ID: 1018777090

View in Genome Browser
Species Human (GRCh38)
Location 6:167027581-167027603
Sequence ATGTCTCTCCAGAAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018777090_1018777096 6 Left 1018777090 6:167027581-167027603 CCTTCCCTCTTCTGGAGAGACAT 0: 1
1: 0
2: 0
3: 32
4: 272
Right 1018777096 6:167027610-167027632 TAGTGCAAAGAACTTGGGCTTGG 0: 1
1: 0
2: 1
3: 15
4: 202
1018777090_1018777097 12 Left 1018777090 6:167027581-167027603 CCTTCCCTCTTCTGGAGAGACAT 0: 1
1: 0
2: 0
3: 32
4: 272
Right 1018777097 6:167027616-167027638 AAAGAACTTGGGCTTGGAGTTGG 0: 1
1: 0
2: 2
3: 26
4: 324
1018777090_1018777095 1 Left 1018777090 6:167027581-167027603 CCTTCCCTCTTCTGGAGAGACAT 0: 1
1: 0
2: 0
3: 32
4: 272
Right 1018777095 6:167027605-167027627 CTGGATAGTGCAAAGAACTTGGG 0: 1
1: 0
2: 2
3: 14
4: 146
1018777090_1018777094 0 Left 1018777090 6:167027581-167027603 CCTTCCCTCTTCTGGAGAGACAT 0: 1
1: 0
2: 0
3: 32
4: 272
Right 1018777094 6:167027604-167027626 TCTGGATAGTGCAAAGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018777090 Original CRISPR ATGTCTCTCCAGAAGAGGGA AGG (reversed) Intronic
901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG + Intronic
902404581 1:16175692-16175714 GTGTCTCTCCAGAGCAGGAACGG + Intergenic
903139710 1:21332175-21332197 AGGCCTCTCCAGAAAGGGGAAGG - Intronic
903358349 1:22761885-22761907 CTGGCTCCCCAGCAGAGGGAGGG + Intronic
905105063 1:35559060-35559082 ATCCCTCTGCAGAGGAGGGACGG - Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
907751249 1:57265221-57265243 CTGACTCACCAGAAGAGAGAAGG - Intronic
907880536 1:58546216-58546238 CAGTTTCTCCTGAAGAGGGAAGG + Intronic
910154782 1:84203160-84203182 AAGTCTCTCCTGAAAATGGAAGG - Intronic
911263164 1:95711329-95711351 TTTTCTTTCCAGAAGAGAGAAGG + Intergenic
913071232 1:115300618-115300640 ATGTCACTGCAGAAGAGCAAGGG - Intronic
913415282 1:118598689-118598711 CTGTCTCTCCATCAGAGGGTTGG + Intergenic
915286840 1:154858613-154858635 ATATGTTTCCAGAAGAGGGATGG + Intronic
916504610 1:165416797-165416819 GTGTCTCTCCAGAGCAGAGAGGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
921587755 1:216967447-216967469 ATGTCTTTCTAGAAAAGGCAGGG - Intronic
922155154 1:223035259-223035281 AGCTCTCTCCTGAAGAGAGAGGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
923208128 1:231778074-231778096 ATGTCCCTCCAGGCCAGGGATGG + Intronic
923390276 1:233507933-233507955 ATTTCTCCCAAGAGGAGGGAAGG - Intergenic
1064193917 10:13230329-13230351 AGGTCTCTTAAGCAGAGGGAAGG - Intronic
1065409328 10:25406284-25406306 CTGACTTTCCAGAAGATGGAAGG - Intronic
1066706553 10:38185698-38185720 ATGTCTCTCCATAAGAGTAAGGG - Intergenic
1067270812 10:44789986-44790008 CTGTGTCTCCAGAAGAGATACGG - Intergenic
1067371752 10:45690441-45690463 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067388029 10:45835708-45835730 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1067418092 10:46121572-46121594 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067446236 10:46348893-46348915 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067503451 10:46828135-46828157 ATGCCTCTCCATAAGAGTAAGGG - Intergenic
