ID: 1018778460

View in Genome Browser
Species Human (GRCh38)
Location 6:167041439-167041461
Sequence ACTAAGACATGAAGAGCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018778460_1018778462 25 Left 1018778460 6:167041439-167041461 CCTTCAGCTCTTCATGTCTTAGT 0: 1
1: 0
2: 2
3: 18
4: 227
Right 1018778462 6:167041487-167041509 CTTGTTGCAGTCCCCCAGTGTGG 0: 1
1: 0
2: 1
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018778460 Original CRISPR ACTAAGACATGAAGAGCTGA AGG (reversed) Exonic
902292368 1:15443641-15443663 ACAAAGACATGAAAATGTGAAGG - Intronic
902614994 1:17618850-17618872 AATAAAACATGCAGAGCTAAAGG - Intronic
902656713 1:17874117-17874139 ACTAAGACATGGAGGGATGAAGG + Intergenic
903613358 1:24633351-24633373 ATTAAGACATAAGGAGCAGACGG - Intronic
908429646 1:64043361-64043383 AATAACACATGAAGTGCTGAGGG + Intronic
912984297 1:114411340-114411362 CCAGAGACATGAAGGGCTGAAGG + Intronic
914007654 1:143746960-143746982 ACTAAGAACTGTAGAACTGATGG - Intergenic
914321245 1:146562752-146562774 AATAAGAAATGAAGAGCATAAGG - Intergenic
915845532 1:159260032-159260054 AATAAGAGAGGAAGAGCTGCAGG - Intergenic
917241484 1:172953653-172953675 ACTAACACATGTAGTGCTTATGG - Intergenic
917241571 1:172954561-172954583 TCTTAGAAATGAAGAGCTCAAGG + Intergenic
918653093 1:186990209-186990231 GCAAAGAGGTGAAGAGCTGAGGG + Intergenic
920440732 1:205978979-205979001 ACTAAGAAATGAAGGGCGGGCGG - Intronic
920953316 1:210594838-210594860 AGCAAGACATAAAGTGCTGAAGG - Intronic
921661362 1:217806648-217806670 ACTAATAGATAAAGAGATGATGG - Intronic
921743768 1:218714882-218714904 AATAAGGCAGGAAGTGCTGAAGG - Intergenic
922164539 1:223104152-223104174 ACTAATTCATGTAGAGCTTATGG - Intergenic
922311230 1:224393155-224393177 ACTTAGACTTGAAGACCTGATGG + Intronic
1063555222 10:7072553-7072575 ACTAAGACATGCAGAGAAGCAGG + Intergenic
1063673010 10:8115051-8115073 ACTAAGAAATAAAGAACAGAAGG - Intergenic
1064153267 10:12883123-12883145 TTTAAGAGATGAAGAACTGAAGG - Intergenic
1065875985 10:29997478-29997500 AATGAGACATGAATATCTGATGG - Intergenic
1066431544 10:35356601-35356623 AGTAAAACATGAAGAGGTTAAGG - Intronic
1067429788 10:46235535-46235557 ATTAAGAAATGGAAAGCTGAGGG - Intergenic
1068056375 10:52016856-52016878 ACAAAGAGATGAAGAGAAGAAGG + Intronic
1068701293 10:60022956-60022978 TATAAGACATTAAGGGCTGATGG - Intergenic
1069159990 10:65081625-65081647 ATAAAGACATGCAGAGTTGAAGG - Intergenic
1070720353 10:78752710-78752732 ACTGAGACATGCAGAGAAGATGG + Intergenic
1071802346 10:89077511-89077533 AGGAAGACAGGAAGAGGTGAGGG - Intergenic
1073798256 10:107012561-107012583 ATTGAGACATGAAGAGGTTAAGG + Intronic
1074053660 10:109902867-109902889 AGTAGGAGATAAAGAGCTGAGGG + Intronic
1077288710 11:1779052-1779074 ACTAAGGGATGAAGAGGGGATGG - Intergenic
1079186715 11:18244939-18244961 ACTGAGGAATGAAGAACTGAGGG + Intronic
1081694771 11:45102352-45102374 ACTAAGACAGGAAGAGCCTTTGG - Intronic
1083425249 11:62581015-62581037 ACTAAGACATGGAGAGCTAAAGG + Intronic
