ID: 1018778668

View in Genome Browser
Species Human (GRCh38)
Location 6:167043184-167043206
Sequence TGGTTCATGAAGGACATGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018778659_1018778668 18 Left 1018778659 6:167043143-167043165 CCTCTGAAGGAGGTGCCCTCTGT 0: 1
1: 0
2: 1
3: 23
4: 171
Right 1018778668 6:167043184-167043206 TGGTTCATGAAGGACATGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 143
1018778663_1018778668 2 Left 1018778663 6:167043159-167043181 CCTCTGTGTGGCTCTGCTGTGGT 0: 1
1: 0
2: 4
3: 29
4: 285
Right 1018778668 6:167043184-167043206 TGGTTCATGAAGGACATGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 143
1018778661_1018778668 3 Left 1018778661 6:167043158-167043180 CCCTCTGTGTGGCTCTGCTGTGG 0: 1
1: 0
2: 7
3: 39
4: 343
Right 1018778668 6:167043184-167043206 TGGTTCATGAAGGACATGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018778668 Original CRISPR TGGTTCATGAAGGACATGGG AGG Exonic
902060156 1:13635142-13635164 TGGTTCATGAAGGACTTCCACGG + Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906106744 1:43299328-43299350 TGGTTCTTGGAAGACCTGGGGGG - Intergenic
908429641 1:64043310-64043332 TGGTTGATGAAGTAAATGGAAGG - Intronic
908982611 1:69976971-69976993 GGGTTCCTGGAGGACATAGGTGG - Intronic
909672063 1:78200468-78200490 TGGTTTAGGAAGGGGATGGGGGG - Intergenic
911947126 1:104126058-104126080 TCTTTCATGAAGGACCTGGTAGG + Intergenic
912411127 1:109481351-109481373 TGGTTACTCAAGGACAAGGGGGG + Exonic
912495158 1:110086909-110086931 TGGGTCCTGAAGGACATGCAGGG + Intergenic
915290001 1:154877201-154877223 GGTTTCATGGAGGACCTGGGTGG - Intergenic
916894972 1:169152611-169152633 TGGATCATAGAGGACAGGGGAGG + Intronic
918771400 1:188565446-188565468 TGGTTCATGAATAACTTGTGTGG - Intergenic
922697517 1:227738687-227738709 TGGTGCATGCAGATCATGGGAGG + Intronic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
1064577018 10:16756906-16756928 TGGTGTGTGAAGGACGTGGGGGG + Intronic
1072805272 10:98420040-98420062 TGGTTCGAGAATGACATGGTAGG - Exonic
1076391696 10:130108196-130108218 TGGTTCCTGGAGGAGGTGGGGGG - Intergenic
1076464022 10:130666209-130666231 TGGGTCATCAGGAACATGGGTGG + Intergenic
1078042778 11:7884064-7884086 TGGTCCATGGCGGCCATGGGTGG + Intergenic
1079379444 11:19924523-19924545 TGGTTCATGCAGGACAGAGGAGG + Intronic
1079712651 11:23706220-23706242 TGGTTCAGGAAGGACACAAGAGG - Intergenic
1080571335 11:33559672-33559694 TGTTTCATGGAGGCCATGGGAGG - Intronic
1081599928 11:44485880-44485902 TGGTTTAGGAAGGCCAGGGGTGG - Intergenic
1087152707 11:94872833-94872855 GGGTTGAGGATGGACATGGGTGG + Exonic
1091622046 12:2096420-2096442 TCCTTCAGGAAGGAGATGGGAGG - Intronic
1099618749 12:84974556-84974578 TGTTTCCTGAAGGCCATGTGTGG - Intergenic
1103049762 12:117768880-117768902 TTGTCCAAGAAGGACATGTGGGG + Intronic
1106993975 13:35459138-35459160 TGGGTCATGAAGGAGATGACTGG - Intronic
1108994983 13:56718802-56718824 TGGTTTTAGCAGGACATGGGTGG + Intergenic
