ID: 1018776999

View in Genome Browser
Species Human (GRCh38)
Location 6:167026712-167026734
Sequence CTGAATGAGCAGCAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 433}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018776999_1018777002 -8 Left 1018776999 6:167026712-167026734 CCTTCCTGCTGCTGCTCATTCAG 0: 1
1: 0
2: 4
3: 32
4: 433
Right 1018777002 6:167026727-167026749 TCATTCAGCAGGTGTTTGAATGG 0: 1
1: 0
2: 1
3: 17
4: 220
1018776999_1018777003 8 Left 1018776999 6:167026712-167026734 CCTTCCTGCTGCTGCTCATTCAG 0: 1
1: 0
2: 4
3: 32
4: 433
Right 1018777003 6:167026743-167026765 TGAATGGCTTTTATGTGTTCAGG 0: 1
1: 0
2: 1
3: 29
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018776999 Original CRISPR CTGAATGAGCAGCAGCAGGA AGG (reversed) Intronic
900977407 1:6026156-6026178 CTGGATGAGCAGCGGCCAGATGG - Intronic
901527914 1:9835685-9835707 CTGAAGGGGCAGCAGGAGGGAGG + Intergenic
901625802 1:10624367-10624389 CTGAATCAGCAGCTCCTGGACGG - Exonic
902472163 1:16656731-16656753 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
902486640 1:16750715-16750737 CTGGAGGAGGAGCAGCAGGGAGG + Intronic
903575795 1:24339019-24339041 ATGAAGCAGCAGCAGCAGTATGG - Intronic
903829975 1:26168953-26168975 CTCAATGAACTGGAGCAGGAAGG + Intergenic
904444704 1:30559632-30559654 CTGAGTGAGATGGAGCAGGATGG + Intergenic
904909280 1:33921951-33921973 AGGAAAGAGAAGCAGCAGGAAGG + Intronic
905294680 1:36946754-36946776 GTGTATGAGCAGCACCATGATGG - Intronic
906613578 1:47219967-47219989 CTCAATGACCAGGAGGAGGAGGG - Exonic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
907321691 1:53606640-53606662 CTGAAAGAGGAGCAGCAGGAAGG + Intronic
907391815 1:54163141-54163163 CGGAATGACCAGCAGCCTGAGGG - Intronic
907573841 1:55507782-55507804 GTAAAGGAGAAGCAGCAGGAGGG - Intergenic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
909165227 1:72214262-72214284 CTGAATGGGCAAAAGCTGGAAGG + Intronic
909562980 1:77025781-77025803 CTGGAGGAGGGGCAGCAGGAGGG - Intronic
909708147 1:78611615-78611637 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
910447058 1:87309540-87309562 CTGAATGCACAGCAGCAGGCAGG - Intergenic
911768839 1:101713310-101713332 ATGAATTAGAAGCAGGAGGAAGG - Intergenic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
915142359 1:153775505-153775527 CAGCAGGGGCAGCAGCAGGAGGG - Exonic
915511670 1:156390123-156390145 CTGGATGAGGAGCTGCAGAAAGG - Intergenic
916030802 1:160876056-160876078 CTGAATGAGCACCTGCAGATGGG + Intergenic
916217704 1:162411649-162411671 CAGACTCTGCAGCAGCAGGAGGG - Intronic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
917495088 1:175533315-175533337 CTCAGTGTGCAGCAGAAGGAAGG + Intronic
918515571 1:185359067-185359089 GGGAGTAAGCAGCAGCAGGATGG - Intergenic
918859139 1:189799016-189799038 ATGGAAGAGCAGCAGCAAGATGG + Intergenic
919718253 1:200803035-200803057 ATCTAAGAGCAGCAGCAGGAAGG - Intronic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
922241013 1:223755561-223755583 CTGAATGAGCCCCACCAGGAAGG - Exonic
922305608 1:224341264-224341286 CTGCGCGAGCTGCAGCAGGAAGG - Intergenic
922399257 1:225235139-225235161 CTGAATGGGCAAAAGCTGGAGGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922803774 1:228375565-228375587 CTGAATGAACAGGACCAGGGAGG + Intronic
922844056 1:228668972-228668994 CTGAATGAAAAGGGGCAGGATGG + Intergenic
923550498 1:234959382-234959404 CTGGATGAGCAGTAGCAAGGAGG - Intergenic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1062981205 10:1724520-1724542 TTGTGTGCGCAGCAGCAGGAGGG + Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063639117 10:7813558-7813580 CTGAAAGAGCAGATGCAAGATGG + Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064228825 10:13511523-13511545 CTGACTCAGCAGCAGCTAGACGG + Intronic
