ID: 1018777611

View in Genome Browser
Species Human (GRCh38)
Location 6:167032012-167032034
Sequence CAGAGTTAACATAAGGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018777611_1018777617 18 Left 1018777611 6:167032012-167032034 CCTGAATCCTTATGTTAACTCTG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1018777617 6:167032053-167032075 GTACGTCAGAGCAGAGGACATGG 0: 1
1: 0
2: 1
3: 10
4: 129
1018777611_1018777615 -7 Left 1018777611 6:167032012-167032034 CCTGAATCCTTATGTTAACTCTG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1018777615 6:167032028-167032050 AACTCTGATTGGTGTGGCTTTGG 0: 1
1: 0
2: 5
3: 25
4: 212
1018777611_1018777619 29 Left 1018777611 6:167032012-167032034 CCTGAATCCTTATGTTAACTCTG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1018777619 6:167032064-167032086 CAGAGGACATGGCCCAGAAAGGG 0: 1
1: 0
2: 3
3: 38
4: 341
1018777611_1018777616 12 Left 1018777611 6:167032012-167032034 CCTGAATCCTTATGTTAACTCTG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1018777616 6:167032047-167032069 TTGGCTGTACGTCAGAGCAGAGG 0: 1
1: 0
2: 0
3: 6
4: 71
1018777611_1018777618 28 Left 1018777611 6:167032012-167032034 CCTGAATCCTTATGTTAACTCTG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1018777618 6:167032063-167032085 GCAGAGGACATGGCCCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018777611 Original CRISPR CAGAGTTAACATAAGGATTC AGG (reversed) Intronic
901246149 1:7732818-7732840 TAGAGATAACTTAAGGATTAGGG - Intronic
902953250 1:19904767-19904789 GAGAATTAACACAAGGTTTCAGG - Intronic
903256205 1:22102578-22102600 CAGAGTTGTCATTAGGATTTAGG + Intergenic
905618283 1:39416933-39416955 TAGAGTTAACATGAGTATACAGG + Intronic
906159551 1:43637631-43637653 CGGAGGTAAGAGAAGGATTCGGG + Intergenic
909157803 1:72102028-72102050 CAGAGTCAGCATAACAATTCAGG - Intronic
910953472 1:92676169-92676191 GAGAGTTAACATAAGAAAACTGG + Intronic
911274326 1:95842129-95842151 CAGAGTAAACATGATGCTTCAGG - Intergenic
919049091 1:192490599-192490621 CAGAGGTAAGAGAAGAATTCAGG - Intergenic
919156569 1:193773664-193773686 CAGACTTAAAATATGGATTTGGG + Intergenic
921235964 1:213130680-213130702 CAGAAATAACAAAAGGCTTCTGG - Intronic
921767093 1:218984511-218984533 CACATCTAATATAAGGATTCTGG - Intergenic
1067948299 10:50705578-50705600 CAGGCTTAACATAAAGAATCAGG + Intergenic
1068742004 10:60483974-60483996 CAAAGTTAAGATAAGGAGCCTGG + Intronic
1069302982 10:66931604-66931626 CCACGTTTACATAAGGATTCAGG - Intronic
1070883612 10:79870573-79870595 CAGGCTTAACATAAAGAATCAGG + Intergenic
1071650172 10:87386883-87386905 CAGCCTTAACATAAAGAATCAGG + Intergenic
1072587019 10:96791708-96791730 CAAAGTAAAGATAAGGATTCAGG + Intergenic
1072856197 10:98949526-98949548 CAGAGTTTACAGATGGAATCAGG + Intronic
1073028236 10:100504182-100504204 CAGAGCTATGATAAGAATTCAGG + Intronic
1074850312 10:117434229-117434251 AGGAGTTAACAAAAGCATTCTGG - Intergenic
1077934549 11:6769834-6769856 CAGAGCTATCATATGGATTCAGG - Intergenic
1078200542 11:9178597-9178619 TAGAGTGAACATCAGGATTCTGG - Intronic
1081265990 11:41022095-41022117 TAAAGTTAGCATAAGCATTCAGG - Intronic
1083036972 11:59647421-59647443 CAGAATTTACAGAAGGATTAGGG - Intronic
1083383148 11:62284817-62284839 CAGAGTTTTCATAAGTAATCTGG - Intergenic
1092512199 12:9169061-9169083 TAGAATTAATATAAGGATACTGG - Intronic