1112603410 13:100879564-100879586 TGGTTCCTGCAGGACAGGGTGGG - Intergenic
1113506230 13:110818390-110818412 TTCTTCAGGAAGGACATGGTTGG - Intergenic
1116081554 14:40180279-40180301 AGGAACATGAAGGACATGAGAGG - Intergenic
1117041746 14:51774564-51774586 TGGTTCATGAGAGCCATGGGGGG + Intergenic
1119494047 14:75063640-75063662 TGGTTAAGGATGGACAGGGGTGG - Intronic
1119982034 14:79092785-79092807 TTGTTCATGAAGGACTTGCATGG + Intronic
1124808798 15:32913475-32913497 TGGTGCATGGAGAACATGGTAGG - Intronic
1125135151 15:36332840-36332862 TGGGTCATGAATGTCAAGGGTGG - Intergenic
1125394782 15:39234989-39235011 TTGTCCTTGAAGGACCTGGGGGG - Intergenic
1126403638 15:48300510-48300532 TGGTTTATGTAGGGCATGGTGGG - Intronic
1130635776 15:85618532-85618554 TGGATCATGAATGATTTGGGAGG - Intronic
1133295876 16:4752048-4752070 TGGCTCCTGAAGGGCCTGGGAGG - Exonic
1138193736 16:55036803-55036825 AGGCTCCTGAAGGACAAGGGTGG + Intergenic
1139531221 16:67543643-67543665 ATGGGCATGAAGGACATGGGAGG - Intronic
1142609703 17:1102086-1102108 TGGCTCATAAAGGATATGGTGGG - Intronic
1142619166 17:1154159-1154181 AGGATCATGAAGGACCTGGGAGG - Intronic
1143869696 17:9949474-9949496 TGGTTCAGGAAGCTCCTGGGTGG + Intronic
1144422652 17:15112160-15112182 TGGTTAAAGAAAGACATAGGAGG + Intergenic
1144457392 17:15430301-15430323 TGCTTCAGGGAGGAGATGGGTGG + Intergenic
1147806297 17:43134247-43134269 TGGATCATGAAGGAGGGGGGCGG - Intergenic
1148394935 17:47300219-47300241 AGTTTAATGAAGGACCTGGGAGG + Intronic
1149382644 17:56109285-56109307 TGGTTACTCAGGGACATGGGTGG + Intergenic
1149597354 17:57872255-57872277 GGGTTCATGAAGGCCAGGGCGGG - Intronic
1150357819 17:64503248-64503270 TGCTTCATCAAGGACAAGGTAGG + Exonic
1150398592 17:64839336-64839358 TGGATCATGAAGGAGGGGGGCGG + Intergenic
1157118588 18:44886204-44886226 TTCTTCATGTAGCACATGGGAGG + Intronic
1157130556 18:45003482-45003504 TGGTTCATGATGGTGTTGGGTGG - Intronic
1158951419 18:62499020-62499042 TGGTTCATGAAATACATTAGAGG - Intergenic
1160071524 18:75633049-75633071 TGGTTTAAGTGGGACATGGGTGG + Intergenic
1163618584 19:18344099-18344121 TGGTTCAGGAAGGACCAGGCAGG + Intronic
1165395420 19:35561091-35561113 TGGGACATGAGGGACATGGGAGG - Intronic
1165422215 19:35727884-35727906 AGCTTCATGGAGGACATGGTGGG + Exonic
1166190814 19:41175394-41175416 TGGTTCAGCATGGACATCGGTGG + Intergenic
1168550796 19:57291671-57291693 TCTTTCATGCAGGACATAGGTGG - Exonic
925471694 2:4169139-4169161 TGGTTCATGGAGGTCATGAAAGG - Intergenic
929531484 2:42755772-42755794 TGGTTCAGTGAGCACATGGGTGG + Exonic
932194549 2:69772036-69772058 AGGGTTATGAAGAACATGGGTGG - Intronic
939529150 2:143335821-143335843 TGGTTCATGAAGGACTTGAAGGG + Intronic
941317719 2:164015572-164015594 TGGTCCATGAAGGATGTGGGTGG + Intergenic
943755353 2:191551396-191551418 TGGTACAGCAAGAACATGGGAGG + Intergenic
945067640 2:205960600-205960622 TGGTCCCTGAATGATATGGGGGG + Intergenic
1170734379 20:19001535-19001557 TGGTTCATGATGGCCTTGGCTGG - Intergenic
