ID: 1018777023

View in Genome Browser
Species Human (GRCh38)
Location 6:167026983-167027005
Sequence ACTTCTGTGCAGAAGCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018777019_1018777023 23 Left 1018777019 6:167026937-167026959 CCTTTGTCCAGTCTTGGCATTCA 0: 1
1: 1
2: 0
3: 13
4: 192
Right 1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG 0: 1
1: 0
2: 1
3: 33
4: 218
1018777022_1018777023 16 Left 1018777022 6:167026944-167026966 CCAGTCTTGGCATTCAGGGAAGA 0: 1
1: 0
2: 1
3: 21
4: 184
Right 1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG 0: 1
1: 0
2: 1
3: 33
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018777023 Original CRISPR ACTTCTGTGCAGAAGCTTCA TGG Intronic
900341460 1:2191278-2191300 GCTACTGAGCAGAAGCGTCACGG - Intronic
900783293 1:4631700-4631722 ACCTCTGAGCAGAGGCTTGATGG - Intergenic
900862709 1:5244578-5244600 AGCTCTGTGCACAAACTTCAGGG + Intergenic
900939462 1:5788847-5788869 ACCTCAGTGCAGGATCTTCATGG - Intergenic
903678342 1:25080723-25080745 ACTTTTGGGCAGAAGCTTTAGGG - Intergenic
903728107 1:25467318-25467340 ACTGCTGTCCTGAAGTTTCAAGG + Intronic
904420859 1:30390320-30390342 ACTCCTGAGCTGAAGCTTCAAGG + Intergenic
904486419 1:30827501-30827523 ACTGATGTGCAGAAGATTCTAGG - Intergenic
905000160 1:34661677-34661699 ACATCTGAACAGAAGCTTCTAGG + Intergenic
905372780 1:37494071-37494093 ACATTAGTGCAGAAGCTTCCAGG - Exonic
907522848 1:55036156-55036178 ACTTTTGTGTGGAAGCTGCATGG + Intergenic
908050332 1:60222655-60222677 ACATCTGTGCATGTGCTTCAGGG + Intergenic
908743824 1:67356204-67356226 ATCTCTCTGCAGCAGCTTCAGGG - Intronic
910556860 1:88543961-88543983 ACTTCTAGACAGAAGCTTGAGGG - Intergenic
910745241 1:90566948-90566970 AGTTCATTGCAGATGCTTCAAGG - Intergenic
912621782 1:111167974-111167996 ACTTCAGTTCAGGAGTTTCAAGG - Intronic
917955800 1:180096740-180096762 ACCTTTGTCCAGAAGCTACAAGG + Intronic
919297206 1:195718135-195718157 ACTTCTGGGTAGAAGTTTCTAGG - Intergenic
921533644 1:216317058-216317080 TTTGCTGTGCAGAAGCTCCAAGG + Intronic
921843410 1:219853557-219853579 AATTCTGTGAAGAAAGTTCATGG - Intronic
1063740269 10:8810004-8810026 AGTTCTGAGGAGAAGCTGCAGGG + Intergenic
1067805485 10:49389541-49389563 ATTTCTGTTTAGAAGCTACACGG - Intronic
1069580851 10:69565688-69565710 ACTTCTGAGCATAAGTTTTAAGG + Intergenic
1071548412 10:86546512-86546534 ACTTCTGAGCAGAAGGTTTAAGG - Intergenic
1072229029 10:93398036-93398058 ACTTCTGTGTAACATCTTCAGGG + Intronic
1074050580 10:109877737-109877759 GCTCCTGTGCAGAAGCAGCAAGG + Intronic
1074922095 10:118024926-118024948 CCATCTCTGCAGAGGCTTCAAGG + Intronic
1075683350 10:124347824-124347846 GCGTCTGTGCAGAAGCAGCACGG - Intergenic