1093359079 12:18201723-18201745 TAGAGTTAACATAAGGAGAAAGG - Intronic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098071459 12:66680046-66680068 AGGAGTTAACATAAACATTCAGG + Intronic
1099692104 12:85968742-85968764 CAGAGTTATCATAATTGTTCTGG - Exonic
1100369889 12:93958629-93958651 CACAGTAAACACAAGGCTTCTGG + Intergenic
1100673003 12:96836309-96836331 CAGGGAAAACATAAGGATTGAGG + Intronic
1105814113 13:24017800-24017822 CAGAGGTAACATATGGATTACGG - Intronic
1107669457 13:42729310-42729332 CAGAATTAAAATAAGTTTTCTGG - Intergenic
1107804416 13:44141053-44141075 CTGAGCAAACATAAGAATTCAGG + Intergenic
1112766273 13:102747922-102747944 CAGAGCTGACACAAGGCTTCAGG - Exonic
1113494682 13:110717406-110717428 TAGAGTAAACATAAGAACTCAGG - Intronic
1114885564 14:26845402-26845424 CTGAGGGAACATAAGGATTCTGG + Intergenic
1114946876 14:27693355-27693377 CAGAGTTAAAAGAAGCTTTCAGG - Intergenic
1115571954 14:34675069-34675091 CATAGTTTACATTAGGATTTAGG - Intergenic
1122030150 14:98906171-98906193 CAGAGTCAACATTAGGATAGAGG - Intergenic
1124580914 15:30954115-30954137 CAGAGTGCACATAATCATTCAGG + Intronic
1126436295 15:48641884-48641906 CAAATTTAACATAAGAATTGGGG + Intronic
1127431492 15:58914379-58914401 CAGATTTAAGAAAAGGTTTCTGG + Intronic
1128873390 15:71181825-71181847 AAGAGTTAACAACAGGAGTCAGG - Intronic
1131368857 15:91863051-91863073 CAGAGTAAACATAAGACTTTAGG - Intronic
1131522408 15:93126445-93126467 CAGAGTTAAAAATAGGATTTTGG + Intergenic
1135073344 16:19371505-19371527 CAGGGTAAAAATCAGGATTCAGG + Intergenic
1135429410 16:22370440-22370462 CAAACTTAGAATAAGGATTCAGG - Intronic
1137550732 16:49435796-49435818 CACAGTCAACATCAGGAGTCAGG + Intergenic
1138130696 16:54477230-54477252 CAGGTTTAACTTAAGGATCCAGG + Intergenic
1141104874 16:81225293-81225315 CAGAGTTATCTTCAGGAGTCAGG - Intergenic
1144258434 17:13493376-13493398 ACAAGTTAACAAAAGGATTCAGG + Intergenic
1144353494 17:14422280-14422302 CAGAGATATCTGAAGGATTCTGG - Intergenic
1148540805 17:48478971-48478993 CTGAGTTAAAATAAGGATTAGGG - Intergenic
1149677538 17:58479272-58479294 CAGAGTTAAAATAAGGTTCTGGG + Intronic
1150215669 17:63467573-63467595 CAGAGTTAACAGAAGCAGCCGGG + Intergenic
1155038418 18:22044730-22044752 CAAAGTCAACACAAGGCTTCTGG + Intergenic
1155305609 18:24475112-24475134 CAGGATTGACATAAGGATTGTGG + Intronic
1156713966 18:39983512-39983534 CAGAGGTAAGATAGAGATTCAGG - Intergenic
1158275681 18:55764679-55764701 CAGAGTTTACATAAGGGATGGGG + Intergenic
1158793406 18:60810715-60810737 CACATTTAACTTATGGATTCTGG + Intergenic
1159221073 18:65463735-65463757 CATAGTCAATATAAGGATTGTGG - Intergenic
1159490901 18:69133091-69133113 CAGAGTTAAAATTACGGTTCAGG - Intergenic
1165985442 19:39764959-39764981 CAGAGTTAAATTAGGAATTCAGG + Intergenic
927280682 2:21303197-21303219 CAGAGTTTACTTAAGGATTCTGG - Intergenic
928640262 2:33290690-33290712 GAGAGTAAAAATAAGGACTCAGG + Intronic
928653647 2:33427099-33427121 CTGAGTCATCATAAGGAATCTGG - Intergenic
928854015 2:35782539-35782561 CAGAATTAACTTTAAGATTCTGG + Intergenic
931838184 2:66121793-66121815 CAGAATCAACACAAGAATTCAGG + Intergenic
934589944 2:95539323-95539345 CAGAGTAAACAAATGAATTCAGG + Intergenic
936866781 2:117084015-117084037 CAGAGATCACATAAAGATTCAGG + Intergenic
940221747 2:151359839-151359861 CAGAGTTAAAATAAGCCTTAGGG - Intronic
940661621 2:156552643-156552665 CAGAATTAACATAAGGTCTGTGG - Intronic
