ID: 1018786185

View in Genome Browser
Species Human (GRCh38)
Location 6:167109810-167109832
Sequence CCTGGCATGCTCCGCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018786185_1018786190 -4 Left 1018786185 6:167109810-167109832 CCCATCCTGCGGAGCATGCCAGG No data
Right 1018786190 6:167109829-167109851 CAGGAGTTCCTTCTGCTTTCTGG No data
1018786185_1018786194 14 Left 1018786185 6:167109810-167109832 CCCATCCTGCGGAGCATGCCAGG No data
Right 1018786194 6:167109847-167109869 TCTGGCTGGGTAGCATTCCACGG No data
1018786185_1018786191 0 Left 1018786185 6:167109810-167109832 CCCATCCTGCGGAGCATGCCAGG No data
Right 1018786191 6:167109833-167109855 AGTTCCTTCTGCTTTCTGGCTGG No data
1018786185_1018786195 15 Left 1018786185 6:167109810-167109832 CCCATCCTGCGGAGCATGCCAGG No data
Right 1018786195 6:167109848-167109870 CTGGCTGGGTAGCATTCCACGGG No data
1018786185_1018786192 1 Left 1018786185 6:167109810-167109832 CCCATCCTGCGGAGCATGCCAGG No data
Right 1018786192 6:167109834-167109856 GTTCCTTCTGCTTTCTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018786185 Original CRISPR CCTGGCATGCTCCGCAGGAT GGG (reversed) Intergenic
No off target data available for this crispr