1085304643 11:75478120-75478142 GCTAAGACCTGAAGAGAGGAGGG - Intronic
1085524323 11:77155418-77155440 AATTAGCCATAAAGAGCTGAAGG - Intronic
1086231463 11:84575366-84575388 ACTAAGAAAAGAACAGTTGAGGG - Intronic
1086990373 11:93296691-93296713 ACTAAGACTTAAATAGTTGAAGG - Intergenic
1087006649 11:93478329-93478351 ACTCAGAAATGATGAGCAGAGGG + Intergenic
1089906607 11:122046505-122046527 AGTAAGACAGGAAGAGAAGAAGG + Intergenic
1090066360 11:123507137-123507159 ACAAACACATGGAGAGCAGAAGG - Intergenic
1090077727 11:123590109-123590131 ACTTTGACCTGAAGATCTGACGG + Intronic
1090273732 11:125405302-125405324 ACAAAGACATGAAGGAGTGAAGG - Intronic
1092017389 12:5170501-5170523 AATAAAAAATAAAGAGCTGAGGG + Intergenic
1093420343 12:18967438-18967460 ACCTAGACATGAACAGATGAAGG + Intergenic
1093893237 12:24548459-24548481 AGGAAGACATAAAGAGGTGAAGG + Intergenic
1096964398 12:55613852-55613874 ACAAAGACATGAATATCAGAAGG + Intergenic
1098732498 12:74055857-74055879 AATAAAACATGAAGATCTTAGGG + Intergenic
1099049443 12:77765599-77765621 ACAAAGACATGCAGTCCTGAAGG + Intergenic
1100771995 12:97933989-97934011 ACTAATCCTTCAAGAGCTGAGGG + Intergenic
1100782991 12:98049124-98049146 CCTGAGAGATGAAGGGCTGATGG - Intergenic
1101731853 12:107433320-107433342 AAAAAGACAAGAAGAGCAGAGGG + Intronic
1104103657 12:125639007-125639029 CCTAATATAAGAAGAGCTGAGGG - Intronic
1107658901 13:42619065-42619087 ACCAAAATATGAAGAGTTGAAGG + Intergenic
1108688115 13:52838477-52838499 ACTAAGGCAGGAAGAGGGGAAGG + Intergenic
1109298783 13:60568199-60568221 ACTACTACATGAGAAGCTGAGGG - Intronic
1111565576 13:90010480-90010502 ACTAAGACTGGAAGAGGTTAAGG - Intergenic
1114375011 14:22135574-22135596 ACTATAACATGAAGAAATGAGGG + Intergenic
1114870487 14:26649821-26649843 ACTCAGAGATGATGTGCTGACGG - Intergenic
1115157353 14:30356319-30356341 ACCCAGACATGAACAGCTGGGGG + Intergenic
1116365572 14:44058726-44058748 AGTAACACATAAAGAGGTGAAGG - Intergenic
1120225796 14:81790064-81790086 CTTAAGTAATGAAGAGCTGAAGG + Intergenic
1121599757 14:95194631-95194653 ACTGAGCCATGAAGAGCTCCAGG - Intronic
1121848950 14:97201620-97201642 AATAAGATATGGAGAGGTGAAGG - Intergenic
1124232363 15:27956470-27956492 ACTAACACCAGAGGAGCTGATGG + Intronic
1124609487 15:31198496-31198518 TCTTAGACATGGTGAGCTGAAGG - Intergenic
1125155154 15:36577710-36577732 ACTAAGACATGAAAAGGTTAAGG - Intergenic
1126124068 15:45279442-45279464 ACTCTGAGATGAAGAGCTGTTGG + Intergenic
1126477996 15:49087484-49087506 AGTAAGAAATGAATAGCAGAAGG + Intergenic
1127023692 15:54780010-54780032 CCTAAAACATGAACACCTGAAGG + Intergenic
1128228135 15:66017058-66017080 GTTAAGTCATGAAGAGCTGCTGG + Intronic
1129112184 15:73343863-73343885 ACTAAGGGAGGAAGATCTGAGGG + Intronic
1129679297 15:77648983-77649005 AATAGTACATGCAGAGCTGAGGG - Intronic
1129680048 15:77653637-77653659 GCTAAGGCAGGAAGAGCGGACGG - Intronic
1131837924 15:96409082-96409104 ACTGAAACATGAAGATCTGTTGG - Intergenic
1133411467 16:5572747-5572769 GCCAAGACATAAAGAGGTGAGGG + Intergenic