944012042 2:194984164-194984186 CACAGTCAACATCAGAATTCTGG + Intergenic
945234219 2:207619686-207619708 CAGAGTTACCATTAGCATTTTGG - Intronic
947511862 2:230762598-230762620 CAGTTTTAAGATAAGGATTAAGG - Intronic
1173096503 20:40034805-40034827 CAGAGTTTACATATAGATTTTGG - Intergenic
1174211852 20:48886028-48886050 CATAGTTTACATTAGGTTTCGGG - Intergenic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1174731359 20:52921223-52921245 CAGAGATCTCATAAAGATTCTGG - Intergenic
1175372478 20:58501247-58501269 CAGCTTTAACATAAGAATTTGGG - Intronic
1175991335 20:62791265-62791287 CAGATTTAACATAAAAATACAGG - Intergenic
1177035459 21:16037487-16037509 CAGAGTTCCCATAAGCATTTTGG - Intergenic
1179681270 21:43022797-43022819 CATAGTTAACATGAGGAATGAGG + Intronic
1181172617 22:21018204-21018226 AAGACTGAACATAATGATTCAGG - Intronic
1182700436 22:32232870-32232892 AAGAGAGAACATACGGATTCAGG + Intronic
1183477075 22:38041555-38041577 ATGAGTTAACGTAAGGATGCAGG - Intronic
950151640 3:10692231-10692253 CAGAGTTAACACATAGATGCAGG + Intronic
951458030 3:22915351-22915373 CAGTGTTAAAATCAGGCTTCGGG + Intergenic
955832661 3:63020955-63020977 CAGAGTTAAAGTAAAAATTCAGG + Intergenic
959791938 3:110372450-110372472 CTGAGTTAAAATAAGGAGGCTGG - Intergenic
962164477 3:133034721-133034743 CAGAGATGAGGTAAGGATTCAGG - Intergenic
963844755 3:150143916-150143938 TAGACTTAAGATATGGATTCTGG - Intergenic
964005646 3:151824425-151824447 GAGAGTAAACAAAAGGTTTCTGG + Intronic
965282040 3:166766313-166766335 CAACTTTAAAATAAGGATTCTGG + Intergenic
965916662 3:173856862-173856884 CAGAATAAACTTTAGGATTCAGG + Intronic
966953180 3:184843901-184843923 CATAGTAAGCATAAGCATTCTGG + Intronic
967422781 3:189292539-189292561 CAGAAATAACAGAAGGATCCTGG + Intronic
968294813 3:197567842-197567864 CAGAGTTCTAATAAGGGTTCAGG + Intronic
968670745 4:1849846-1849868 CAGACTTAAAAGAAGGTTTCAGG - Intronic
969064993 4:4472137-4472159 CAGAGTTAAAGCAAAGATTCAGG + Intronic
969157085 4:5220430-5220452 AAGAGTTCAGATAAGGCTTCTGG + Intronic
974623485 4:64391526-64391548 CACAGTTGACGTAAAGATTCTGG - Intronic
976481543 4:85552560-85552582 CAAAGTTAACAAAAATATTCAGG - Intronic
976777663 4:88723532-88723554 CAGAGTTACCAAAATTATTCAGG + Intergenic
979068349 4:116167390-116167412 TAGAGCTTACATAGGGATTCGGG - Intergenic
979767391 4:124478399-124478421 CAGAGTTTACAGAATGATTGTGG - Intergenic
982672625 4:158339895-158339917 AAGGGTTAACATTAGGATTAAGG + Intronic
984237482 4:177177974-177177996 CAGGGTTAACAAAGGAATTCAGG - Intergenic
987057163 5:14204731-14204753 GAGAGTTAACCTAAGGATATAGG + Intronic
987904973 5:24064615-24064637 AAGAGTTAACATTAGGACTATGG + Intronic
990610841 5:57455473-57455495 CAGAGTTAGGATTCGGATTCCGG + Intergenic
990696456 5:58423087-58423109 CAGAGTTAATGAAAGGATTGTGG - Intergenic
991457374 5:66818814-66818836 CAGAGCTAACAAGAGAATTCAGG - Intronic
993906193 5:93626065-93626087 CAAAGTAAACATCAGGATTTTGG - Intronic
994013026 5:94929957-94929979 CAGCGTTAACATAAGCTTTTGGG - Intronic
995732446 5:115260337-115260359 CAGTGTTAAACTAATGATTCAGG - Intronic
995863241 5:116662989-116663011 CAGAGTTTACATAGGGTTTGGGG + Intergenic
998815796 5:146013079-146013101 CAGTCTTAGCATAAGGATTCAGG + Intronic
1000133690 5:158323732-158323754 CAGAGTTAAAAAAAACATTCTGG - Intergenic
1000819286 5:165964052-165964074 CAGTTTTAGCATAAGGATCCGGG + Intergenic