1064307702 10:14182831-14182853 CTGAGTGAGAACTAGCAGGAGGG + Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1065970681 10:30803829-30803851 CTGAGTTAGAGGCAGCAGGAGGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066690264 10:38019550-38019572 CTGAAACTGCGGCAGCAGGAAGG + Intronic
1067077272 10:43195275-43195297 CTGAATGGGCTCCAGCAGTATGG + Exonic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1067894683 10:50166077-50166099 CTGAAGGAGGAGCAACTGGAGGG - Intergenic
1067954158 10:50774185-50774207 CTGAAGGAGGAGCAACTGGAGGG + Intronic
1068020235 10:51572825-51572847 TTGAAAGAGAAGCAGCAGCATGG - Intronic
1068302948 10:55169465-55169487 CTAAATGTGCAACAGCAGAAAGG + Intronic
1068861912 10:61855984-61856006 CTGCATGAAGAGCAGCAAGAAGG + Intergenic
1069828088 10:71266412-71266434 CTGAGTGAGCAGCAGAGGAAGGG - Intronic
1070234079 10:74605338-74605360 CTGAATGGGCAAAAGCTGGAAGG - Intronic
1071814843 10:89222168-89222190 CTCAATGAGAAGCAGATGGAGGG + Intronic
1072387833 10:94950236-94950258 TTGAATGGGCAGAAGCTGGAAGG + Intronic
1073219598 10:101859338-101859360 CTGAGACAGCAGCTGCAGGAAGG + Intronic
1074789575 10:116873280-116873302 TTCTATTAGCAGCAGCAGGAAGG + Intronic
1074833016 10:117263160-117263182 CTGTGTCAGCACCAGCAGGAGGG + Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075600595 10:123765793-123765815 CTGGAGGAGGAGCAGCAGGGTGG - Intronic
1075862987 10:125693575-125693597 TTGAATGAGAAGCAGTGGGAAGG + Intergenic
1075924134 10:126236574-126236596 CTGAATGAGCACTCACAGGAAGG + Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1078627126 11:12967948-12967970 CTGAAGGAGAAAGAGCAGGAAGG - Intergenic
1079108010 11:17586312-17586334 CTCACTGAGCAGCAGCAGGATGG + Intronic
1079409840 11:20177081-20177103 CTGAATGAGCAGCTCCAGCCTGG + Intergenic
1079738294 11:24025366-24025388 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
1080304055 11:30817806-30817828 ATGAGTGAGAAGCAGAAGGAAGG + Intergenic
1080787333 11:35487477-35487499 CTGGAAGTGCAGCAGCAGAAGGG - Intronic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1081444736 11:43119623-43119645 CTGAAGCAGCAGCATCAAGAAGG + Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081920770 11:46773918-46773940 CTGAATGGGCAAAAGCTGGAAGG + Intronic
1083622528 11:64056218-64056240 CTGGAGGAGCTGCAGCAGGTGGG + Intronic
1083779851 11:64912150-64912172 CTGAACCAGCAGCTGCAGGCAGG - Exonic
1084711168 11:70844568-70844590 CTCAAAGGGCTGCAGCAGGAGGG - Intronic
1086064223 11:82730017-82730039 CAGAAGGTGAAGCAGCAGGAAGG + Exonic
1088598140 11:111455071-111455093 CAGAGGGAGCAGCAGCAGGTGGG + Exonic
1088792870 11:113241651-113241673 CTGAATGTGCAGGAGTAGAAGGG + Intronic
1090418222 11:126555617-126555639 CTGCTTGAGGAGCAGCAGGAAGG + Intronic
1090647515 11:128777681-128777703 CTGAGTGTGCAGGAGCGGGAGGG - Intronic
1090885710 11:130874432-130874454 CTGAAACTGCAGCAGCAGGAAGG + Intergenic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1091041446 11:132284979-132285001 AAGCATGAGCAGGAGCAGGAAGG + Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091889776 12:4044374-4044396 CTGAATGATCAGGAGGAGGCTGG - Intergenic
1091933692 12:4417667-4417689 CGGGAGGAGGAGCAGCAGGAGGG - Intergenic
1092286259 12:7130653-7130675 CAGAAGGGGCAGCAGCAGGAGGG - Exonic
1092325218 12:7523980-7524002 CTGAATGGGCAAAAGCTGGAAGG - Intergenic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1093942958 12:25074668-25074690 CAGAATTATCAGCAGCATGAAGG + Intronic
1094629175 12:32156038-32156060 CTCAATGGGCAGCAACAGCAGGG - Intronic
1096445147 12:51683097-51683119 ATGTATGAGAGGCAGCAGGAGGG - Intronic