1067591142 10:47511878-47511900 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1067638260 10:48019970-48019992 ATGCCTCTCCATAAGAGTAAGGG + Intergenic
1067875234 10:50000391-50000413 ATGCCTCTCCATAAGAGTAAGGG - Intronic
1069864627 10:71494352-71494374 ATGTGACTCCAGCAGAGGGAAGG + Intronic
1070134865 10:73684396-73684418 ATGCCTCTCCATAAGAGTAAGGG + Intronic
1070167434 10:73909479-73909501 AAGTCTCTCCAGAAGACAGTGGG + Intronic
1070723333 10:78771732-78771754 ATGTTTTTTCAGAAGAGGAAAGG + Intergenic
1070745607 10:78931903-78931925 TTTTGACTCCAGAAGAGGGATGG + Intergenic
1071086658 10:81874687-81874709 TGGTCTCTCCAGAAGAGTGCTGG + Intergenic
1071239675 10:83691857-83691879 CTGTCACTGCAGAAGGGGGAGGG - Intergenic
1073008480 10:100342165-100342187 ATGGGCCTCCAGAGGAGGGAGGG + Intergenic
1075459157 10:122604586-122604608 ATTTGTATCCAGAAGAGGCAGGG + Intronic
1075459789 10:122608645-122608667 ATTTGTATCCAGAAGAGGCAGGG + Intronic
1075460421 10:122612704-122612726 ATTTGTATCCAGAAGAGGCAGGG + Intronic
1075461053 10:122616763-122616785 ATTTGTATCCAGAAGAGGCAGGG + Intronic
1075618160 10:123906280-123906302 ATGTCTACCTAGAAGAGAGATGG + Intronic
1077069109 11:659786-659808 CTGTCTCTCCAGAGGAGGCCGGG - Intronic
1077787046 11:5395672-5395694 ATTTCTCTCGAAAAGAGGCAGGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080148539 11:29020326-29020348 ATGTCTCTCCACATTAGGGAGGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084704008 11:70805304-70805326 CTGTCTCTCCAGAGCAGGAAGGG - Intronic
1084852840 11:71957240-71957262 ATCTCTCTCCAGAAGAGCAATGG + Exonic
1086120292 11:83298808-83298830 TTGTGTCTGCAGAAGAGGGCTGG - Intergenic
1086843880 11:91723492-91723514 ATGTGTCTCCAGGTGAGAGAGGG + Intergenic
1087225203 11:95591555-95591577 CTGTCTCTGCAGGAGAGAGAGGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087664727 11:101031083-101031105 ATGGCTCTCCTGAAGGGGCAAGG + Exonic
1088003786 11:104915927-104915949 ATAGCTGTCCAGATGAGGGATGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092972783 12:13714097-13714119 CTGTCTCTCAGGAAGTGGGAGGG + Intronic
1095962965 12:47846803-47846825 AGGTCTCTGCAGGGGAGGGAGGG + Exonic
1096025816 12:48360155-48360177 AACTCTCTCCAGAGGAGGAAGGG - Intergenic
1096618203 12:52846532-52846554 ATGTCACTGCAGGAGAGGGCGGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098004862 12:65985580-65985602 ATGCCTCTCTTGAAGAGTGAAGG + Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1099344363 12:81479750-81479772 ATCTCTCTGCAGAAGAGTGGAGG - Intronic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100282831 12:93134603-93134625 ATGTCTATTCAGAAGAGGCTGGG - Intergenic
1101033080 12:100678904-100678926 ATGTTTCTAAAGATGAGGGAAGG - Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101886161 12:108664639-108664661 AGGTCTCTTCCGCAGAGGGAGGG - Intronic
1105268536 13:18847043-18847065 ATTTCTCTGCAAAAGAGGAATGG + Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG + Intergenic
1108128412 13:47269982-47270004 ATGTTTCCCCACAAGAGTGAGGG + Intergenic