1137003011 16:35247619-35247641 AGTAAGACATGGCCAGCTGACGG - Intergenic
1139366528 16:66437189-66437211 ACTGAGACCTGGAGAGGTGAGGG - Intronic
1140012382 16:71148394-71148416 AATAAGAAATGAAGAGCATAAGG + Intronic
1141968633 16:87464498-87464520 ACGCAGACAGGAAGAGCTAAAGG + Intronic
1143382637 17:6506100-6506122 ACCAAGGCCTGAAGAGGTGAAGG + Intronic
1145125971 17:20300343-20300365 ACTAAGACATCAAGAGGGCAGGG - Intronic
1146573829 17:33974882-33974904 AGGAAGACAGGAAAAGCTGAGGG - Intronic
1147293143 17:39459928-39459950 ACTAAGGCATGGAGAAATGAAGG - Intergenic
1147472196 17:40673461-40673483 TCAAAGACAGGAAGAGCTAAGGG - Intergenic
1150075295 17:62186997-62187019 AGAAAGACATGAAAGGCTGAGGG - Intergenic
1150470083 17:65429864-65429886 ACTAAGCCAAGAAGAAGTGATGG + Intergenic
1150960651 17:69908744-69908766 ACTTAGAGATGAAGAAATGAAGG + Intergenic
1157984452 18:52421286-52421308 ATCAAGATATGAAGGGCTGATGG + Intronic
1158346062 18:56518291-56518313 ACTTGGAGAAGAAGAGCTGAGGG - Intergenic
1158558660 18:58495725-58495747 GCTAAGACATGAGGAGCGAAGGG + Intronic
1159270454 18:66142384-66142406 TGTAAAACATGAAGACCTGAAGG + Intergenic
1159870793 18:73758027-73758049 ACTAAGACATGAAACGCTCGAGG - Intergenic
1160608037 18:80066879-80066901 GATAAGATATGCAGAGCTGATGG + Intronic
1166300687 19:41910508-41910530 ACAGAGACAGTAAGAGCTGAGGG - Intronic
925275746 2:2647000-2647022 GCTAAGACATGAGGAGTTGGGGG - Intergenic
925296134 2:2778828-2778850 ACTAAGACATGGAGGCCAGAGGG - Intergenic
925325258 2:3014621-3014643 ACTAACACAGTAAGAGCTGGGGG + Intergenic
925392329 2:3504622-3504644 ACTAAGAGCAGAAGAGCTTAAGG - Intronic
925702596 2:6653881-6653903 ACAAGGACATGAAGGGCTGGGGG - Intergenic
925833360 2:7918154-7918176 AAGAGGACATGGAGAGCTGATGG - Intergenic
926750596 2:16195903-16195925 ACTGAGACTTGAAGAAATGAAGG + Intergenic
926898898 2:17727955-17727977 AGTATGAAATGAAGAGCTGGGGG - Intronic
927322736 2:21766748-21766770 AGTAAGAAATAAAGGGCTGATGG - Intergenic
927743157 2:25590589-25590611 GCTAAGAGCTGAAGAGATGATGG - Intronic
928952922 2:36830568-36830590 ACAAAGAGATGAAGAGCTGTGGG - Intergenic
932081106 2:68715891-68715913 ACTATTACATGAACAGGTGAGGG + Intronic
933391285 2:81671340-81671362 GCTGGGACATGTAGAGCTGATGG + Intergenic
935088691 2:99873506-99873528 ACTGAGGCATGCAGAGGTGAAGG - Intronic
939566326 2:143790278-143790300 ACTTTGACATGCTGAGCTGAAGG - Intergenic
939737553 2:145867168-145867190 ACAAAAAAATGAAGAGCAGAGGG + Intergenic
939885245 2:147674252-147674274 ACTAAAACATCAAGTGCTCAAGG - Intergenic
940786886 2:157990822-157990844 ACTAAGACATATAGAGTTCATGG - Intronic
942637661 2:178025464-178025486 ACTAAGAAAGGAAGAACAGAGGG - Intronic
943260638 2:185657293-185657315 ACTAAGAATTGAAGAGTTGATGG - Intergenic
943756652 2:191564182-191564204 ACCAAGAGATGAAGAGTTGAGGG + Intergenic
947074836 2:226331217-226331239 ATTAAGGCAAGAAAAGCTGAAGG + Intergenic
948211454 2:236196307-236196329 ACTCTGACAAGCAGAGCTGAGGG + Exonic
1170199418 20:13726450-13726472 AGTCAGGCATGAAGAGCTGGGGG - Intronic