1096777402 12:53972753-53972775 CTCTGTGAGCAGCACCAGGAGGG - Intergenic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1097229193 12:57498813-57498835 CTGAAGGAGCAGCTGAGGGAGGG + Intronic
1097365369 12:58706430-58706452 CTGAATGGGCAAAAACAGGAAGG - Intronic
1097770905 12:63583715-63583737 CTGAAGGTGCATCAGCAGCAAGG + Intronic
1098197464 12:68017131-68017153 CAGAAGGAACAGCAGCAGGTAGG + Intergenic
1098467080 12:70799856-70799878 CAGAGAGAGCAGCAGCAGGTAGG + Intronic
1098579103 12:72077853-72077875 CAGAATGAGCACTAGCAGGAAGG - Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102777971 12:115537276-115537298 TTGAAAGAGCAGCAGCAGCAAGG + Intergenic
1104349081 12:128029290-128029312 ACGAATGAGGAGCAGCAGAATGG - Intergenic
1104409486 12:128546406-128546428 CTGAATGAGAAGCAGAGCGAGGG + Intronic
1105246132 13:18652021-18652043 CTTAATTAGCACCAGCAGCATGG + Intergenic
1105581645 13:21703373-21703395 CTTAATGCACATCAGCAGGAGGG - Exonic
1106485250 13:30166731-30166753 CTGGATGAGCAGGAGTAGGCGGG - Intergenic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1108522575 13:51259316-51259338 GTGGATGAGCAGCCGCTGGAGGG - Intronic
1110387793 13:74934893-74934915 CTGAATGGGCAAAAACAGGAAGG + Intergenic
1111948679 13:94692319-94692341 GTGTTTGAGCAGCAGCAAGAAGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113378831 13:109785653-109785675 GAGAACGAGCAGGAGCAGGAGGG - Exonic
1113463927 13:110501007-110501029 CAGTATGAGCTGCAGCAAGAAGG + Intronic
1113481834 13:110626864-110626886 CTGAATGAGAAACTGCAGCAGGG + Intronic
1113949330 13:114062795-114062817 CTGAGGGAGCAACAGCAGAACGG + Intronic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1116588645 14:46742522-46742544 CTGAATGTGCAGCTTGAGGATGG + Intergenic
1117967638 14:61221807-61221829 CTGACAAAGCTGCAGCAGGAAGG - Intronic
1118249583 14:64146776-64146798 CTGAATGGGCAGCAGCCACAAGG - Intronic
1118280117 14:64420643-64420665 CTGAGTGGGAAGCAGCTGGAGGG - Intronic
1119090264 14:71774259-71774281 CTGCATGAGCACTAGGAGGATGG + Intergenic
1119459244 14:74785430-74785452 CTGAGTGAGCAAAAGCAGCAGGG - Intronic
1119945983 14:78694882-78694904 AGGAATGAGCAGCAGTGGGAGGG + Intronic
1120180371 14:81336875-81336897 ATGAGTGATCAGCAGGAGGAGGG + Intronic
1121281234 14:92700207-92700229 CTGCATTCGCAGCAACAGGATGG + Intergenic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1121936038 14:98019832-98019854 CTTGAGGAGAAGCAGCAGGATGG - Intergenic
1122981917 14:105195927-105195949 CTGAACCAGCTGGAGCAGGATGG - Intergenic
1123831801 15:24146894-24146916 CTGAATGGGTAGCAGTAGAAGGG - Intergenic
1123836779 15:24202910-24202932 CTGAATGGGTAGCAGTAGAAGGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1126389835 15:48135413-48135435 CTGAATGAGCATCAGAAGTTTGG - Exonic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1128529175 15:68432182-68432204 CTGAATGAGCCGCAGCTGTCAGG - Intergenic
1128818854 15:70634325-70634347 CTTAAGGAGAAGCAGCTGGAGGG + Intergenic
1129391963 15:75225174-75225196 CAGAGGGAGCAGCAGCATGAGGG + Intergenic
1129395751 15:75245090-75245112 CTGGATCATCAGCAGCAGCACGG + Intergenic
1129472413 15:75762988-75763010 CAGAGGGAGCAGCAGCATGAGGG - Intergenic
1131027790 15:89159431-89159453 GTGAATGTGCTGCAGCAGCATGG + Intronic
1132683198 16:1152279-1152301 CTGAAGGAGCAGCTGCTGGCAGG + Intergenic
1132726882 16:1342762-1342784 ATGGCTGAGCAGCAGCAGGTGGG - Exonic
1132769131 16:1551318-1551340 CCGAAGGATCAGCAGCAGGAGGG + Intronic
1133059095 16:3162862-3162884 ATGAATGGGCAACAGCAGAATGG - Intergenic
1133093343 16:3422889-3422911 TTGAATGAGGAAAAGCAGGATGG - Intronic
1134053795 16:11156551-11156573 CTGAAACGGCAGCAGGAGGAAGG - Intronic
1134235599 16:12463074-12463096 CAGCATGGGCAGCAGCAGCAGGG - Intronic