1109688999 13:65861374-65861396 ATGTATTTCAAGTAGAGGGAAGG - Intergenic
1109969470 13:69748037-69748059 TTGTATCTCCAGTAGAGAGATGG - Intronic
1110475391 13:75907546-75907568 ATGGCTGTCGAGAAGAAGGAGGG + Intergenic
1110723360 13:78790767-78790789 AATTCTCTTCAGAGGAGGGAAGG - Intergenic
1112418320 13:99224250-99224272 ATGTCTTTTAAGAAAAGGGAGGG - Intronic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114049446 14:18910820-18910842 ATGTCACTACAGAAGAGAGATGG + Intergenic
1114113117 14:19491111-19491133 ATGTCACTACAGAAGAGAGATGG - Intergenic
1114345689 14:21792292-21792314 ATGTCTCCCTGGAAGAGGGAGGG + Intergenic
1114412153 14:22511233-22511255 ATATCTCTCTAGAAGAAAGAGGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1115544975 14:34457661-34457683 ATGTCTCATCAGAAGACAGATGG + Intronic
1116656671 14:47662428-47662450 AGCTCTCTCTGGAAGAGGGAAGG + Intronic
1116665603 14:47770437-47770459 ATGTCTCACCAGAAAAATGATGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1119723792 14:76909504-76909526 ATGCCTCTGCAGAAGAAAGAAGG + Intergenic
1121297797 14:92843797-92843819 TTGTCTCTGCAGAAGTGGCAGGG + Intergenic
1121440978 14:93949121-93949143 ATGTCCTTCCAGAACAAGGAAGG - Intronic
1122076001 14:99234995-99235017 AAGTCCCTCTAGAAGAGAGACGG - Intronic
1202830769 14_GL000009v2_random:26913-26935 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1124911115 15:33921716-33921738 TTGTCTCTTCAGAATAGGAAAGG - Intronic
1125929790 15:43592468-43592490 ATGTCTTACCAGAAGAAGAAGGG + Intergenic
1125942957 15:43692300-43692322 ATGTCTTACCAGAAGAAGAAGGG + Intergenic
1126582257 15:50252552-50252574 AGGTCTCTCCAGAGGAGGCAAGG + Intronic
1128437053 15:67663580-67663602 ATGTCTCTCCAGGCCAGGCATGG + Intronic
1129857849 15:78837718-78837740 AATTCTCTCCTGAAGAGGGCAGG + Intronic
1131933100 15:97467975-97467997 ATGTATCTGCAGGAGGGGGATGG + Intergenic
1132083452 15:98886693-98886715 GTGTCTCGCCAGCAGATGGATGG - Intronic
1134891120 16:17842578-17842600 ATCTGTCACCAGAATAGGGAGGG - Intergenic
1136777896 16:32881393-32881415 ACCTCTCTCCAGAAGAGGAGGGG - Intergenic
1136892726 16:33980121-33980143 ACCTCTCTCCAGAAGAGGAGGGG + Intergenic
1136925799 16:34372665-34372687 AAGCCTCTCCAGGGGAGGGAGGG + Intergenic
1136928407 16:34396455-34396477 ATGTCTCTCCAGTAAAGTGGGGG - Intergenic
1136976167 16:35015349-35015371 ATGTCTCTCCAGTAAAGTGGGGG + Intergenic
1136978775 16:35039141-35039163 AAGCCTCTCCAGGGGAGGGAGGG - Intergenic
1137862792 16:51863620-51863642 ATTTCTGCCCAGAAGAGGGAAGG - Intergenic
1138194874 16:55044656-55044678 CTGGCTCTGCAGGAGAGGGAGGG - Intergenic
1138764344 16:59583352-59583374 GAGGCTCTCCAGAAAAGGGAAGG + Intergenic
1139345434 16:66300170-66300192 ATACCTCTCAAGAAGAGGCATGG - Intergenic
1141289165 16:82701856-82701878 CTGTGTCTTCAGAAGAGGGGAGG - Intronic
1141914443 16:87085445-87085467 TTCTCTCCCCAGGAGAGGGATGG + Intronic
1203080314 16_KI270728v1_random:1143502-1143524 ACCTCTCTCCAGAAGAGGAGGGG - Intergenic
1142630433 17:1222384-1222406 ATATCTCTTCACAATAGGGATGG + Intronic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1143345339 17:6244984-6245006 AAGTCTCTCCAGAGCGGGGAAGG + Intergenic
