ID: 1018787300

View in Genome Browser
Species Human (GRCh38)
Location 6:167118027-167118049
Sequence GCAGAAGGACAGACTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018787300_1018787308 26 Left 1018787300 6:167118027-167118049 CCAGCTTCAGTCTGTCCTTCTGC No data
Right 1018787308 6:167118076-167118098 GCAGTTCCATCGGCGTCTCTGGG No data
1018787300_1018787307 25 Left 1018787300 6:167118027-167118049 CCAGCTTCAGTCTGTCCTTCTGC No data
Right 1018787307 6:167118075-167118097 AGCAGTTCCATCGGCGTCTCTGG No data
1018787300_1018787304 16 Left 1018787300 6:167118027-167118049 CCAGCTTCAGTCTGTCCTTCTGC No data
Right 1018787304 6:167118066-167118088 CAACATCCCAGCAGTTCCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018787300 Original CRISPR GCAGAAGGACAGACTGAAGC TGG (reversed) Intergenic
No off target data available for this crispr