1134301669 16:12997114-12997136 CTGAATGAAAAGAAGCATGAGGG - Intronic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1136067162 16:27766998-27767020 CTGAGTGAGAAGCAGCAGGGGGG + Intronic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138653919 16:58479350-58479372 CTCAGTGAGCACCAGGAGGATGG - Intronic
1139061552 16:63259232-63259254 CTGAATGAGCAAAAGCTGAAAGG - Intergenic
1139241673 16:65398336-65398358 GTGAATGAGTAGCTACAGGAAGG - Intergenic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1142143054 16:88481109-88481131 CTTAATGAGCAGGAGACGGATGG + Intronic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1142765262 17:2060846-2060868 CAGGAAGAGGAGCAGCAGGAAGG + Exonic
1142943509 17:3403941-3403963 GTGAATGATCAGCACCAGCATGG + Intergenic
1143325058 17:6093284-6093306 CTGAATGAGATAAAGCAGGAAGG - Intronic
1143659553 17:8316096-8316118 CTGGAAGGGCAGTAGCAGGAAGG - Exonic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144078154 17:11737421-11737443 TTGAATGAGCCTCAGCAGGTCGG - Intronic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144705287 17:17363910-17363932 CAGAGTGAGCACCTGCAGGATGG + Intergenic
1146533113 17:33627489-33627511 TGGCAGGAGCAGCAGCAGGAGGG - Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1148047677 17:44753934-44753956 CTAGAAGAGCAGCAGAAGGAAGG + Intergenic
1148189622 17:45669424-45669446 CTGCATGAGCATCAGCTGGCTGG - Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149180012 17:53924670-53924692 CTGAAAGAAGAGCAGCAGGCTGG - Intergenic
1150972273 17:70042371-70042393 CTGAATGAGCAGTTGAAGTAGGG - Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1152353122 17:79794303-79794325 CCGAATGAGCTGGGGCAGGAGGG - Exonic
1152466832 17:80471287-80471309 CTGAGGGACCAGCTGCAGGAGGG - Intronic
1152566689 17:81103479-81103501 CTGAAGTGGAAGCAGCAGGAAGG - Intronic
1152743804 17:82030221-82030243 CTGGAAGAGCTGCAGCAGGTAGG + Exonic
1154442785 18:14407645-14407667 CTTAATTAGCACCAGCAGCATGG - Intergenic
1155597042 18:27500185-27500207 CTGAATATGCAACAGCAGCAAGG + Intergenic
1156484576 18:37456727-37456749 CAGATTGAGCATCCGCAGGAGGG - Intronic
1157068507 18:44379144-44379166 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
1157328949 18:46689211-46689233 CTGAATGAGTGGCAGAAGGCAGG - Intronic
1157479040 18:48041016-48041038 CTCAATGAGCAACGGCACGATGG - Exonic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1159120533 18:64163997-64164019 CTACATCAGCAGTAGCAGGAAGG + Intergenic
1159935011 18:74358046-74358068 GTGACTGGGCAGTAGCAGGAAGG - Exonic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1162098414 19:8324660-8324682 CTGGGTGAGCAGCAGCCGCACGG + Exonic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1163722134 19:18903340-18903362 CCCATTGAGCAGCAGCAGGGTGG + Exonic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1165015870 19:32879614-32879636 GGGAATGGGGAGCAGCAGGACGG + Intronic
1165204273 19:34170749-34170771 ATGAATGAACAGCAGGATGAAGG - Intergenic
1165431646 19:35776332-35776354 ATGAATGAGCGGGAGCAGCATGG - Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1168000565 19:53442620-53442642 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1168005060 19:53480104-53480126 AGGAAGGAGCAGCAGCAGGGTGG - Intronic
1202704559 1_KI270713v1_random:13525-13547 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
925177527 2:1795825-1795847 CTGCATCAGCAGCAGCCTGATGG + Intronic
925587323 2:5476423-5476445 CCGAATCATCAGCAGCAGCATGG - Intergenic
925763224 2:7206753-7206775 CTGACTTTGCAGCAGCTGGATGG - Intergenic
926166483 2:10524433-10524455 GTGGAGGAGCAGCAGCTGGAGGG + Intergenic