1143346885 17:6256271-6256293 ATGTATGTGGAGAAGAGGGAGGG + Intergenic
1146590572 17:34125034-34125056 ACGTTTTTCCAGAATAGGGAAGG - Intronic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1147911453 17:43858510-43858532 CTGGCTCTGCTGAAGAGGGAGGG + Intronic
1149931118 17:60756576-60756598 ATGTCACTGCAGCACAGGGATGG - Intronic
1150886031 17:69086934-69086956 TTGTCTTGCCAGAAGAGGGGTGG + Intronic
1151307012 17:73268930-73268952 ATAGCTCCCCAGAGGAGGGAGGG - Intergenic
1151859056 17:76745695-76745717 GTGTCTCAGGAGAAGAGGGAGGG - Intronic
1153351362 18:4084024-4084046 AAGTAGCTCCAGAAGATGGATGG + Intronic
1153526040 18:5995619-5995641 CTGTCTCTCCAGAAGTGCGAAGG - Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1158188888 18:54803086-54803108 ATGTATATCTAGAAGAGGAAAGG + Intronic
1159587921 18:70299540-70299562 ATTTCTCTTCAGGATAGGGACGG + Intronic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1160361729 18:78288641-78288663 ATGTATAACCAGAAGTGGGATGG - Intergenic
1163418784 19:17202721-17202743 ATGCCACTCCAGGTGAGGGAGGG + Intronic
1167019559 19:46863198-46863220 TTGCCTCTGCAGCAGAGGGATGG - Intergenic
1202641924 1_KI270706v1_random:100863-100885 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
925302920 2:2829710-2829732 AGGTCTCTGCAGAAGAGACAAGG + Intergenic
926332199 2:11834931-11834953 ATGTCACTGCAGTAGAGGGGTGG - Intergenic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
927016625 2:18970031-18970053 ACATCTTTCCAGAAGAGAGAGGG - Intergenic
927108012 2:19844322-19844344 ATGGCTCTCCAGCAAAGGCATGG - Intergenic
929225994 2:39512228-39512250 ATGTCTTTCCAGGTTAGGGAAGG + Intergenic
929278449 2:40050927-40050949 ATGCCACTCTAGTAGAGGGAGGG + Intergenic
931821359 2:65955377-65955399 ATATATCTCCAGAGGAGGGAGGG - Intergenic
934497759 2:94824324-94824346 ATTTCTCTGCAAAAGAGGAATGG + Intergenic
937038359 2:118801371-118801393 ATGCCTGTCCAGAAGAAGGCAGG + Intergenic
938407188 2:131039207-131039229 AGGGCTCACCAGAAGAGGAATGG - Intronic
940469534 2:154077816-154077838 ATGTCTGTCCACATGGGGGAAGG + Intronic
940659677 2:156531409-156531431 ACTTCTCTCCAGAAGATGCAAGG + Intronic
943137569 2:183934437-183934459 ATATCTCTTCAAAAGAGGAAAGG + Intergenic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
944986897 2:205187661-205187683 ATGGCTTTGCAGAAAAGGGAAGG - Intronic
946945743 2:224820291-224820313 CTCTCTCTCCAAAAGACGGATGG + Intronic
947031167 2:225797489-225797511 TTGTACCTCCAGAACAGGGAAGG - Intergenic
947356097 2:229297347-229297369 GTATTTCTCCAGAAGAGTGAAGG - Intergenic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171256252 20:23690912-23690934 ATGTGTCTCCAGGAGTGGGGAGG + Intergenic
1171889039 20:30691053-30691075 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1172762511 20:37332394-37332416 ATGTTTCTCCAGCAGGGAGAGGG - Intergenic
1175163865 20:57029389-57029411 ATGTCTCCCCAGAGCAGGTAAGG - Intergenic
1175208989 20:57336638-57336660 ATGCCTCTCAAGAAGAGGCTGGG + Intronic
1176243778 20:64087809-64087831 TGGTCCCTCCAGAAGGGGGAAGG - Intronic
