCCGG + Intronic
1183482721 22:38073966-38073988 CACCCCGAGGCCCAGCGAGCGGG - Intronic
1184164707 22:42720567-42720589 CGCCCCGAAGTGGAGCGCGGCGG - Intronic
1185424168 22:50755365-50755387 CTCCCGGTCGCGCACCGCGCTGG + Intergenic
952418923 3:33114130-33114152 GCGCCCGGCGCGCAGCGCGCAGG - Exonic
954838925 3:53494615-53494637 CGCCGCGCCGCGCCGCACGCCGG - Intergenic
960914383 3:122681259-122681281 CGCCTGGAAGCGCAGGGCGCCGG - Intronic
968879888 4:3293299-3293321 CGCCCCGCCCCGCCCCGCGCCGG - Intronic
969357772 4:6640645-6640667 GGCCGCAACGCGCAGAGCGCTGG + Exonic
969378959 4:6782334-6782356 CTCTCCGACGCCCAGCACGCTGG + Intronic
974016847 4:56656005-56656027 CTCCCTGCCCCGCAGCGCGCAGG - Exonic
980990500 4:139735077-139735099 CGCCCAGACGCGCGGGGCGGGGG - Intronic
987374031 5:17217878-17217900 CGCCCCGCCCCGCAGCCCCCGGG + Intronic
990308651 5:54517951-54517973 CGCCCGGGCGCGCAGCGCCATGG - Exonic
992444091 5:76819151-76819173 AGCCCCGACGCCGGGCGCGCGGG - Exonic
996378977 5:122845309-122845331 CGCGCCAACGCGCTGGGCGCGGG - Intronic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1007367788 6:41406967-41406989 CGCCGCGCCGCGCCGCGCTCTGG - Intergenic
1007532367 6:42554276-42554298 CGGCCCGCCGCGCAGAGTGCGGG - Intergenic
1010001733 6:70956054-70956076 CGCGGCGGCGCGCAGCGAGCTGG - Exonic
1013225932 6:108119434-108119456 CGCCCGGGCGCGCATCGGGCAGG + Intronic
1014035830 6:116765653-116765675 CGCCCCGGCCTGCCGCGCGCTGG + Exonic
1016982294 6:149864285-149864307 CGCCCCGGCCTGCGGCGCGCTGG + Intergenic
1018774328 6:166999290-166999312 CGCCCCGACGCGCAGCGCGCTGG - Exonic
1022207757 7:28180234-28180256 CGCCCCGAGGTGCCGCGGGCGGG - Intronic
1022817119 7:33924419-33924441 CGTCCGGAGCCGCAGCGCGCAGG - Intronic
1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG + Intronic
1029926985 7:104328712-104328734 CCCCCCGCCTCTCAGCGCGCAGG - Exonic
1032391166 7:131556344-131556366 CGACACGATGCGCTGCGCGCTGG - Exonic
1033299817 7:140176342-140176364 CGCCCCGCCCCGCCGCGCCCGGG - Intronic
1034977666 7:155457767-155457789 CGCCCCGGCCCGCAGCGGGGCGG + Intergenic
1035476291 7:159145727-159145749 CGCCCCGCCGCGCCCCACGCGGG + Intergenic
1036454186 8:8893370-8893392 CCCCCCGAGGCGCCGCGCGGCGG - Exonic
1037807561 8:22066981-22067003 CGCAGCGCCGCGCAGCGCCCCGG + Intronic
1040038819 8:42896703-42896725 CGCCTCGACACGCAGCGAACTGG + Exonic
1042236009 8:66613518-66613540 CGCCGAGAGGCGCACCGCGCGGG + Intronic
1044430630 8:92102930-92102952 CGCCCCGTCGCCCCGCGGGCCGG - Intronic
1044832188 8:96261568-96261590 CGTCCCGCCGCGCCGCACGCCGG + Exonic
1045231415 8:100310186-100310208 CGCCATGACGCACAGCACGCGGG - Intronic
1051898027 9:22008961-22008983 CCCCCAGACGCGCAGCGGCCCGG + Exonic
1054775636 9:69121635-69121657 CGCCGCGCCGCCCAGCGCCCCGG + Intronic
1060700560 9:125746819-125746841 GGCCCCGGCGGGCCGCGCGCCGG - Intergenic
1060881851 9:127122956-127122978 CGCTCCGCCTCGCAGCACGCGGG - Intronic
1061128186 9:128689705-128689727 CGCCCCGGCCCGCAGGCCGCCGG + Intronic
1062435475 9:136545013-136545035 CTCCCCGCCGCACAGCGAGCGGG - Intronic
1185791257 X:2929309-2929331 CGCCCGGGCGCGGAGTGCGCAGG - Exonic
1189731858 X:44029212-44029234 CGCCCCTACGCCCAGGCCGCGGG - Intergenic