926221070 2:10935712-10935734 GTGAATGAACAGCAGGAGGCCGG - Intergenic
926226499 2:10970867-10970889 CTGAATGAGACCCTGCAGGAGGG + Intergenic
926417043 2:12659847-12659869 CAGAATGAGCAGAAACAGGTTGG - Intergenic
926514901 2:13831077-13831099 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
929570872 2:43022159-43022181 CTGAATGAGGAGCAGAGGAAGGG - Intergenic
929666572 2:43838502-43838524 CTGGGGGAGCAGCAGCAGCAAGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930165468 2:48199487-48199509 CTGGATGAGCACCAGCATCAGGG - Intergenic
930362162 2:50394845-50394867 CTGGAGGAGCATGAGCAGGAAGG - Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
931464554 2:62475121-62475143 CTCCAGGAGAAGCAGCAGGAAGG + Intergenic
932515712 2:72346286-72346308 TTTATTTAGCAGCAGCAGGAAGG - Intronic
934708673 2:96501796-96501818 CAGAAAGAGCAGGACCAGGAGGG - Intronic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
936062759 2:109306420-109306442 CTGCAAGGGCAGCAGCAGGATGG - Intronic
936669890 2:114644948-114644970 ATGACTGAACAGCAGAAGGAGGG - Intronic
938193374 2:129302512-129302534 CTCACTGAGCATTAGCAGGACGG + Intergenic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
940822298 2:158369765-158369787 CTGAATGGGCAAAAGCTGGAAGG - Intronic
941662418 2:168208854-168208876 CTGACTGAGTTGCTGCAGGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941999571 2:171632463-171632485 CAGAATGAGAATCAGAAGGAAGG + Intergenic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
943699957 2:190978914-190978936 CTCACTGAACCGCAGCAGGAAGG + Exonic
944335463 2:198528533-198528555 CTGAATGACCTGCAGCAGACTGG + Intronic
944455585 2:199890645-199890667 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
944524721 2:200607076-200607098 CTGAATGGGCAAAAGCTGGAAGG - Intronic
944606810 2:201359082-201359104 CTGACTGAGGAGCAGCAGTGGGG + Intergenic
946237354 2:218332365-218332387 CAGAAAGAGAAGAAGCAGGATGG + Intronic
946434144 2:219640886-219640908 CACCGTGAGCAGCAGCAGGAAGG - Exonic
946921265 2:224584692-224584714 CTGAAGGAGCAGCTCCCGGACGG + Intronic
947239768 2:227981757-227981779 ATGCATGAGGAGCAGAAGGATGG - Exonic
947633095 2:231666276-231666298 CTGCATGTGCAGCAGGAGGGAGG - Intergenic
948190081 2:236051640-236051662 CCCAAAGAGCAGAAGCAGGAAGG + Intronic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948266197 2:236636875-236636897 CTTAGTGAGGAGCAGCCGGAAGG + Intergenic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1168960132 20:1863443-1863465 CTGAATGACCAGCATAGGGAAGG + Intergenic
1168969976 20:1924377-1924399 CTGAATCAGCAGCTGGAAGAAGG - Intronic
1172027039 20:31955579-31955601 TTGTGTGAGCAGCAGCAGGGAGG - Intergenic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1172836328 20:37875527-37875549 TGGAATCAGCAGCAGCAAGATGG + Intergenic
1172957213 20:38769539-38769561 CTGAACGAGGAGCCGCGGGAGGG + Intronic
1173186138 20:40841813-40841835 CTGAAGGAGCAGCACTAGGCAGG - Intergenic
1173295353 20:41750415-41750437 CTGTATGGGCTGCAGCTGGACGG + Intergenic
1173313716 20:41924594-41924616 CTGAATTAGCAGCAGCATGTAGG + Intergenic
1173639698 20:44592294-44592316 CTGAAGGAGCACCAGCAGAATGG - Intronic
1173935585 20:46859449-46859471 CTGAGTGTGCAGCTTCAGGAGGG - Intergenic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1174263238 20:49312768-49312790 CTGAATGACAAGCAGCATCATGG + Intergenic
1174556043 20:51396466-51396488 CTGAGAAAGCAGCAACAGGAAGG + Intronic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175783568 20:61698420-61698442 CTGAATGGGAAGCACCCGGACGG - Intronic
1176453301 21:6883548-6883570 CTTAATTAGCACCAGCAGCATGG + Intergenic
1176669620 21:9720833-9720855 AGGAATGAGCAGGAGCAGAATGG + Intergenic