1171960041 20:31486672-31486694 ACTAAGGCATGGAGAGATGGAGG - Intergenic
1172356642 20:34284973-34284995 ACAAGGACTGGAAGAGCTGAAGG - Intronic
1173311890 20:41904206-41904228 CCTAAGACAAAAAGAGCTGCAGG - Intergenic
1173716573 20:45212154-45212176 ATGAAGACATTAAGACCTGATGG - Intergenic
1175284752 20:57830596-57830618 CCTGAGAGCTGAAGAGCTGATGG + Intergenic
1176221766 20:63972677-63972699 ACTTACACAGGGAGAGCTGACGG - Intronic
1177164044 21:17579952-17579974 AGGAAGACATGAAGAGGTGATGG + Intronic
1177893028 21:26829125-26829147 ACAAAAAGAAGAAGAGCTGATGG - Intergenic
1178070383 21:28959155-28959177 ACTAAGACATCAAGAAATTAAGG + Intronic
1178571408 21:33740644-33740666 ACTTACACAGGAAGAGGTGATGG + Intronic
1178787584 21:35667815-35667837 ATAAAGACAGGAAGAGGTGATGG + Intronic
1179789535 21:43748563-43748585 ACTCAGCCAGGAAGAGCTGGCGG + Intronic
1180849699 22:19009975-19009997 AGTAAGACATCAATAGCTTATGG + Intergenic
1181584197 22:23844187-23844209 AATAAGAGAGGAAGAGCAGAGGG + Intergenic
1181665000 22:24388746-24388768 ATTAAGACATCAACAGCTTATGG + Intronic
1182013702 22:27021604-27021626 GCAGAGACATGAAGAGGTGAGGG - Intergenic
950062313 3:10082142-10082164 ACTAAGCCAGGCAAAGCTGAAGG - Intronic
951999440 3:28768832-28768854 ACTAAAAGATAAAGAGCTCAAGG + Intergenic
952244949 3:31577708-31577730 AGAAAGACATAAAGAGATGAAGG + Intronic
953193302 3:40709748-40709770 ACTTGGCCATGAAGAGCTGACGG - Intergenic
955816855 3:62852816-62852838 ACTCAGATATGAAGTGTTGAGGG - Intronic
956325285 3:68045394-68045416 AAGAATACAGGAAGAGCTGAAGG + Intronic
956649684 3:71492598-71492620 ACTAAGACAGAAAAAGATGAGGG + Intronic
956783655 3:72624424-72624446 ACTAAGCCCTGAAGAGCTTAGGG - Intergenic
958462003 3:94410102-94410124 ACTAAGTCATGAAGAGTTGAAGG + Intergenic
959110809 3:102120417-102120439 AATTAGACATCAAAAGCTGAAGG - Intronic
959207524 3:103329570-103329592 ATTAAGCCATCAAGATCTGAAGG + Intergenic
959355080 3:105316462-105316484 ACTAGGACATGAAGTCCTGCAGG - Intergenic
960505667 3:118490325-118490347 ACAAAGAAATGAAAAACTGAGGG + Intergenic
961374223 3:126451960-126451982 TCTAAGGCATGAAGAGCTGTGGG - Intronic
961460803 3:127049303-127049325 GGGAAGACAGGAAGAGCTGAAGG + Intergenic
961484577 3:127208002-127208024 ACTGAGGCATGAAGAGGTTAGGG + Intergenic
964530985 3:157667581-157667603 TCTGAGACCTGGAGAGCTGACGG - Intronic
964852336 3:161108213-161108235 AGTAAGACAGGAAGTGCTGGAGG - Intronic
965042403 3:163526637-163526659 ACTAAGAAAGGAAGAGAGGAAGG + Intergenic
965053072 3:163676500-163676522 ACTAAGACCTCAAAAGCTAAAGG + Intergenic
966086517 3:176074206-176074228 ACTAAAAAAGGAAAAGCTGAAGG + Intergenic
967243682 3:187466032-187466054 ACAAAAACATGAAGACATGAAGG - Intergenic
970542814 4:17096319-17096341 GCTAAGACATTAAGGGCTCAGGG - Intergenic
972907282 4:43766702-43766724 ATTAACACAGGAAGAGATGAAGG - Intergenic
973532473 4:51846504-51846526 AATAAGCCAAGAAGAGCTGCTGG - Intronic
975040836 4:69743351-69743373 ACTCAGACCAGAAGAGATGACGG - Intronic
976125667 4:81831564-81831586 ACTAAAGCATGAAGACCTAATGG - Intronic