1170812843 20:19687983-19688005 TGCTTCAGGAAGGACACAGGAGG - Intronic
1171075940 20:22123362-22123384 TGGATCAGGAAGAAAATGGGAGG - Intergenic
1172476578 20:35242837-35242859 TGGTCCAAGGAGCACATGGGAGG + Intronic
1173556215 20:43967685-43967707 TGGTTTATTAATGAGATGGGTGG - Intronic
1174076947 20:47944071-47944093 TGCTGCATGGAGGAGATGGGAGG - Intergenic
1174120414 20:48260647-48260669 TGGGTGACGAAGGACACGGGAGG - Intergenic
1174450097 20:50614508-50614530 TAATTCATTAAGGACATGTGGGG + Intronic
1175243286 20:57565481-57565503 TGGTTCCGGAAGGACAAGGAAGG + Exonic
1175723645 20:61302619-61302641 CGGGCCATGCAGGACATGGGAGG - Intronic
1175951367 20:62585113-62585135 TGTGTCATGAGGGACATGTGTGG - Intergenic
1177329466 21:19638634-19638656 TGGTTCATGAAGGAGGTGGATGG + Intergenic
1181473125 22:23152894-23152916 TGGTCCACGCAGGCCATGGGTGG - Intronic
949616036 3:5754712-5754734 TTGTTTCTGAAGGACAGGGGAGG + Intergenic
954400467 3:50317006-50317028 TGAGTCATCACGGACATGGGCGG + Intergenic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
958605470 3:96352876-96352898 TGGTTCATGAGGGAGTGGGGGGG + Intergenic
962635411 3:137326220-137326242 TGGAGCATGAAGCACATGTGAGG - Intergenic
964409996 3:156388101-156388123 TTGTTCATGAAGACCAAGGGAGG + Intronic
967576116 3:191095957-191095979 TAGTTCATGAAGTCCATTGGAGG + Intergenic
967893535 3:194380092-194380114 AGGTTCAAGAAAGACATGGAAGG + Intergenic
968002302 3:195214416-195214438 TGGTTTAGGATGGACATGGGTGG - Intronic
968544909 4:1193708-1193730 GGGTGTAGGAAGGACATGGGCGG + Intronic
968704332 4:2070998-2071020 TGGGTAAGGAAGTACATGGGAGG + Intergenic
972572279 4:40321330-40321352 TGGGTGATGGGGGACATGGGAGG + Intergenic
979530080 4:121760811-121760833 CAGATCCTGAAGGACATGGGTGG - Intronic
983335317 4:166384342-166384364 TGGTTCAGGAAGGACATAATAGG + Intergenic
984607118 4:181797941-181797963 TGGTTCAGGAATGAAGTGGGGGG + Intergenic
984719393 4:182955824-182955846 TGGTTTGTTAAGGACATGGAAGG + Intergenic
985350301 4:189054086-189054108 TTGATCGTGAGGGACATGGGAGG - Intergenic
986561170 5:9061944-9061966 TGGTACATGGAGGCCATGTGGGG + Intronic
986823897 5:11499578-11499600 GGGTTCATGAATGAAATGGCAGG - Intronic
986925860 5:12749659-12749681 TCTTTTATGAAGGACATGGCAGG + Intergenic
987687380 5:21222781-21222803 TGGTTCATGAAATATGTGGGAGG - Intergenic
990900477 5:60743901-60743923 TGGACCAAGCAGGACATGGGCGG - Intergenic
994513504 5:100739802-100739824 TGGTACATGAGGGATTTGGGGGG - Intergenic
995047428 5:107668990-107669012 CGGTTCATTTAGGACTTGGGCGG + Intronic
997612114 5:135222607-135222629 TGGTTCAGGAGGAACATGCGTGG + Intronic
999780071 5:154842090-154842112 TGGATCATTAAGCACAAGGGAGG + Intronic
1000251483 5:159499854-159499876 TGTTTCATGAAGGGCAAGTGGGG - Intergenic
1001706658 5:173745965-173745987 TTCTTCAGGAAGGAAATGGGTGG - Intergenic
1002274329 5:178094648-178094670 TTGTTCATGAATGGGATGGGAGG + Intergenic
1002317640 5:178354075-178354097 TGGTTGCTGAAGGACAGGGGTGG + Intronic
1004401703 6:15294645-15294667 AGGTTGATGCAGGACATGGAAGG + Intronic