1176831475 21:13748596-13748618 CTTAATTAGCACCAGCAGCATGG + Intergenic
1179412311 21:41171241-41171263 CTGAATGAGCAACAGAATGAAGG + Intronic
1179635021 21:42703327-42703349 GTGAGTGAGCACCAGCAGGAGGG + Intronic
1179658324 21:42859488-42859510 CTGAGTGAGCGGCCGCAGGCGGG + Intronic
1180195737 21:46192403-46192425 CTGCTTGAGCAGGAGCAGCAGGG - Intronic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1181308148 22:21928519-21928541 CTGAAGGAGCAGCAGGTGGGTGG + Intronic
1181759881 22:25050995-25051017 GTGAAAGAGGAGGAGCAGGACGG - Intronic
1182101895 22:27663265-27663287 AGGAATGAGGAGCGGCAGGAAGG - Intergenic
1182237224 22:28884590-28884612 CTGGACAAGCAGCAGCAGGCAGG + Intronic
1182522418 22:30891999-30892021 GTGAAGAAGCAGCAGCTGGAGGG + Intronic
1183002621 22:34874371-34874393 CTGAATGAGCAGCAGGATTCAGG + Intergenic
1183415159 22:37677424-37677446 ATGAATGACCAGACGCAGGAAGG - Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184513024 22:44944056-44944078 CCGAAGGTGGAGCAGCAGGAGGG - Intronic
1184742060 22:46434321-46434343 CTGAGTCAGCAGCAGCAGCTGGG + Intronic
1184803677 22:46777711-46777733 TTGAGTGAGAAGCAGCAAGAAGG + Intronic
1184912368 22:47544801-47544823 CTGATTGGACAGCAGCAGGCTGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185142829 22:49112868-49112890 CTGAAGGGGCCGCAGCAGGGTGG + Intergenic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
954330128 3:49885412-49885434 CAGAGCGAGCAGCAGCTGGATGG + Intergenic
956932704 3:74063645-74063667 TTGTTTGGGCAGCAGCAGGAGGG - Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
961083928 3:124050299-124050321 CTGAATGAGTACCATCAGCAGGG + Intergenic
961347427 3:126273287-126273309 CTCAAAGAGCAGCTGCAGAAAGG + Intergenic
964951226 3:162296036-162296058 CTGAAAGAGCAGCATGAGAAAGG + Intergenic
965731322 3:171774979-171775001 CTGAAGGAGCAGCTGCAGCTGGG + Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966268696 3:178079152-178079174 CTGAATGAACAGGATTAGGATGG + Intergenic
966412113 3:179654481-179654503 ATGTGTGAGAAGCAGCAGGAGGG + Intronic
966734311 3:183176772-183176794 CTGAATGGGCATCAGCAGGCTGG - Intergenic
967171938 3:186828588-186828610 CTGAATGGGCATCATCAGGCTGG + Intergenic
967654892 3:192035293-192035315 CTGAAAGAGAAGCAGAATGAAGG + Intergenic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
969714819 4:8863382-8863404 CTGGGTGAGCAGCACCAGGGAGG - Intronic
970004700 4:11399568-11399590 CAGGATGAGCAGCAGCCGGATGG + Exonic
971019946 4:22524274-22524296 TTGACTGAGAAGCTGCAGGATGG + Intergenic
971265573 4:25093758-25093780 CTGCATGTGGAGCACCAGGAGGG - Intergenic
973721127 4:53724631-53724653 CTGAAGGAGCCCTAGCAGGAAGG - Intronic
974899346 4:67978224-67978246 CTGAATGGGCAAAAGCTGGAAGG - Intergenic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
976315993 4:83659724-83659746 CTTAATAAGCAAGAGCAGGAAGG + Intergenic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
981752492 4:148105924-148105946 CTGAATGGGCAAAAGCTGGAAGG + Intronic
981914845 4:150022749-150022771 CTCAATCTGCAGTAGCAGGAAGG - Intergenic
981938524 4:150257987-150258009 CTTATGAAGCAGCAGCAGGAAGG + Intergenic
982650431 4:158081662-158081684 CTGCAGGAGCAGCTGCAGGCAGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
984003060 4:174274147-174274169 CTGAAAGAGCAGCTGCAGCTGGG - Intronic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
985405155 4:189630632-189630654 AGGAATGAGCAGGAGCAGAATGG - Intergenic
985573984 5:665297-665319 CTGCAAGAGGAGCAGGAGGAAGG + Intronic
986396093 5:7332252-7332274 CAAAATTGGCAGCAGCAGGATGG + Intergenic
990719614 5:58679171-58679193 TTGAAGGAGAAGCAGCAGGGTGG + Intronic
992634669 5:78716074-78716096 CTGTCTGAGCAGCACCATGATGG - Intronic