1176609956 21:8871751-8871773 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1176853816 21:13946338-13946360 ATTTCTCTGCAAAAGAGGAATGG + Intergenic
1180360021 22:11881002-11881024 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1184595409 22:45510941-45510963 GTGTCTCTCCTGAAGAGAGGTGG + Intronic
949438261 3:4052190-4052212 ATGTGTCTCCACATGATGGACGG + Intronic
951031632 3:17888570-17888592 GTGTCTCTCCAGATGAGATAGGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952944817 3:38472277-38472299 AGGTCCCTCCATAAGAGCGAAGG - Intronic
953068109 3:39493444-39493466 ATGTCTGTTCAGTAGAGGAAGGG - Intronic
953473590 3:43186918-43186940 ATGGCCCTCCAGAACAGGGAGGG - Intergenic
953507240 3:43498306-43498328 ATGCCTCCCCAGAAGATGGGTGG + Intronic
953634184 3:44648618-44648640 ATGTCGCCCCAGACCAGGGATGG - Intergenic
953868756 3:46607887-46607909 CTTTGTGTCCAGAAGAGGGAGGG + Intronic
954441125 3:50522506-50522528 ATCTCTCTCCATCAGAGGAAAGG + Intergenic
957122844 3:76118460-76118482 CTGTTTCTCCAAATGAGGGAGGG + Intronic
957310232 3:78509691-78509713 ATAGCTCTCCTGAAGAGGTAGGG + Intergenic
960132752 3:114074683-114074705 ATGGCTCTCCAGTAGAAGAAAGG - Intronic
961308400 3:125975945-125975967 TTGTCTCTCCAGAAAAGTGCAGG + Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963705740 3:148686127-148686149 ATATCTCTCAAGTAGAGGGTTGG - Intergenic
964081039 3:152757226-152757248 ATTTCTCTCCATAATAGAGATGG + Intergenic
964786201 3:160399301-160399323 ACGCCTCTTCAGAAGAGGGCGGG - Exonic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967829300 3:193905033-193905055 CTGACTCTTCAGAAAAGGGATGG + Intergenic
1202736642 3_GL000221v1_random:6541-6563 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
969219523 4:5750821-5750843 ATGTTTGTATAGAAGAGGGATGG + Intronic
969435524 4:7187012-7187034 ATGTCCAACCAGAAGACGGAGGG - Intergenic
969447468 4:7253458-7253480 AAGGCACTACAGAAGAGGGATGG + Intronic
969808725 4:9631449-9631471 AAGTCCCTTCAGAAAAGGGAGGG - Intergenic
971887598 4:32473406-32473428 ATGGCGAGCCAGAAGAGGGATGG + Intergenic
972872659 4:43319653-43319675 ATGTCCCTCCAGCCTAGGGATGG - Intergenic
978137551 4:105281049-105281071 ATGTCTTTCCAGGAGAGGCAAGG - Intergenic
982230530 4:153204670-153204692 TTTTCCCTGCAGAAGAGGGAAGG + Intronic
982464967 4:155718816-155718838 AAGTCTGCCCAGAAGAGAGAGGG + Intronic
983771729 4:171558266-171558288 CTGTCTCTCAAGAAGAGAGTAGG + Intergenic
985135842 4:186785338-186785360 ACATATCTCCAGAAGTGGGATGG + Intergenic
1202769292 4_GL000008v2_random:186728-186750 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
989195055 5:38708379-38708401 CTGTCTCTCCTAAAGTGGGAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991157584 5:63457890-63457912 ATGGCTCTCATGAAGAGGAATGG + Intergenic
991933893 5:71783031-71783053 ATTTCTGTCAAGGAGAGGGAGGG + Intergenic
992261517 5:74975326-74975348 ATGTCTTTCCAGAAGGGGTTCGG - Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
995428324 5:112048586-112048608 ATGACTCTCATGAAGAGGAATGG + Intergenic
995641610 5:114263707-114263729 ATCACTCTTCAGAAAAGGGAAGG - Intergenic
997290268 5:132727429-132727451 AGGACTTTCCAGAAGAGGTAAGG + Intronic