1076161990 10:128251480-128251502 ACTTCTGAGCTGAGGCTACAAGG - Intergenic
1077798812 11:5518066-5518088 ATTCCAGTGCAGAAGCTGCAGGG - Intronic
1082649623 11:55773225-55773247 GCTTCTGTTCAGAAGGTTGATGG + Intergenic
1083990791 11:66244545-66244567 AGTTCTGTGCAAAAACTTCTGGG - Exonic
1084059263 11:66659207-66659229 TCTTCTGTGCTCAAGATTCAGGG + Intronic
1090866318 11:130703935-130703957 ACTTCTGGGCAGAAGAGTCTTGG + Intronic
1094487891 12:30939326-30939348 ACCACTGTGCTGAAGCTGCAGGG + Intronic
1096539817 12:52300681-52300703 ACTTCTGTGCAGGAGTTTCAAGG + Intronic
1097969118 12:65613388-65613410 ACTTTTGTGCAGAGGTTTCTGGG - Intergenic
1099921786 12:88967185-88967207 AGTTCTGGGGAGAAGCTTTAAGG + Intergenic
1101688675 12:107052645-107052667 ACATCTGTGCAGAAACCTGAAGG + Intronic
1102710286 12:114919993-114920015 ACTTTTGTTAATAAGCTTCATGG + Intergenic
1103009943 12:117450317-117450339 ACCTCTGTGCACAGGCTTCAGGG - Intronic
1103186255 12:118960426-118960448 ACTGCTGTGCAAAAGATTCAAGG + Intergenic
1104067094 12:125315089-125315111 CCTTCTGTGCATAAGCTGCCTGG - Intronic
1104158628 12:126157273-126157295 ACTCATGTGCTGAAGCTACATGG - Intergenic
1104389567 12:128380073-128380095 ACTTGTGAGCAGAAGCTTTGAGG - Intronic
1104828247 12:131730366-131730388 TCTGCTTTGCAGCAGCTTCAGGG - Intronic
1106897396 13:34318880-34318902 TCTTCAATGCAGAAACTTCATGG + Intergenic
1107354526 13:39552746-39552768 CCTTCACTTCAGAAGCTTCATGG - Intronic
1107451959 13:40517780-40517802 ACCTCTATGGAGAGGCTTCAGGG - Intergenic
1108888922 13:55228579-55228601 ACTTCTCTGAAGAAGTTTCCTGG + Intergenic
1109948011 13:69463375-69463397 ACTTCTGTGCAGAGGATGTATGG + Intergenic
1111001131 13:82183967-82183989 TCTTCTGTGCAGAAGCTTTTTGG - Intergenic
1111983170 13:95038486-95038508 ATTTCTGAGGAGGAGCTTCAGGG + Intronic
1113020081 13:105875298-105875320 ACTTCTGTCCAGAAGGTACCTGG - Intergenic
1113183180 13:107655626-107655648 AGTTCTGTGAAGAATCATCATGG - Intronic
1113680834 13:112243753-112243775 ACTTCTGTGGAGAAGGAGCAGGG + Intergenic
1113784815 13:112996907-112996929 AGATCTGTGCAGGAGTTTCATGG - Intronic
1117180545 14:53186970-53186992 ACTTCTGTTCTGAGGGTTCAAGG + Intergenic
1117436931 14:55724436-55724458 ACTTCTGTGCAGAAGTTTTCAGG - Intergenic
1117629550 14:57676077-57676099 ACTACTATGCAGAATCTACAAGG + Intronic
1122487287 14:102089620-102089642 ACTTGTGTGCAGATGACTCACGG + Intronic
1122505338 14:102228260-102228282 TCTTCTGAGCATAGGCTTCAAGG - Intronic
1123146224 14:106133185-106133207 ACTCCTCTGCAGCAGCTCCAGGG + Intergenic
1123186464 14:106522234-106522256 ACTCCTCTGCAGCAGCTCCAGGG + Intergenic