992970525 5:82052106-82052128 CAGAATGATCAACTGCAGGAAGG - Intronic
993692987 5:91025639-91025661 CTGAATGTGCAGCAGAAGGGTGG - Intronic
996469259 5:123840909-123840931 CTGAATGAGCAAAAGTTGGAAGG + Intergenic
997745758 5:136298778-136298800 TTGAAGGGGCAGAAGCAGGATGG - Intronic
997924713 5:138019017-138019039 CTTGATGAGCTGCAGCAGGGAGG - Exonic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1000687071 5:164264109-164264131 CTGAATGCCCAGCAGAAGGTAGG - Intergenic
1000907460 5:166979592-166979614 CAGAATGAGGAGCAACAGAAAGG - Intergenic
1002695714 5:181087013-181087035 CTCAAAGAGCAGCAGCTGGCGGG - Intergenic
1002941529 6:1720804-1720826 CAGAAGGAGCAGGAGCGGGAGGG + Intronic
1003472565 6:6450846-6450868 CTGAGTTATCAGCAGAAGGATGG + Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1006905329 6:37529462-37529484 CTGAGACAGCGGCAGCAGGAAGG - Intergenic
1006966397 6:37990073-37990095 CTGAATCAGCATCATCTGGAGGG + Intronic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007582870 6:42969594-42969616 CTGGAGGAGCAGCAGCCAGATGG - Intronic
1009043109 6:58205288-58205310 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009218946 6:60959537-60959559 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009629051 6:66170840-66170862 CTGAATGAGCAAAAGCTGGAAGG + Intergenic
1009676304 6:66826830-66826852 GTGAATAAGCAGAAGCAGCAGGG - Intergenic
1010985136 6:82414855-82414877 CTGGAGGAGCAGCAGTGGGAGGG + Intergenic
1011657530 6:89565297-89565319 CCCAGTGAGCAGGAGCAGGATGG + Intronic
1012404186 6:98876052-98876074 GTCAATGAGTAGCAGCAGCAAGG - Intronic
1012951509 6:105522724-105522746 CTGACTGAGTAGCAGAAAGAGGG + Intergenic
1014058087 6:117039914-117039936 CTGAATGGGCAAAAGCTGGAAGG - Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1015159492 6:130136564-130136586 ATGAATGGGCAGCAGGAGCAGGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015868445 6:137751804-137751826 AAGAATAAGCAGCAGCAGAAGGG + Intergenic
1016868637 6:148795227-148795249 CTGAATGAGAAGGGACAGGAGGG + Intronic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1017182337 6:151565141-151565163 CTGAAGCAGCAGCTGCAGGTGGG + Intronic
1017209401 6:151838219-151838241 CCGAAGGAGCAGAAGAAGGATGG + Intronic
1017708926 6:157148481-157148503 CTGCACCAGCAGCAACAGGAAGG + Intronic
1018333877 6:162763297-162763319 CTCCTTGAGAAGCAGCAGGAAGG + Intronic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019073938 6:169371608-169371630 CAGAGCGAGCAGCACCAGGAAGG + Intergenic
1021040288 7:15853679-15853701 ATTAAAGAGCAGCAGCAGTAAGG + Intergenic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1023255056 7:38304982-38305004 TTGGATGAGAAGCTGCAGGAAGG - Intergenic
1023661231 7:42473037-42473059 GTCCATGAGCGGCAGCAGGAAGG - Intergenic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1024154130 7:46603099-46603121 CTGAATGGGCATCTGCAGGGAGG + Intergenic
1024248997 7:47492257-47492279 CTGTTTGGCCAGCAGCAGGAAGG + Intronic
1024417083 7:49119978-49120000 GTGCATCAGCAGCAGCATGAGGG + Intergenic
1024916654 7:54507735-54507757 ATGAGAGAGAAGCAGCAGGAAGG + Intergenic
1025733291 7:64125304-64125326 CTGAATGAGCATCATCAGTCTGG - Intronic
1026381057 7:69799790-69799812 CTCAAGGAACAGCACCAGGAGGG - Intronic
1026401827 7:70021682-70021704 CAGATTGAGGAGCAGCAGGAAGG - Intronic
1026636036 7:72082475-72082497 CTCAAAGAGCAGGTGCAGGAGGG - Intronic
1027335115 7:77142113-77142135 CTGAATGGGCAAAAGCTGGAAGG + Intronic
1027591042 7:80119669-80119691 TTGAATCAGAAGTAGCAGGAGGG - Intergenic
1029580472 7:101433739-101433761 CTGTCAGAGCAGCAACAGGAGGG + Intronic
1029885066 7:103860573-103860595 GTGAAATAGCAGCAGCAGTATGG + Intronic