997707270 5:135968273-135968295 ATGTATACCCAGAAGTGGGATGG + Intergenic
998147895 5:139740637-139740659 AAGGTTCCCCAGAAGAGGGAGGG + Intergenic
998617908 5:143761168-143761190 GTTTCTCTTCAAAAGAGGGAAGG - Intergenic
998682597 5:144486968-144486990 ATTTCAGTCCACAAGAGGGATGG + Intergenic
999112621 5:149135234-149135256 ATGTCTCTACAGTAGATGAAAGG + Intergenic
1001641518 5:173247219-173247241 ATGACTCTCCTGGAGGGGGAGGG + Intergenic
1001926330 5:175639871-175639893 ATCGCTCTCCAGGAGAGTGATGG - Intergenic
1001961080 5:175880637-175880659 ATGTCTCTCCAGGTGGGGGCTGG - Exonic
1002101182 5:176858429-176858451 GTGTCTCTTCAGAAAAGGGCTGG + Intronic
1002637693 5:180616280-180616302 CTGCCTGTCCAGGAGAGGGAGGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007399800 6:41597327-41597349 AGGACTCACCAGAGGAGGGAAGG + Intronic
1011266216 6:85522191-85522213 ATGGCTCTGCAGAATGGGGAAGG - Intronic
1013768175 6:113597287-113597309 ATGTCTCTCCAGATGGGGCCAGG - Intergenic
1015179349 6:130345248-130345270 GTGGCTCCCCTGAAGAGGGAAGG + Intronic
1015350310 6:132210288-132210310 AGGTCTCTGCACAGGAGGGATGG + Intergenic
1015810475 6:137157516-137157538 ATGTCTCTCCAGCATGGGGTAGG - Intronic
1017018481 6:150120557-150120579 ATGTATACCTAGAAGAGGGACGG + Intergenic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020077272 7:5266714-5266736 GTGTCTGTCCAGAACAGAGAGGG - Intergenic
1022410790 7:30136692-30136714 GTGGCACTCCAGAAGAGGGATGG + Intronic
1023130616 7:36999205-36999227 ATGGCGCTCCAGATGAGGCATGG - Intronic
1023655509 7:42415749-42415771 ATGTCTCTAAAAAAGGGGGAGGG - Intergenic
1026202594 7:68227332-68227354 ATGTTTCTCCAGAAATGTGAGGG - Intergenic
1029503206 7:100946593-100946615 CTGTGTCTCCAGAACAGTGATGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030196063 7:106854957-106854979 AGGTCTCCACAGCAGAGGGAAGG + Intergenic
1030779802 7:113586217-113586239 ATGTCTCTACAAAAAAGTGAAGG + Intergenic
1030787201 7:113676450-113676472 ATGTCTGACAGGAAGAGGGATGG - Intergenic
1032566989 7:132956924-132956946 ATCGCTCTTCAGAAGAGGCATGG - Intronic
1032638465 7:133737326-133737348 GAGTCTCTGCAGAAGAGTGATGG - Intronic
1033626735 7:143117705-143117727 AGCTCTCTCCTGAAGAGAGAGGG - Intergenic
1033704687 7:143875555-143875577 ATGTCTATCCAGATGAGGTTAGG - Intronic
1035104972 7:156434689-156434711 ATGTCTCTCGAGAAGACAGGTGG + Intergenic
1036101017 8:5785222-5785244 ATGTGTACCCAGAAGTGGGATGG + Intergenic
1037140289 8:15511227-15511249 ATTTCTCTCCAGTAGAAGGAGGG + Intronic
1037184279 8:16042626-16042648 ATTTCTCTGCAAAGGAGGGAGGG + Intergenic
1037863175 8:22420943-22420965 AACTCTCTCCAGAAAATGGATGG + Exonic
1038263266 8:26016666-26016688 ATGTTGCTCCAGTAGAGAGATGG + Intronic
1040045470 8:42959118-42959140 CTGTCTTTCCTGAAGAGGGAAGG - Intronic
1045290076 8:100825467-100825489 GGGGCTCTCCAGAAGAGGAAGGG + Intergenic
1045375183 8:101565568-101565590 GTGTCTCCCCAGCAGAGGAAGGG + Intronic
1045777470 8:105822634-105822656 CTGTCTCTCCTGCAGAGAGAGGG + Intergenic
1045987024 8:108260836-108260858 ATGTTTTTCCAGAAGAGACAAGG + Intronic
1046018820 8:108639002-108639024 ATATCTCTCCAGGAGACTGATGG - Intronic