1202943079 14_KI270726v1_random:1267-1289 ACTCCTCTGCAGCAGCTCCAGGG - Intergenic
1124025456 15:25961488-25961510 ACTGCTGGGCAGAGGCTTTAAGG - Intergenic
1124220716 15:27847628-27847650 ACATCTGTGCAGAACCTGCCAGG - Intronic
1125360235 15:38857267-38857289 AATTCTGTGGAGATGCTTCCTGG + Intergenic
1125753249 15:42044956-42044978 ATTTCTGAGCAGAACCTACACGG + Intronic
1126937204 15:53724086-53724108 ACTTCTATGCAGAACCTAAAAGG + Intronic
1129627671 15:77220300-77220322 ACTTTTACTCAGAAGCTTCAAGG + Intronic
1132084559 15:98896836-98896858 ACTTCTGCTCAGATGCTCCAAGG + Exonic
1134230617 16:12426372-12426394 ACTTCTGAGCAGAAGCTTTCAGG - Intronic
1135783908 16:25330767-25330789 ATTTCTAAGCAGAAGCTTTAAGG + Intergenic
1136562001 16:31044799-31044821 ACTTCTGCATAGAAGCTTTAGGG + Intergenic
1136737590 16:32477567-32477589 AGGTCTGTGCAGAAGCTTGGAGG - Intergenic
1138125627 16:54436169-54436191 CCTTCTGTGGAGAAGCTATAAGG - Intergenic
1139217753 16:65145708-65145730 ACTTCTGAGCAGAAGCAGCCTGG - Intergenic
1203015481 16_KI270728v1_random:352010-352032 AGGTCTGTGCAGAAGCTTGGAGG + Intergenic
1203033816 16_KI270728v1_random:625168-625190 AGGTCTGTGCAGAAGCTTGGAGG + Intergenic
1144123435 17:12179005-12179027 ATTTGTGAGCAGAAGCTACACGG + Intergenic
1146585951 17:34081644-34081666 AATTCTGTGCAGAGCCTTAAGGG - Intronic
1149248916 17:54745315-54745337 AGTTCTCAGCTGAAGCTTCAAGG - Intergenic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1151957571 17:77388055-77388077 ACTTCTGCCCAGAAGCCTCACGG - Intronic
1153605739 18:6829518-6829540 AGATCTGTGCAAATGCTTCAAGG - Intronic
1155373895 18:25135339-25135361 ATTTCTGGGCAGTAGCCTCAAGG - Intronic
1156006683 18:32450823-32450845 ACTTCTGAACAGAAGCTTTAAGG + Intronic
1156549896 18:38004454-38004476 CCTTTTGGACAGAAGCTTCAGGG + Intergenic
1156685099 18:39635219-39635241 ACTTCTGGGTGGAAGTTTCAAGG + Intergenic
1158628642 18:59093039-59093061 AGTTGTGTGCAGAAGCCCCAGGG - Intergenic
1159001051 18:62975407-62975429 ACTGCTGGGCAGAAGCTTGGTGG + Exonic
1159984236 18:74822792-74822814 ACTTCTGTGAAGAAACTCAATGG + Intronic
1163621732 19:18364874-18364896 ACTTCTGGCCTGGAGCTTCAGGG + Exonic
1163723557 19:18909994-18910016 ACTCCTGTGCAGAGGCAGCATGG - Intronic
1166720640 19:44994051-44994073 ACTGCTGTGCTGAGGCCTCAGGG - Intergenic
1167143364 19:47667413-47667435 ACTGGTTTGCAGAAGCCTCACGG + Intronic
926293583 2:11550935-11550957 AGTGCAGGGCAGAAGCTTCAAGG - Intronic
926774431 2:16407859-16407881 AATTCTGTGCAGATGCTGAAAGG - Intergenic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
928189948 2:29154880-29154902 ACTTCTGCCCAGAGGCTACATGG + Intronic
929847634 2:45546825-45546847 ACTACTGTGCTGCAGCTTCAAGG + Exonic