1030853828 7:114525747-114525769 ATTAAGGAGCAGCAGCAGGTAGG - Intronic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1031811737 7:126377857-126377879 CTGAATGGGCATGTGCAGGAAGG + Intergenic
1032613808 7:133444213-133444235 CTGAATGAGAGCCAGCAGAATGG + Intronic
1032973717 7:137196528-137196550 CCGAAGGACCAGGAGCAGGACGG - Intergenic
1033443697 7:141402408-141402430 AGGAATGAGCAGCAGGGGGAGGG - Intronic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1035995967 8:4547237-4547259 CAGACTCAGCAGCCGCAGGAAGG - Intronic
1037292520 8:17366433-17366455 ATGAATCAGCATCAGCAGAATGG + Intronic
1038670015 8:29575346-29575368 CTGAAACACCAGCAGGAGGAAGG - Intergenic
1039256927 8:35729528-35729550 CTGAAAGAGCGGCAGCAGAGAGG + Intronic
1039811779 8:41055320-41055342 CTGAAAGAGCAGGGTCAGGAGGG + Intergenic
1040576263 8:48654109-48654131 CAGAGTGAGGGGCAGCAGGATGG + Intergenic
1041143599 8:54847712-54847734 CTTAATGAATAGCAGCAGGTTGG - Intergenic
1042021164 8:64372279-64372301 CTGAAAGAGAAACTGCAGGAAGG + Intergenic
1045368754 8:101500202-101500224 CTTAATGAGCAGCAACAGGCTGG + Intronic
1046809695 8:118519026-118519048 CTTAAGTATCAGCAGCAGGAGGG + Intronic
1047618087 8:126579891-126579913 CTCAATGAGATGCAGCAGAAAGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1049256984 8:141619418-141619440 CTGTATGAGAAGCAGCTGGGAGG - Intergenic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049528059 8:143139178-143139200 CTGAATTAGCGACTGCAGGAGGG - Intergenic
1049803933 8:144530458-144530480 CTGGATGAGCACCCGCAGGAAGG + Exonic
1050265520 9:3885407-3885429 CTGCATGAGGAGCAGCACCATGG - Intronic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051499285 9:17759335-17759357 GTGAAACAGCATCAGCAGGAAGG - Intronic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1053098302 9:35348176-35348198 CTGAATCAGTAGCAGTAGCAGGG + Intronic
1056802995 9:89707057-89707079 CCGAAAGAGGAGAAGCAGGAGGG - Intergenic
1056856332 9:90132704-90132726 CAGAATCAGCAGCGGAAGGAAGG - Intergenic
1058896017 9:109401335-109401357 CTGGATTGGCAGCACCAGGATGG - Intronic
1059692539 9:116699363-116699385 CAGAATGAGCACCACCTGGAGGG + Exonic
1059799727 9:117738039-117738061 CTGACAGAGCAGCAGAGGGAAGG + Intergenic
1060070035 9:120538514-120538536 TTCCATGAGCACCAGCAGGATGG + Intronic
1060987387 9:127827598-127827620 ATGAAACAGCAGCAGCAGAAGGG + Intronic
1061431739 9:130535651-130535673 CTGAGTGAGCAGCTGGAGGCGGG + Intergenic
1062026829 9:134344414-134344436 CTGACTCAGCAGCTGCAGGGTGG + Intronic
1062104524 9:134746286-134746308 CGGAAAGAGCTGGAGCAGGAGGG - Intronic
1062344843 9:136109883-136109905 CTGAATCAGCTGCACCCGGACGG + Intergenic
1062402102 9:136377270-136377292 CTGGCTGGGCAGCATCAGGATGG + Intronic
1062544806 9:137056911-137056933 CTTAATGAGCACCTGCAGAAAGG - Intergenic
1062577975 9:137217388-137217410 CGGAAAGAGGAGCGGCAGGAGGG + Intergenic
1062729815 9:138102643-138102665 CAGGAGGAGCGGCAGCAGGAGGG - Intronic
1203515880 Un_GL000213v1:967-989 CTTAATTAGCACCAGCAGCATGG - Intergenic
1203656245 Un_KI270753v1:34-56 AGGAATGAGCAGGAGCAGAATGG - Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1191044427 X:56120650-56120672 GTGAGTGAGTGGCAGCAGGAAGG - Intergenic
1191969994 X:66802938-66802960 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
1193065943 X:77260143-77260165 CTGAATGGGCAAAAGCTGGAAGG + Intergenic
1194641710 X:96410644-96410666 CTGAATGTGCAGCTTCAGGTGGG + Intergenic
1195394208 X:104393605-104393627 GTGCTTGAGGAGCAGCAGGAAGG + Intergenic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1200037063 X:153338462-153338484 CTGCATGAGCTGCTACAGGAAGG + Intronic
1200081154 X:153577082-153577104 CTGAGTGAACCGCTGCAGGATGG - Intronic
1200406479 Y:2817036-2817058 ATGAATGAGCAAAAGCTGGAAGG - Intergenic