1046107719 8:109686387-109686409 ATGTTTTTCCACAAGAGAGAAGG - Intronic
1046313097 8:112464519-112464541 ATGTAACTTCAGAGGAGGGAAGG - Intronic
1047408864 8:124607861-124607883 ATATCTCTACAGAAAAGGGGGGG + Intronic
1050286589 9:4108988-4109010 ATGTCTCTCTAGACCGGGGAAGG - Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1053407904 9:37893535-37893557 ATGGCTCTCCTGATCAGGGAGGG - Intronic
1053659387 9:40256149-40256171 ATTTCTCTGCAAAAGAGGAATGG - Intronic
1053909759 9:42885512-42885534 ATTTCTCTGCAAAAGAGGAATGG - Intergenic
1054360421 9:64108911-64108933 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1054371514 9:64402450-64402472 ATTTCTCTGCAAAAGAGGAATGG - Intronic
1054525211 9:66120068-66120090 ATTTCTCTGCAAAAGAGGAATGG + Intronic
1054679135 9:67892165-67892187 ATTTCTCTGCAAAAGAGGAATGG - Intronic
1054766153 9:69044353-69044375 ATGTCTCTGAAGAAGTGAGAGGG - Intronic
1055747859 9:79470554-79470576 ATCTCTCTAAGGAAGAGGGAAGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056797814 9:89670643-89670665 CTGTCTCTCCAGAAGGGCTAAGG - Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1059578950 9:115522639-115522661 AAGGCTTCCCAGAAGAGGGAGGG - Intergenic
1059586322 9:115611176-115611198 AATTCTCCCCAGAAGAGGAAAGG - Intergenic
1059631772 9:116132213-116132235 ATATATATCCAGAAGTGGGATGG - Intergenic
1060229476 9:121815984-121816006 ATGTCTGTCGAGAAAAGGAAGGG - Intergenic
1060732365 9:126046762-126046784 AAGTCTCCCCAGGAGAGGGGAGG - Intergenic
1060851132 9:126877323-126877345 ATGTATCTCCAAAAAAGAGATGG - Intronic
1060904313 9:127291226-127291248 ATGGCTCTTCAGATGAGGTAAGG + Exonic
1203694180 Un_GL000214v1:80444-80466 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203705374 Un_KI270742v1:36981-37003 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1203558635 Un_KI270744v1:28824-28846 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203642093 Un_KI270751v1:23619-23641 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1185814599 X:3143371-3143393 AAGTCTGTCCTGCAGAGGGAAGG + Intergenic
1185814605 X:3143429-3143451 AAGTCTGTCCTGCAGAGGGAAGG + Intergenic
1187285298 X:17898602-17898624 GTGTCTCCCAAGCAGAGGGAGGG - Intergenic
1187372844 X:18724967-18724989 AAACCTCTCCAGGAGAGGGAAGG - Intronic
1189664623 X:43340546-43340568 ATGCCTATCCAGAAGGGTGAAGG - Intergenic
1191192947 X:57686049-57686071 ATCTCTCTGCAGAAGAGAGTGGG + Intergenic
1193334025 X:80266161-80266183 ATGTGTCTGCAGATGTGGGATGG - Intergenic
1193715272 X:84928845-84928867 ATGGCTCTCAAGGAGAGGAATGG - Intergenic
1194510615 X:94789972-94789994 ATGTCTGTAAATAAGAGGGATGG - Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1198740194 X:139834084-139834106 CTGGCTCTACAGAAGAGGCACGG + Intronic
1198962433 X:142196209-142196231 CTGTCTGGACAGAAGAGGGAGGG - Intergenic
1199380660 X:147168494-147168516 ATGGCTCTCCACAGGACGGATGG - Intergenic
1199435437 X:147807209-147807231 TTGTCTGTCCAAAAGAGAGAGGG - Intergenic
1200101938 X:153692643-153692665 ACCTCTCTCCAGAAGAGGAGGGG + Intronic
1200812408 Y:7499722-7499744 ATGTATACCCAGAAGTGGGATGG + Intergenic