976710433 4:88065145-88065167 AGTAAGTCATGAAGAACTAAAGG - Intronic
978481995 4:109203404-109203426 TCTCAGAAATTAAGAGCTGATGG + Intronic
978889265 4:113803307-113803329 ACAAAGTCATGAATAGCAGAAGG + Intergenic
980604283 4:135068991-135069013 ACTAAAACATGATGACATGATGG - Intergenic
980843802 4:138299868-138299890 ACTAAGAGATAAAGAGTTGAGGG - Intergenic
982089794 4:151870575-151870597 ACAAAGACATAAAGAAATGAAGG - Intergenic
986067503 5:4249645-4249667 ACTATGACAAGAAGAGCACAGGG - Intergenic
986577325 5:9225950-9225972 CCTGAGACATAAAGAGCTGAAGG - Intronic
987830441 5:23088309-23088331 TCTAAGAAATGCAGAGCAGAGGG - Intergenic
989341570 5:40381280-40381302 ACTAAAACCTGAAGAGTTGTTGG + Intergenic
990675019 5:58174414-58174436 ACTGAGACAGGAAGCCCTGAAGG - Intergenic
993607317 5:90007724-90007746 ATTAGAACAGGAAGAGCTGAAGG + Intergenic
994548053 5:101194089-101194111 GCTAAGACATGAAGATTTGTTGG - Intergenic
995318694 5:110805622-110805644 GCTGATACATGAAGAGTTGATGG - Intergenic
996888955 5:128394457-128394479 ACTGAGACATTATAAGCTGAAGG + Intronic
997404593 5:133635109-133635131 ACTTAGACATAAAGAACAGATGG - Intergenic
998929112 5:147160933-147160955 ATTATGACAAGAAGAGTTGAAGG - Intergenic
999007974 5:148003285-148003307 AGTTAGACAGGAAAAGCTGAAGG + Intergenic
999457284 5:151727906-151727928 ACCATGAGTTGAAGAGCTGATGG + Intergenic
1000336914 5:160248266-160248288 ACTGAGAGATGCAGAGCCGAAGG - Intergenic
1000754031 5:165134093-165134115 ACTCAGAAATGAAGGGCTTAAGG + Intergenic
1000930117 5:167241460-167241482 GCTAAGTCCTGAAGAGCAGAAGG + Intergenic
1003295981 6:4829005-4829027 AGAAAGATATGAAGAACTGAAGG - Intronic
1005008835 6:21316261-21316283 ATTAAGACAAAAAGAGCTGGGGG - Intergenic
1005472884 6:26179247-26179269 ACAAAGACATTAAGGGTTGAGGG + Intergenic
1005985969 6:30875173-30875195 ACTAAGAGAGGAAGATGTGAAGG - Intergenic
1006261091 6:32871348-32871370 ATTAAGACATACAGAGATGAGGG + Intergenic
1007139006 6:39552925-39552947 CCAAGGACATGAAAAGCTGAAGG + Intronic
1011996703 6:93598719-93598741 ACAAAGAAATGAAAAACTGAAGG + Intergenic
1012030171 6:94050215-94050237 ACCAAGACAGAAAGAGCTGAAGG + Intergenic
1013047638 6:106503151-106503173 ACTAAGAGATGGAGAGATTAGGG + Intergenic
1013075409 6:106766483-106766505 ACTAGGAAATAAAGAGATGAAGG - Intergenic
1014046134 6:116889556-116889578 ATTAAGAAATGAGGACCTGATGG + Intronic
1014952438 6:127572649-127572671 ACTAAGAGCTGATGAGATGAGGG - Intronic
1015548521 6:134387324-134387346 ACTTAGAAATGAGGAGCTGACGG + Intergenic
1016157634 6:140832137-140832159 GGTAAGACATGAAGTGGTGATGG - Intergenic
1017625232 6:156341187-156341209 ACTAAGACCTTAGGAGCTGCTGG + Intergenic
1018778460 6:167041439-167041461 ACTAAGACATGAAGAGCTGAAGG - Exonic
1020452979 7:8340964-8340986 ACAAAGTCATTAAGATCTGAAGG - Intergenic
1021331244 7:19341089-19341111 AGTTAGACAGGAAAAGCTGAAGG + Intergenic
1027598692 7:80211126-80211148 CTTGAAACATGAAGAGCTGAAGG + Intronic
1030039017 7:105433403-105433425 AGTAAGCCATGAAGAGCAAATGG - Intergenic