930810250 2:55532985-55533007 ACATCTGAATAGAAGCTTCAAGG + Intronic
931250129 2:60522781-60522803 AATTCTGTGCAGAACCGTCCAGG - Intronic
931707299 2:64957846-64957868 ACTTCTGAGAAGAAGATTCAGGG + Intergenic
932305019 2:70695882-70695904 ACTTGGGTGCAGTAGATTCAGGG - Intronic
932574294 2:72954386-72954408 AGTTCTCTGCTGAGGCTTCAGGG + Intronic
935431732 2:102983288-102983310 ATCTATGTGGAGAAGCTTCAAGG + Intergenic
936923828 2:117716264-117716286 ACTCCTGGGCAGAAGTTTCAAGG - Intergenic
937313393 2:120915851-120915873 GCTTCTGAGCAGCAGCTGCAAGG - Intronic
938711041 2:133976453-133976475 ACTGCTGTGCAGGAGCCTCTTGG - Intergenic
938900645 2:135796349-135796371 GCTTCTGAGCAGAAGCGTCAGGG - Intronic
939615402 2:144356540-144356562 ACTTCCCAGCAGAAGCTTTAAGG + Intergenic
939913565 2:148012614-148012636 ATTGCTGTGCAGAAGCTTTTTGG - Intronic
940659677 2:156531409-156531431 ACTTCTCTCCAGAAGATGCAAGG + Intronic
942478367 2:176353777-176353799 ACATCTGTGCAGAAGCTTTTTGG + Intergenic
943138887 2:183952492-183952514 ACATCTAAGCAGAAGCTTTAAGG - Intergenic
944377421 2:199063078-199063100 ACTTCTGTGAAGAATGTTCTTGG - Intergenic
946404686 2:219486104-219486126 TTTTCTGTGCAGAAGGGTCAGGG - Intronic
948681376 2:239637284-239637306 ACTTGTGGGCACCAGCTTCAGGG - Intergenic
1168874066 20:1158402-1158424 ACTGAAGTGCAGAAGTTTCATGG + Intronic
1169556253 20:6753516-6753538 TCTTCTGAGCAGAAGCTTAGTGG + Intergenic
1170260030 20:14394483-14394505 TATTCTGTGCAAAAGCTTCTAGG - Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1173186590 20:40844895-40844917 CCTTCTCTGCAGAAGTTTCTGGG - Intergenic
1173742674 20:45412461-45412483 CCTTCTGTGCAAAAGCCTCTAGG + Intergenic
1175232976 20:57486559-57486581 TTTTCTGTGCAGAAACTTCTTGG - Intergenic
1175674627 20:60936101-60936123 ATTTGTGTGGACAAGCTTCAGGG - Intergenic
1176664787 21:9675619-9675641 ATTTCTGTGCTGCAGCTTCTGGG + Intergenic
1176882573 21:14215807-14215829 ACTTCATTGCAGAAGCTCCCAGG - Intergenic
1178241879 21:30912177-30912199 ACTTCTCTGCTGAATTTTCAAGG + Intergenic
1179300823 21:40108615-40108637 AGTTCTGTGAAGAATCTTAATGG - Intronic
1179432331 21:41331414-41331436 TCTGCTGTGCAGAAGCTTTTTGG + Intronic
1179503624 21:41825230-41825252 AGTTCTGTGCAGAAGCACCTTGG - Intronic
1181449018 22:23004329-23004351 TTTTCTGTGCAGAAGCTTTTAGG - Intergenic
1183189196 22:36310818-36310840 TCATCAGTGCAGAAGCTTCCAGG - Intronic
1184500770 22:44870299-44870321 ACTTCAGTGCAGAGGCTGCCAGG - Intergenic
1184868123 22:47214974-47214996 ACATCTGTGCACTAGCTACAAGG - Intergenic
950721182 3:14883803-14883825 AGTTTTGTGCAGAATCTGCAGGG + Intronic