1005563927 6:27069766-27069788 TGGTGAATGGAGGAGATGGGAGG - Intergenic
1005842195 6:29750994-29751016 TGGATCATGGTGGACATTGGGGG + Intergenic
1006072799 6:31509157-31509179 TGGGTGCTGAAGGTCATGGGAGG + Intronic
1007807740 6:44463140-44463162 AGTATCATGAAGGGCATGGGCGG - Intergenic
1010646991 6:78401220-78401242 CGGTTCAGGGAGCACATGGGTGG + Intergenic
1015305975 6:131708833-131708855 TGGTTCCTGGAGGAGGTGGGGGG + Exonic
1018778668 6:167043184-167043206 TGGTTCATGAAGGACATGGGAGG + Exonic
1018938096 6:168287140-168287162 TGGTTCCTGGAGGAGGTGGGGGG + Intergenic
1027729009 7:81845893-81845915 ACGTTAATGAAGGACATGAGAGG - Intergenic
1032069319 7:128794127-128794149 TGGTCCAGGAAGGGCCTGGGAGG + Intronic
1033444087 7:141405123-141405145 TGGTTCAAGTAGGAGAGGGGAGG - Intronic
1033550871 7:142446410-142446432 TCTTTCATGAAGGATATGTGAGG + Intergenic
1033679002 7:143573980-143574002 TGGTTCCTGGAGGAGGTGGGGGG - Exonic
1033692836 7:143755474-143755496 TGGTTCCTGGAGGAGGTGGGGGG + Exonic
1033731575 7:144185666-144185688 TGGTTCCTGGAGGAGGTGGGGGG - Exonic
1033740090 7:144267066-144267088 TGGTTCCTGGAGGAGGTGGGGGG + Exonic
1036534339 8:9631277-9631299 TGGCTCATGATTGACATGGCTGG - Intronic
1037726178 8:21484275-21484297 TGGTTCATGAAGATGAAGGGAGG - Intergenic
1040031963 8:42832865-42832887 TGGTTTAGGAAGGGGATGGGGGG + Intergenic
1041942984 8:63409182-63409204 TGGATCATGGTGGACATCGGGGG - Intergenic
1041947528 8:63462829-63462851 TTTTTCCTGAAGGAAATGGGAGG - Intergenic
1043765717 8:84129738-84129760 TGGGTCATGAAGGAGAGGAGAGG - Intergenic
1043970547 8:86523893-86523915 TGGATCTTGAAGAACTTGGGTGG + Intronic
1044464712 8:92489619-92489641 TGATTCAGGAAGAACAAGGGTGG + Intergenic
1047905169 8:129465501-129465523 TGTCTCATGTGGGACATGGGTGG - Intergenic
1048140980 8:131793973-131793995 AGCTTCAAGAAGGAGATGGGAGG + Intergenic
1050839065 9:10123536-10123558 TGGTTCATGAAGGACAGGGCTGG - Intronic
1052365569 9:27608618-27608640 TGGTTCCTGGAGGAGGTGGGGGG + Intergenic
1053709204 9:40788278-40788300 TCGCTCATGAAGAACATGAGAGG + Intergenic
1057271087 9:93651864-93651886 TGGTGTTTGAAGGACATGGCTGG + Intronic
1060676811 9:125522814-125522836 TGGGTCATAAAGGACATAGATGG - Intronic
1061766644 9:132885861-132885883 TGGTTCAGGGAGGGCAGGGGAGG - Intronic
1186938006 X:14472516-14472538 AGGTTCAGGAAGGAGGTGGGAGG - Intergenic
1190099369 X:47509351-47509373 TGGTTCAACCAGGACAAGGGAGG - Intergenic
1190256767 X:48769157-48769179 GGATTCATGAAGAACATGGCAGG + Intronic
1192446129 X:71212792-71212814 TGGGTCATAAAGGAGATGGAGGG - Intergenic
1192591692 X:72365514-72365536 GGCTTCATGGAGGAGATGGGAGG + Intronic
1194482207 X:94440406-94440428 TGGATCATGAAAGACATGATAGG - Intergenic
1196277859 X:113789688-113789710 TGCTTCATGAGAGAAATGGGAGG + Intergenic
1197164528 X:123361859-123361881 TGGTCCATGAAGATCTTGGGGGG - Intronic
1198153294 X:133932409-133932431 TGTTTGAGAAAGGACATGGGAGG + Intronic
1199565350 X:149209953-149209975 TGGTCCATAAAGGACTTGAGAGG - Intergenic