1030824116 7:114133804-114133826 ACAAAGAGAGGAAGACCTGAAGG - Intronic
1031485174 7:122316225-122316247 ACTGAGAGATGAGGAGGTGAGGG - Intergenic
1032685947 7:134233819-134233841 AATTAGACACGAAGAGCAGAGGG - Intronic
1033516992 7:142116597-142116619 TATCAGACATGAAGAACTGAAGG - Intronic
1034284882 7:149878230-149878252 CCCAAGACGTGAGGAGCTGACGG - Intronic
1035017711 7:155781182-155781204 ATTGAGACATGGAGAGATGACGG + Exonic
1035969672 8:4233940-4233962 ACTAATGCATGGAGAGCTTAAGG + Intronic
1037046169 8:14306604-14306626 AACAAGACATGACAAGCTGATGG + Intronic
1038195226 8:25360966-25360988 ACTAAGACCTGGAGAAATGAGGG + Intronic
1038797699 8:30724400-30724422 AATAAGAGATGAGAAGCTGATGG - Intronic
1039410782 8:37353386-37353408 AATAAGACAAGAAGACCTTATGG + Intergenic
1039777687 8:40752784-40752806 ACTCAGGTAAGAAGAGCTGAGGG - Intronic
1041553730 8:59129534-59129556 CCTAGAACATGAAGAGCTGGAGG - Intergenic
1041583206 8:59486357-59486379 ACAAGGACATGAATACCTGAAGG - Intergenic
1041923176 8:63205728-63205750 ACTAAGAAATGATGAGCTACCGG - Intronic
1043234012 8:77838090-77838112 CCTAAGTGGTGAAGAGCTGAAGG + Intergenic
1045679669 8:104645266-104645288 AATTAGACTTGAAGATCTGAGGG - Intronic
1048161291 8:132024409-132024431 GCTGAGAGATAAAGAGCTGAAGG + Exonic
1049819159 8:144624003-144624025 GCTAAGACCTGGAGAGCTGACGG + Intergenic
1050290681 9:4151041-4151063 ATGAAGAGATGAAGAGCTGAAGG + Intronic
1050494740 9:6229202-6229224 ACTGAGACCTGGAGAGCTGTAGG + Intronic
1052186546 9:25603407-25603429 ACTAAGACATACACAACTGATGG + Intergenic
1052805207 9:33007096-33007118 ACAAACACATGAAGACTTGATGG + Intronic
1053438101 9:38090730-38090752 ACTAAGATATAAAAAGCTGGAGG - Intergenic
1055232205 9:74078808-74078830 ACTATCTCCTGAAGAGCTGAGGG - Intergenic
1057189793 9:93080454-93080476 ACTATGCCATGAAAAACTGAAGG - Intronic
1058561511 9:106233606-106233628 ATTAAGCCATGGAGGGCTGAAGG + Intergenic
1058671080 9:107360849-107360871 ACTAAGACATGAACATCTTTGGG + Intergenic
1058892310 9:109371441-109371463 ACAAAGACAGGAAGAGATGCAGG + Intergenic
1060770632 9:126329282-126329304 AATCAGTCAAGAAGAGCTGAAGG + Intronic
1061768889 9:132901822-132901844 ACTAAGACATCAAATTCTGAGGG - Intronic
1062676193 9:137745896-137745918 ACTCAGCAATGAAGAGCTGCTGG - Intronic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1187856716 X:23644044-23644066 ACTAACCCAAAAAGAGCTGATGG + Intergenic
1189693488 X:43640261-43640283 TCTATGACTTGAAGAGGTGAGGG - Intergenic
1193848678 X:86507853-86507875 ACTAGGGCATGAAGGGATGAAGG + Intronic
1195010369 X:100727847-100727869 ACTGAGACAGGGAGTGCTGAGGG + Intronic
1195628776 X:107032043-107032065 ACTAACACCTGAAGAGAGGATGG - Intergenic
1196383023 X:115114149-115114171 ACTAAGACATGGATCGCAGAAGG - Intronic
1197875027 X:131093177-131093199 AGTAAAACATCAAGAGATGATGG - Intergenic
1198128965 X:133675223-133675245 ACTAAGGCCAGAGGAGCTGACGG - Intronic
1198167478 X:134071790-134071812 ACTAAGGCATGAAGAGGTTAAGG - Intergenic
1199333747 X:146593914-146593936 ACTAAGAGATTAAGAGATGTGGG - Intergenic