952751729 3:36830514-36830536 TCTTCTGTGGAGAAGATACAGGG - Intronic
953962827 3:47280373-47280395 ACTCTTGTGCAGGGGCTTCAGGG - Intronic
954468007 3:50668417-50668439 AAGTCTGTGCAGAAGCATCTAGG - Intergenic
955086999 3:55712484-55712506 ACTTCTCTGCAGAAGATTGTTGG + Intronic
956209901 3:66791894-66791916 ACTTCTGAGGAGAAGCTCCCTGG + Intergenic
957356443 3:79093997-79094019 ACTTTTGGGCAGTAGCTTCAAGG + Intronic
959494781 3:107037570-107037592 AGTTCTATGGAGAATCTTCATGG - Intergenic
960084484 3:113575982-113576004 ACTTGTGTGCATGATCTTCATGG + Intronic
960543969 3:118890934-118890956 ACTTGTTTCCAGCAGCTTCATGG - Intergenic
963590649 3:147254052-147254074 ACTTGTGTGAAGAAGCATTAAGG - Intergenic
965006796 3:163037427-163037449 ACTTCTGAGCAGAAGATTTAAGG + Intergenic
965075728 3:163973360-163973382 ATTTCTGTTCAGAAGTTTCACGG - Intergenic
966671470 3:182530939-182530961 ACTCCTATGCAGAATCTACAAGG + Intergenic
969070791 4:4537058-4537080 ACTGCTGTGCAGAGGCAGCAGGG - Intronic
969176100 4:5400196-5400218 TCTTTTGTGCAGCAGCTTCAGGG - Intronic
970394615 4:15654375-15654397 ACTTTTGTGGAGATGGTTCAGGG - Intronic
971636729 4:29070126-29070148 ACTTCTGTGAAGAATCTTATTGG + Intergenic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
973949884 4:56001233-56001255 ATTGCTGTGCAGAAGCTTTTTGG + Intronic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
974252290 4:59402117-59402139 AGTTCTGTGAAGAATCTTAATGG - Intergenic
975723936 4:77274132-77274154 ATTTCTGTGCAGAAGTTCCAGGG - Intronic
975995938 4:80314968-80314990 ACTTTTGTGGAAAAACTTCAAGG + Intronic
977468289 4:97409444-97409466 AGTTGTGTGCAGAAGCTGCAAGG + Intronic
978042769 4:104090694-104090716 ATATTTGTGCAGAAGCTGCAAGG + Intergenic
980008029 4:127563319-127563341 AGATCTGGGCAGAAGCTGCAAGG - Intergenic
980233697 4:130076542-130076564 ACATTTGTGCAGAATCTTGAAGG + Intergenic
981426227 4:144606540-144606562 ACATCTGTGCAGTAACTTGAAGG - Intergenic
986224735 5:5801992-5802014 CCTTCTGTGCTGAACCTTCCTGG + Intergenic
986288020 5:6374908-6374930 TCCTCTGTGGAGGAGCTTCAGGG + Intronic
986418171 5:7549369-7549391 CCTTCTGAGCAGAAGCTTTAGGG - Intronic
986597744 5:9441242-9441264 ACTTATGGGCAGAAGAGTCAAGG + Intronic
986825379 5:11515153-11515175 TTTTCTCTGCAGAAGCATCATGG + Intronic
989665467 5:43848611-43848633 TCTTCTGTGCAGATGATACAGGG + Intergenic
992730694 5:79665109-79665131 ATATCTTTGCAGAAACTTCAAGG + Intronic
994756098 5:103795620-103795642 ATTTTTTTTCAGAAGCTTCAGGG - Intergenic
995474830 5:112537353-112537375 GCTTCTGTGCAGTGTCTTCATGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
998639205 5:143990538-143990560 AGGTCTGTACAGAAACTTCAAGG + Intergenic
