ID: 1018780963

View in Genome Browser
Species Human (GRCh38)
Location 6:167064985-167065007
Sequence TAGACACTTACCCTGGATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018780963_1018780967 14 Left 1018780963 6:167064985-167065007 CCCGTATCCAGGGTAAGTGTCTA No data
Right 1018780967 6:167065022-167065044 AAGTGCTGTCCTTTCCATGATGG No data
1018780963_1018780968 20 Left 1018780963 6:167064985-167065007 CCCGTATCCAGGGTAAGTGTCTA No data
Right 1018780968 6:167065028-167065050 TGTCCTTTCCATGATGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018780963 Original CRISPR TAGACACTTACCCTGGATAC GGG (reversed) Intergenic
No off target data available for this crispr