1001982935 5:176048586-176048608 CAGGGTGAACATTAGGCTTCTGG - Intergenic
1002234528 5:177795470-177795492 CAGGGTGAACATTAGGCTTCTGG + Intergenic
1004327805 6:14691957-14691979 TAGAGTCATCATAAGGATTAAGG + Intergenic
1004660309 6:17704515-17704537 CAGATTTAAGATTAGAATTCAGG - Intronic
1006604468 6:35246071-35246093 CATAGGTAACATAGGGAATCTGG - Exonic
1006649457 6:35538809-35538831 GAGAGCCAACATGAGGATTCAGG - Intergenic
1007253931 6:40515586-40515608 CACACTTAACCTAAGAATTCCGG + Intronic
1008064667 6:47034731-47034753 GAGAGTTAAAATAGGGATCCTGG - Intronic
1008319012 6:50083726-50083748 CAGGGTTAACATGAGAAGTCAGG + Intergenic
1010897999 6:81389913-81389935 CAGAGTTAAGAGAAAAATTCAGG + Intergenic
1011572858 6:88758678-88758700 CAGAGTTAACATCAGCAGTGAGG - Intronic
1012828273 6:104174368-104174390 CAGAGTTAATAAAATGATTTTGG - Intergenic
1015217375 6:130765944-130765966 CAGTGTTAACAAGAGGATCCAGG - Intergenic
1016724286 6:147343232-147343254 CTGAGTTAACATAATTATTTAGG + Intronic
1017359169 6:153545861-153545883 CTGAGTTAAGATAAGGGTTATGG - Intergenic
1018625245 6:165771609-165771631 CAGAGGTGAAATAAGGATTTTGG - Intronic
1018777611 6:167032012-167032034 CAGAGTTAACATAAGGATTCAGG - Intronic
1020540080 7:9451365-9451387 AAAAGTTAACAAATGGATTCTGG - Intergenic
1020715666 7:11672957-11672979 AATATTTAACATAAGGTTTCTGG + Intronic
1022158448 7:27683538-27683560 AAGAGTTAACATATGAATTTGGG + Intergenic
1022199264 7:28100278-28100300 CAGAGTTCATGTAAGGATTGTGG - Intronic
1024684336 7:51729035-51729057 CAGACTCAAAATAAGGATTTAGG + Intergenic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1032829079 7:135604136-135604158 CAGACTTCACATAAGGATTTTGG + Intronic
1033761923 7:144445012-144445034 CAGAGTCAACAAAAAGGTTCTGG + Intergenic
1033871287 7:145756747-145756769 CAGAGTTAACATAACCAGTAAGG - Intergenic
1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG + Intergenic
1036433909 8:8715148-8715170 CACACTTAACCTAAGGATCCAGG - Intergenic
1037270259 8:17119877-17119899 CTGAGTTAACAAAAGAAGTCAGG + Intronic
1039652421 8:39356608-39356630 CAGAATCAACAAAAGTATTCTGG - Intergenic
1044647307 8:94457778-94457800 CTGAGTTAAAATAATGATTATGG - Intronic
1045630535 8:104115878-104115900 CAAAGATAACATAAGAATTAGGG - Intronic
1046480196 8:114807129-114807151 CAGAGTTGACATTGGGTTTCTGG + Intergenic
1047904585 8:129459689-129459711 CAGAGTTAACATAACTTTCCAGG + Intergenic
1050491109 9:6188733-6188755 CAGCATTAACAAAAGGATGCTGG + Intergenic
1051388419 9:16537109-16537131 CAGATTTAACATAATTATTTAGG + Intronic
1052260955 9:26515671-26515693 CAAAGCTAACATAAGGTGTCTGG + Intergenic
1052476229 9:28963441-28963463 CACAGTAAACATGAGGGTTCAGG - Intergenic
1057796908 9:98164404-98164426 CAGAGACCCCATAAGGATTCTGG - Intronic
1060605167 9:124907524-124907546 CAAAGTTAACAGAATGACTCAGG + Intronic
1061352883 9:130079714-130079736 CAGGGTTAACATTAGGCTCCTGG - Exonic
1186213072 X:7270606-7270628 CAGAGTATACATAAAGATGCTGG + Intronic
1193265158 X:79459465-79459487 CAGAGTTTTCATAAGTAATCTGG + Intergenic
1194791860 X:98160336-98160358 CAGAGGTGCCATCAGGATTCAGG - Intergenic
1195869135 X:109467966-109467988 CAGAATTGAGATAAGGAGTCTGG - Intronic
1197641990 X:128977082-128977104 CAGAGTTAATAAAAGGATTTAGG + Intergenic
1198135906 X:133750028-133750050 CAGAGTTTACATATGTTTTCTGG + Intronic
1199201377 X:145094048-145094070 AAGAGATCACATAAGGTTTCTGG - Intergenic