1003240561 6:4341907-4341929 AGTTATGAGCACAAGCTTCAAGG + Intergenic
1004617669 6:17305743-17305765 ATTTCTGTGCACAAGCCTCCGGG - Intergenic
1006454553 6:34124310-34124332 ACTTTTGTGCAGAACCTGAACGG - Intronic
1007930894 6:45689793-45689815 TCCTGTGTGCAGAGGCTTCAGGG + Intergenic
1008462775 6:51795051-51795073 AATTCTGTGAAGAATCTTAATGG + Intronic
1008839936 6:55890579-55890601 ACTTAATTACAGAAGCTTCAAGG + Intergenic
1009625539 6:66135874-66135896 ACTACAGTGCAGAAGCATAAAGG - Intergenic
1009783572 6:68301161-68301183 ACTTCTGTGAAGAAGGTCAATGG + Intergenic
1010193438 6:73216433-73216455 ACTTCTGTGCTAAAGCGTTAAGG + Intronic
1011018604 6:82786131-82786153 ACATCTGTGCAGAAGTATTAGGG + Intergenic
1011500848 6:87987996-87988018 AGTTCTGTGAAGAATCTTAATGG - Intergenic
1012022778 6:93946186-93946208 ACTTCAGAGCAGAGGCCTCAGGG + Intergenic
1012818599 6:104056433-104056455 AATTCTGTGAAGAAGGTTAATGG - Intergenic
1014552736 6:122807550-122807572 AGTTCTTTGGAGCAGCTTCATGG + Intronic
1016381235 6:143483456-143483478 CATTCTGGGCAGAAGCTACAGGG + Intronic
1016935000 6:149443142-149443164 ATATCTGGGCAGAAGCTTCAGGG + Intergenic
1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG + Intronic
1020523590 7:9227806-9227828 ACTACTCTGCAGAATATTCATGG - Intergenic
1021385231 7:20021291-20021313 ACTTCTCTTCAGAAGCTTCTAGG - Intergenic
1024020308 7:45362414-45362436 ATTTCTGGGTAGCAGCTTCAGGG + Intergenic
1025261207 7:57418489-57418511 TCTCCTGTGCAGAAGCTTTAGGG + Intergenic
1025738517 7:64175700-64175722 TCTCCTGTGCAGAAGCTTTAGGG + Intronic
1026402486 7:70028876-70028898 ACTCCTCTGCTGAAGATTCACGG + Intronic
1028573970 7:92325328-92325350 TCTTCTCTGCAGAAGCTGCTGGG + Intronic
1030222870 7:107115884-107115906 ACTTCTAGGCAGAAGCTTTAGGG + Intronic
1030442903 7:109611418-109611440 GCTTCTGTGGAGATGCTTCCTGG - Intergenic
1031255705 7:119445425-119445447 TTTTCTGTGCAGAAGCTTTTTGG - Intergenic
1031347626 7:120688578-120688600 TTTGCTGTTCAGAAGCTTCAAGG - Intronic
1031774645 7:125892346-125892368 ACTTATAAGCAGAAGCGTCAAGG - Intergenic
1034425990 7:151014275-151014297 ACATCTGTCCAGAGGCTGCAAGG + Exonic
1035319571 7:158020029-158020051 GCTGCAGTGCAGAAGCCTCAGGG - Intronic
1035680426 8:1483614-1483636 ACTGCTGTGCAGGAGGCTCAGGG + Intergenic
1035719848 8:1783792-1783814 ACTTCTGTCGAGGAGCTTCGGGG + Exonic
1036283575 8:7422733-7422755 ATCTTTGTGCAGAAGCTCCAAGG - Intergenic
1036337894 8:7888788-7888810 ATCTTTGTGCAGAAGCTCCAAGG + Intergenic
1036827516 8:11989202-11989224 ACTTCTCAGCAGAAACCTCAGGG + Intergenic
1036913480 8:12780839-12780861 TCTGCTGTGCAGAAGCTTTTGGG + Intergenic
1038177274 8:25192452-25192474 ACCACTGTGTAGCAGCTTCAGGG + Intronic
1038905365 8:31896282-31896304 CTTTCTGTGCAGAAATTTCAAGG + Intronic
1040631800 8:49222394-49222416 ACATTTGTATAGAAGCTTCAAGG + Intergenic
1041905146 8:63024695-63024717 GAGTCTGTGCAGAACCTTCAGGG - Intronic
1042107355 8:65342358-65342380 ACTTCTGTGAAGAAACGTAATGG - Intergenic
1043792811 8:84494428-84494450 AATTCTGTGAAGAATGTTCATGG + Intronic
1043809606 8:84720653-84720675 TTTGCTGTGCAGAAGCTTCTTGG - Intronic
1044701435 8:94968660-94968682 ACCCCTGTGCAGAACCTTCCAGG - Intronic
1044981948 8:97725049-97725071 AGTTCTGTGCATAAGATCCAAGG - Exonic
1045212941 8:100117873-100117895 AGTTCTGTGAAGAATGTTCATGG - Intronic
1045765057 8:105657677-105657699 ACTTTTGTGAAGTAGCTACAAGG - Intronic
1046411722 8:113853066-113853088 TTTTCTGTGCAGAAGCTTTTTGG - Intergenic
1047503254 8:125458597-125458619 ACTTCTGGACAGAAGCCTTAAGG + Intergenic
1048599663 8:135906422-135906444 ACATCTGTGCAGGAGCTTTCTGG - Intergenic
1048752945 8:137700168-137700190 AGTTCCCTGCAGAAGCTTCTTGG + Intergenic
1051152822 9:14102994-14103016 ACTTGTGTTTAGAAGCATCAAGG + Intronic
1052078793 9:24177848-24177870 AGTTCTGTGAAGAATCTTGATGG + Intergenic
1052576787 9:30301147-30301169 ACTTCTGTGAAGAATCTGAATGG - Intergenic
1052857716 9:33417446-33417468 GCTTCTGTACAGATGCCTCAGGG + Intergenic
1053363974 9:37509784-37509806 ACTTCTGGGTAGAAGCTTTAAGG - Intergenic
1055312980 9:75003581-75003603 ACTGCTGTGAAGGAGATTCAGGG - Intronic
1056482691 9:87021698-87021720 ACTTCCGTGCACGAGCTACATGG + Intergenic
1056619085 9:88195480-88195502 GCATCTGTGCAGAATCTGCACGG - Intergenic
1057529774 9:95834126-95834148 ATTTCTGTGAGGAAGCTTGATGG - Intergenic
1059576494 9:115494500-115494522 ACTTATTTGCAGCAGCTTCATGG + Intergenic
1060445901 9:123687820-123687842 TATTCTGTGGAAAAGCTTCACGG + Intronic
1186309701 X:8304180-8304202 ACCTCTGTGCAGAAGTTTAAAGG - Intergenic
1187021227 X:15384368-15384390 ACTTTTTTGCACAACCTTCATGG + Exonic
1192712220 X:73603038-73603060 ACTTCTGTGAAGAATGTTAATGG + Intronic
1192726277 X:73756328-73756350 ACTAATGTGCAGAATCTACAAGG - Intergenic
1193259129 X:79384666-79384688 ACTTCTGTGAAGAATGTTCATGG - Intergenic
1194055153 X:89122796-89122818 AGTTCTGTGAAGAATCTCCATGG + Intergenic
1195000856 X:100641948-100641970 ACGTCTGTGCAGAGGCTCCAGGG + Intergenic
1197070824 X:122295777-122295799 ACTTCTGTGTAGAAAGTCCATGG + Intergenic
1197659266 X:129152233-129152255 ACTTTTGTGCTGAAGTTTGAAGG + Intergenic
1197877039 X:131120286-131120308 ACTTCTGTGCATAATTTTCTTGG - Intergenic
1198540794 X:137637664-137637686 ACTTCTGTGCCAAAGCATCTAGG - Intergenic
1200913297 Y:8549772-8549794 ACAGCTGAGCAGGAGCTTCATGG + Intergenic